ID: 929836573

View in Genome Browser
Species Human (GRCh38)
Location 2:45406522-45406544
Sequence CAGGGTTTTCAGCAAGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 5, 3: 29, 4: 296}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929836573_929836576 -10 Left 929836573 2:45406522-45406544 CCATCCTCTTGCTGAAAACCCTG 0: 1
1: 0
2: 5
3: 29
4: 296
Right 929836576 2:45406535-45406557 GAAAACCCTGCTCTGGCTCTAGG 0: 1
1: 0
2: 1
3: 22
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929836573 Original CRISPR CAGGGTTTTCAGCAAGAGGA TGG (reversed) Intronic
900605532 1:3521950-3521972 CAGGGACTTCAGGGAGAGGAAGG + Intronic
900837628 1:5017949-5017971 GAGGGTTTTCAGCAAAAGAGAGG + Intergenic
901147614 1:7077162-7077184 CAGGGATTTCAGCCAAAGTAGGG - Intronic
901749557 1:11397470-11397492 CAGGGTTGGCTGCAAGAGGAAGG - Intergenic
901948818 1:12725281-12725303 CAGGGACTTCAGGAAGTGGATGG - Exonic
902264840 1:15255924-15255946 ATGGATTTTCAGCAAGTGGAAGG + Intronic
903314394 1:22490082-22490104 CAGGGTTTTGAACAGGAGGCTGG - Exonic
904190220 1:28737408-28737430 CAGGGCTTTAAGGAAGGGGAAGG - Intronic
904413391 1:30339328-30339350 CAGAGTTTTAAGCAAGAGAGTGG + Intergenic
904625752 1:31800998-31801020 CAGAGCTTTGAGCAGGAGGAGGG - Intronic
904834646 1:33327419-33327441 GAGGGTATTCTGCATGAGGAAGG + Intronic
904887420 1:33751328-33751350 GAGGGTTTCCAGAAGGAGGAAGG + Intronic
905108936 1:35580366-35580388 AAGGGGTTGGAGCAAGAGGAAGG - Intronic
906333664 1:44909280-44909302 GTGAGTTTTCAGAAAGAGGATGG - Intronic
906977061 1:50587148-50587170 CAGGATTTGGAGAAAGAGGATGG - Intronic
908152480 1:61316585-61316607 CAGGGTTATCAGCATTCGGAGGG - Intronic
908205755 1:61846951-61846973 TAGGCATTTCAGCAAGATGATGG + Intronic
908902201 1:68968648-68968670 GAGGGTTTTAAGCAAGGGCAGGG - Intergenic
910260597 1:85290025-85290047 CAAGGTTATCATCAAGAAGATGG - Intergenic
910995361 1:93098932-93098954 CATGGGTTTCAGCAAGGTGAGGG + Intronic
912119984 1:106459138-106459160 CATGCTTTTCAGAAAGAGGATGG + Intergenic
912272238 1:108223332-108223354 AAGCGTTTTCAGCAAGAACATGG + Exonic
912519023 1:110232811-110232833 CAGGGAGTTCAGCAAAAGAAAGG - Exonic
912954846 1:114148113-114148135 CAGCATTTTCTGGAAGAGGAGGG - Intronic
914758523 1:150580041-150580063 CAGGGGTTGAAGGAAGAGGACGG + Intergenic
915499798 1:156307715-156307737 CAGAGATTTCAGCAAAAGGCAGG + Intergenic
915588678 1:156858927-156858949 CAGGGTTCTGAGCAAAAGGCAGG + Exonic
916354891 1:163893916-163893938 CAGAGTTTTCAGGAAGAGAAAGG + Intergenic
916502205 1:165396681-165396703 CAGGGTATACAGCGAGAGGGAGG - Intergenic
