ID: 929829995

View in Genome Browser
Species Human (GRCh38)
Location 2:45339437-45339459
Sequence CTCCGTGCTCACAGAGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929829995_929830000 -1 Left 929829995 2:45339437-45339459 CCTTTCCCTCTGTGAGCACGGAG No data
Right 929830000 2:45339459-45339481 GTGCATGCCACTGTGGCGGCAGG No data
929829995_929829998 -8 Left 929829995 2:45339437-45339459 CCTTTCCCTCTGTGAGCACGGAG No data
Right 929829998 2:45339452-45339474 GCACGGAGTGCATGCCACTGTGG No data
929829995_929830005 17 Left 929829995 2:45339437-45339459 CCTTTCCCTCTGTGAGCACGGAG No data
Right 929830005 2:45339477-45339499 GCAGGAGGGAGTGCTGCAATGGG No data
929829995_929830004 16 Left 929829995 2:45339437-45339459 CCTTTCCCTCTGTGAGCACGGAG No data
Right 929830004 2:45339476-45339498 GGCAGGAGGGAGTGCTGCAATGG No data
929829995_929829999 -5 Left 929829995 2:45339437-45339459 CCTTTCCCTCTGTGAGCACGGAG No data
Right 929829999 2:45339455-45339477 CGGAGTGCATGCCACTGTGGCGG No data
929829995_929830002 3 Left 929829995 2:45339437-45339459 CCTTTCCCTCTGTGAGCACGGAG No data
Right 929830002 2:45339463-45339485 ATGCCACTGTGGCGGCAGGAGGG No data
929829995_929830001 2 Left 929829995 2:45339437-45339459 CCTTTCCCTCTGTGAGCACGGAG No data
Right 929830001 2:45339462-45339484 CATGCCACTGTGGCGGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929829995 Original CRISPR CTCCGTGCTCACAGAGGGAA AGG (reversed) Intergenic
No off target data available for this crispr