ID: 929830435

View in Genome Browser
Species Human (GRCh38)
Location 2:45342731-45342753
Sequence AAGCTGATCTGTGGGAGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929830435_929830441 20 Left 929830435 2:45342731-45342753 CCTTGTCTCCCACAGATCAGCTT No data
Right 929830441 2:45342774-45342796 ATAATCCCTAAGCCCTAGAAGGG No data
929830435_929830440 19 Left 929830435 2:45342731-45342753 CCTTGTCTCCCACAGATCAGCTT No data
Right 929830440 2:45342773-45342795 CATAATCCCTAAGCCCTAGAAGG No data
929830435_929830438 -5 Left 929830435 2:45342731-45342753 CCTTGTCTCCCACAGATCAGCTT No data
Right 929830438 2:45342749-45342771 AGCTTAAAGTATACTTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929830435 Original CRISPR AAGCTGATCTGTGGGAGACA AGG (reversed) Intergenic
No off target data available for this crispr