916688053 1:167165753-167165775 CTGGGTTTTCAGGATTAGGAAGG - Intergenic
918885830 1:190193117-190193139 CAGGATTTTCAGAAAGAGTAAGG - Intronic
919865801 1:201782162-201782184 CAGGTTTGCCTGCAAGAGGACGG - Exonic
920233927 1:204490193-204490215 GAGAGTTCTCAGGAAGAGGAAGG + Exonic
920848199 1:209610984-209611006 CAAGGTTTTGAGCTAAAGGATGG + Intronic
921510002 1:216016496-216016518 CAGGGTTTTCATGAAAGGGAGGG - Intronic
923944322 1:238865275-238865297 CAGGTTTTTCAGCTTGAGGTTGG + Intergenic
924226331 1:241924857-241924879 TTGGATTTTCAGCAGGAGGAGGG + Intergenic
1063537080 10:6893886-6893908 GAGGGTAGTCAGCAAGAGAATGG - Intergenic
1063690639 10:8283938-8283960 CTGGGTTTTTAGAAAGAGGAAGG - Intergenic
1066395710 10:35019437-35019459 CAGTCTTTTCAGTAAGAGTATGG - Intronic
1067432780 10:46254805-46254827 CAGGGGTCTCTGTAAGAGGAAGG - Intergenic
1067974470 10:51008441-51008463 TAGGGTTTTCAGAAAGAGCATGG - Intronic
1069137749 10:64785420-64785442 CAGGCTTTTCAGCTTGAGGGTGG - Intergenic
1070539159 10:77403758-77403780 CAGGGTCTTCTGCAGGAGGCTGG - Intronic
1071361615 10:84851804-84851826 CAGGGTACTGAGCAAGGGGAAGG - Intergenic
1072008866 10:91286269-91286291 CAGGGTTTGCAGGAGGAGCAGGG - Intergenic
1072400876 10:95098461-95098483 CAGGGATTTCAGATAAAGGATGG - Intergenic
1073630550 10:105144063-105144085 CAAGATTTTAAGCAAGAGAAAGG - Intronic
1073634126 10:105179933-105179955 CAGGGTTAACAGTAAGGGGAAGG - Intronic
1073728306 10:106260148-106260170 CAGTGTTTCAGGCAAGAGGAGGG + Intergenic
1076122734 10:127949182-127949204 CAGGGTCTTCAGCTTGAAGATGG + Intronic
1076608073 10:131702188-131702210 CAGGGTTTGCTGAAAGATGAGGG - Intergenic
1081826322 11:46056792-46056814 CAGGGTTTTCAGGAAGCACAAGG - Intronic
1081840661 11:46199105-46199127 CAGGGTTTCCAGGAAGAGGTTGG - Intergenic
1081990887 11:47336962-47336984 CAGGGTTTTCACCTATGGGATGG - Intronic
1083192560 11:61062797-61062819 AAGCGTTTCCAGTAAGAGGAGGG + Intergenic
1084313489 11:68330477-68330499 CAGAGATTCCAGCAAGAGGAGGG - Intronic
1084939315 11:72603899-72603921 CAGGGTTTCCAGCACAAGGAGGG + Intronic
1085115547 11:73928408-73928430 AAGGGTTTTAAGCAAGAGAATGG + Intergenic
1087005477 11:93466752-93466774 CAGGCTTTTCAGCTTGAGGGTGG - Intergenic
1088339566 11:108747798-108747820 TAATGTTTCCAGCAAGAGGAAGG - Intronic
1089152247 11:116373167-116373189 CAGGGTTTTCAGCATTAATAGGG - Intergenic
1089376756 11:118000059-118000081 CAGAGCTTCCAGCAGGAGGAAGG + Exonic
1089981982 11:122780192-122780214 AATGGTTTTCAGCAAGTTGAAGG - Intronic
1090084658 11:123640659-123640681 CAGAGTTCTCTGCAAGAGCAAGG - Intronic
