ID: 929827468

View in Genome Browser
Species Human (GRCh38)
Location 2:45320265-45320287
Sequence GAAATTAAACAGCTTGCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929827468_929827472 11 Left 929827468 2:45320265-45320287 CCTGGTGCAAGCTGTTTAATTTC No data
Right 929827472 2:45320299-45320321 GTCTCTCTGCATGCCAGATGGGG No data
929827468_929827471 10 Left 929827468 2:45320265-45320287 CCTGGTGCAAGCTGTTTAATTTC No data
Right 929827471 2:45320298-45320320 GGTCTCTCTGCATGCCAGATGGG No data
929827468_929827473 17 Left 929827468 2:45320265-45320287 CCTGGTGCAAGCTGTTTAATTTC No data
Right 929827473 2:45320305-45320327 CTGCATGCCAGATGGGGAACTGG No data
929827468_929827470 9 Left 929827468 2:45320265-45320287 CCTGGTGCAAGCTGTTTAATTTC No data
Right 929827470 2:45320297-45320319 CGGTCTCTCTGCATGCCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929827468 Original CRISPR GAAATTAAACAGCTTGCACC AGG (reversed) Intergenic
No off target data available for this crispr