ID: 929824929

View in Genome Browser
Species Human (GRCh38)
Location 2:45302651-45302673
Sequence CCAGAATGCCCCTGGGTATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929824929_929824936 -4 Left 929824929 2:45302651-45302673 CCTAATACCCAGGGGCATTCTGG No data
Right 929824936 2:45302670-45302692 CTGGGAAATCAGTGGGAAGCAGG No data
929824929_929824937 9 Left 929824929 2:45302651-45302673 CCTAATACCCAGGGGCATTCTGG No data
Right 929824937 2:45302683-45302705 GGGAAGCAGGAAAACCTCCCTGG No data
929824929_929824938 10 Left 929824929 2:45302651-45302673 CCTAATACCCAGGGGCATTCTGG No data
Right 929824938 2:45302684-45302706 GGAAGCAGGAAAACCTCCCTGGG No data
929824929_929824939 11 Left 929824929 2:45302651-45302673 CCTAATACCCAGGGGCATTCTGG No data
Right 929824939 2:45302685-45302707 GAAGCAGGAAAACCTCCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929824929 Original CRISPR CCAGAATGCCCCTGGGTATT AGG (reversed) Intergenic
No off target data available for this crispr