1090475838 11:127019135-127019157 CAGTGTTTTCAGCAGGAAGGAGG + Intergenic
1090852228 11:130580548-130580570 CATTGTTTTCTGGAAGAGGAAGG + Intergenic
1092850879 12:12625194-12625216 CAGGCTTTTCGGCTTGAGGATGG + Intronic
1092921971 12:13240221-13240243 CAGGTTTTTCTTCAAGATGATGG - Intergenic
1093573415 12:20695751-20695773 CAATGTGCTCAGCAAGAGGATGG - Exonic
1093920155 12:24850401-24850423 CAGGGTCTTCAGCAGGTGGTAGG + Intronic
1094015322 12:25856775-25856797 CAGGATTTTCTGCAAAAGCATGG + Intergenic
1095244819 12:39907688-39907710 GAGGGCTTTCTGCAGGAGGATGG - Intronic
1098218019 12:68240350-68240372 GAGGGTTTCAAGCATGAGGAAGG - Intergenic
1101148824 12:101866337-101866359 CAGGCTTTTCAGCTTGAGGGTGG - Intergenic
1102152342 12:110697414-110697436 GAGCGTTTTGAGGAAGAGGAAGG + Intronic
1103167456 12:118782678-118782700 AAGGGGTTTAAGCCAGAGGAAGG + Intergenic
1104464840 12:128981985-128982007 AAGGGTATTCAGGGAGAGGAGGG - Intronic
1105430476 13:20332852-20332874 AAGAGCTGTCAGCAAGAGGAGGG - Intergenic
1105965969 13:25385168-25385190 CAGGCATTTCAGCAAAAGAAAGG - Intronic
1106038994 13:26071719-26071741 GGGGGTTTAAAGCAAGAGGAGGG + Intergenic
1106859835 13:33893918-33893940 GAGGGAGTTCAGCAAGAGCAAGG + Intronic
1107217210 13:37935191-37935213 CAGGCTTTTCAGCTTGAGGGTGG + Intergenic
1107335133 13:39346743-39346765 CAGGGTTTTAAGTAAGAGCATGG - Intronic
1108163967 13:47672633-47672655 CAGAGTTTACAGCAAGGGGAGGG + Intergenic
1108965212 13:56290052-56290074 CACAGTTTTCAGCAAGATAAAGG + Intergenic
1110818218 13:79884334-79884356 CAGGGTATTGAGCTGGAGGATGG + Intergenic
1111182593 13:84687904-84687926 CAGGCTTTTCAGCTTGAGGGTGG + Intergenic
1111606468 13:90546024-90546046 CAGGCTTTTCAGCTTGAGGGTGG + Intergenic
1112547216 13:100382488-100382510 CAGGCTTTTCAGCTTGAGGGTGG + Intronic
1113267220 13:108633062-108633084 CATTGTTTGCAGCAGGAGGAAGG + Intronic
1115170306 14:30497410-30497432 ATGGGTTTTCAGCAAGGGAATGG - Intergenic
1116491418 14:45507761-45507783 AAGGGTGTTTATCAAGAGGAAGG + Intergenic
1119566458 14:75633244-75633266 CAGGGTCATCAGGAAGAGGAGGG + Intronic
1120238574 14:81922856-81922878 CATGCTATTCAGCAAGAGTAAGG + Intergenic
1121253038 14:92513738-92513760 CGGGGCTTTCAGGAAGAGGCTGG - Intergenic
1121479003 14:94245422-94245444 AAGACTTTTCAGCAAGAAGATGG + Intronic
1123725886 15:23101168-23101190 CAGGAATTTCAGCCAGAGGGTGG + Intergenic
1124688626 15:31803514-31803536 CAGTGTTCTCAGCAAGACAAGGG - Intronic
1126064920 15:44819366-44819388 CAGAGACTGCAGCAAGAGGAGGG - Intergenic
1126094914 15:45081221-45081243 CAGAGACTGCAGCAAGAGGAGGG + Intergenic
