ID: 929828943

View in Genome Browser
Species Human (GRCh38)
Location 2:45332073-45332095
Sequence CTGTAACACCAGGAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929828936_929828943 2 Left 929828936 2:45332048-45332070 CCATTCAGTGTTCCCTTTTCAAT No data
Right 929828943 2:45332073-45332095 CTGTAACACCAGGAGGAGGAAGG No data
929828937_929828943 -10 Left 929828937 2:45332060-45332082 CCCTTTTCAATGCCTGTAACACC No data
Right 929828943 2:45332073-45332095 CTGTAACACCAGGAGGAGGAAGG No data
929828935_929828943 3 Left 929828935 2:45332047-45332069 CCCATTCAGTGTTCCCTTTTCAA No data
Right 929828943 2:45332073-45332095 CTGTAACACCAGGAGGAGGAAGG No data
929828933_929828943 14 Left 929828933 2:45332036-45332058 CCGTTCTCCTGCCCATTCAGTGT No data
Right 929828943 2:45332073-45332095 CTGTAACACCAGGAGGAGGAAGG No data
929828934_929828943 7 Left 929828934 2:45332043-45332065 CCTGCCCATTCAGTGTTCCCTTT No data
Right 929828943 2:45332073-45332095 CTGTAACACCAGGAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929828943 Original CRISPR CTGTAACACCAGGAGGAGGA AGG Intergenic
No off target data available for this crispr