ID: 929826559

View in Genome Browser
Species Human (GRCh38)
Location 2:45313451-45313473
Sequence AAGGGTTAGGATTTGGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929826550_929826559 13 Left 929826550 2:45313415-45313437 CCAAGGAAACAACAATAAATAGT No data
Right 929826559 2:45313451-45313473 AAGGGTTAGGATTTGGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929826559 Original CRISPR AAGGGTTAGGATTTGGGAGG AGG Intergenic
No off target data available for this crispr