1126676329 15:51161916-51161938 GAAGTTTATCAGCAAGAGGAGGG - Intergenic
1126785748 15:52176807-52176829 GAGGGTTTTGAGAGAGAGGATGG - Intronic
1127525462 15:59788041-59788063 GTGGGTTAGCAGCAAGAGGAGGG + Intergenic
1127647093 15:60969732-60969754 CATGGTTTTCAGCATAAGGGAGG + Intronic
1129832022 15:78676836-78676858 CAGGGCTTTCAGGGAGGGGAGGG + Intronic
1130771786 15:86931412-86931434 CAGGTTTTGCAGCAGGAGAAAGG - Intronic
1131441642 15:92464141-92464163 CAGGGTATACATCAAGAGGCCGG - Exonic
1131451456 15:92543846-92543868 CAGGGTGTTCACCAAGATGCTGG - Intergenic
1131583119 15:93664648-93664670 CAGGGTTAGCAGTTAGAGGAGGG - Intergenic
1133592871 16:7263218-7263240 CAGGATATTCAGCACCAGGAAGG + Intronic
1134366025 16:13579902-13579924 CAGGGTTTTCAGCTGGAAAATGG + Intergenic
1135256987 16:20948809-20948831 CAGGCTTTTCAGCTTGAGGGTGG - Intronic
1135872971 16:26169257-26169279 AAGGGTTTTCAGGAAGAGAAGGG + Intergenic
1136550590 16:30980459-30980481 CAGGGTGTTAAGGAAGAGAACGG - Intronic
1136598495 16:31267992-31268014 GAGTGTTTACAGCCAGAGGAAGG - Intronic
1138440026 16:57028635-57028657 CTGGGATTTCAGAAAGAGGGAGG - Intronic
1139494804 16:67308619-67308641 CAGGCTCTTCAGGAAGAGAATGG - Intronic
1140017458 16:71201423-71201445 CATTGTTTCCAGCAAGAGGTTGG - Intronic
1140859320 16:79005498-79005520 TAGAGTTTTCAGAGAGAGGATGG - Intronic
1141514177 16:84532250-84532272 GAGGGATTTCAGCAAGCAGAGGG - Intronic
1142713602 17:1736400-1736422 CAGGGGTCTCAGCAGGAGGCAGG + Intronic
1143393885 17:6576704-6576726 CAGGGCCAACAGCAAGAGGAAGG - Intergenic
1143515439 17:7417345-7417367 CAGGATGTTGAGGAAGAGGAGGG - Exonic
1143750672 17:9024627-9024649 CAGAGTTTTGAGCAAGGGAATGG + Intronic
1144162727 17:12577756-12577778 AAGGGTTTTGAGCAAGAAGGTGG - Intergenic
1144825472 17:18103389-18103411 CAGGGATTTCAGCAAGAAGAGGG - Intronic
1147587525 17:41660881-41660903 CAGGGGATTCACCAGGAGGAGGG + Intergenic
1148063625 17:44853177-44853199 CGGGGTTTCCAGAGAGAGGAGGG + Intronic
1148208127 17:45792270-45792292 CAGAGTTGGCAGAAAGAGGAAGG - Intronic
1148399530 17:47343466-47343488 CAATGTTTTCAGCAAGAGTGGGG - Intronic
1148619149 17:49021674-49021696 CAGGTTTATCAGCTATAGGAGGG + Intronic
1151898903 17:76998734-76998756 CAGGATTTACAGCAGGATGAAGG - Intergenic
1153709437 18:7783202-7783224 AAGGGTGATCAGCAAGGGGATGG + Intronic
1155500772 18:26484814-26484836 CAGGGTTTGGAGTAAGGGGAAGG + Intronic
1156117150 18:33799139-33799161 AAGGGTTTTCAAGCAGAGGAAGG - Intergenic
1157792513 18:50545502-50545524 CAGGCTTTTCAGCTGGAGGGTGG - Intergenic
1158392220 18:57052948-57052970 CAGGGCTGTCACCCAGAGGATGG + Intergenic
