ID: 929824936

View in Genome Browser
Species Human (GRCh38)
Location 2:45302670-45302692
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929824925_929824936 6 Left 929824925 2:45302641-45302663 CCTTGGGCAACCTAATACCCAGG No data
Right 929824936 2:45302670-45302692 CTGGGAAATCAGTGGGAAGCAGG No data
929824929_929824936 -4 Left 929824929 2:45302651-45302673 CCTAATACCCAGGGGCATTCTGG No data
Right 929824936 2:45302670-45302692 CTGGGAAATCAGTGGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type