ID: 929825766

View in Genome Browser
Species Human (GRCh38)
Location 2:45308618-45308640
Sequence GTGATTAAGAATGTGGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929825762_929825766 10 Left 929825762 2:45308585-45308607 CCAGCTAAACTCTTCAGCCAACT No data
Right 929825766 2:45308618-45308640 GTGATTAAGAATGTGGATGCTGG No data
929825764_929825766 -7 Left 929825764 2:45308602-45308624 CCAACTAGACAAATTGGTGATTA No data
Right 929825766 2:45308618-45308640 GTGATTAAGAATGTGGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929825766 Original CRISPR GTGATTAAGAATGTGGATGC TGG Intergenic
No off target data available for this crispr