1159030577 18:63226358-63226380 CAGGCTTTTCAGCTTGAGGGTGG + Intronic
1159863393 18:73675535-73675557 AAGGAGTTTCAGGAAGAGGAGGG - Intergenic
1160906931 19:1455958-1455980 CGGGGTTATCAGGAAGAGGCGGG + Intronic
1161877972 19:6926613-6926635 CAGGGTCTTCAGGAAGAGAGAGG - Intronic
1163413563 19:17172061-17172083 CAGCGTGTTCAGCATGAGGCAGG + Intronic
1163594875 19:18215225-18215247 CAGGGTGTGCAGAATGAGGAAGG - Intronic
1165232008 19:34393176-34393198 CAGGGTTTCCGGCAGGAGGTGGG + Intronic
925556294 2:5134620-5134642 CAGGGCCCTCAGCAGGAGGAGGG + Intergenic
925882356 2:8363446-8363468 GGGGGTTTTCAGCAAGAGGGAGG - Intergenic
926223383 2:10950929-10950951 AAGGGTTTCCTGGAAGAGGATGG - Intergenic
927849783 2:26491617-26491639 GTGGATTTTCAGCAGGAGGAAGG + Intronic
928644442 2:33337056-33337078 CAGGGTTTTCTAAAAGAGGTTGG - Intronic
928712468 2:34022681-34022703 AAGGGTTTTAAGCAAGAGGATGG + Intergenic
928860086 2:35846707-35846729 CAGGCTTTTCGGCTCGAGGATGG + Intergenic
929570998 2:43022841-43022863 CAGGGTTCTTAACAGGAGGATGG - Intergenic
929836573 2:45406522-45406544 CAGGGTTTTCAGCAAGAGGATGG - Intronic
929883293 2:45855938-45855960 CAGGGTTTTCATGATGATGATGG + Intronic
931462902 2:62463703-62463725 CAGGCTTTTCAGCTTGAGGGTGG - Intergenic
931522313 2:63112274-63112296 CAGGGGTTACAGGAAAAGGAGGG - Intergenic
931976053 2:67645570-67645592 CAAGGTTATCAGCAAGGGAATGG + Intergenic
933765614 2:85706680-85706702 CAGGGTTTTCGGCCTGAGCAAGG - Intergenic
935294800 2:101639527-101639549 CAGAGTTTTCAGGAATTGGAAGG - Intergenic
936285101 2:111175631-111175653 CAGGCTTTGGAGGAAGAGGAGGG + Intergenic
936656547 2:114494757-114494779 CAGGGTTTTCTGCAAGAGTAAGG + Intronic
936803616 2:116297333-116297355 GAGGGAATTTAGCAAGAGGAAGG + Intergenic
938937274 2:136138071-136138093 CACTGTTATCAGCATGAGGATGG - Intergenic
940133276 2:150408035-150408057 CAGGGTCTTCATAAAGATGAAGG + Intergenic
942135486 2:172920874-172920896 CAGGTCTGTCAGAAAGAGGAAGG - Intronic
942286173 2:174419231-174419253 TAGGGTTTTGAGAGAGAGGAAGG + Intronic
942614291 2:177774186-177774208 CAGGCTTTTCAACAAGAAGCTGG - Intronic
943969547 2:194386047-194386069 TAGGTTTTTCAGCTTGAGGATGG - Intergenic
944169698 2:196760961-196760983 CAAGGTTTTCAGCAGGAGAAAGG - Intronic
944451927 2:199852033-199852055 GAGGGTTGTTGGCAAGAGGAGGG + Intergenic
944621196 2:201517421-201517443 CATGGCTTTCTGGAAGAGGAAGG - Intronic
946047802 2:216835742-216835764 CAGGGTGTTGAGGCAGAGGATGG - Intergenic
946117160 2:217473149-217473171 TGGGAATTTCAGCAAGAGGAAGG + Intronic
946447863 2:219755008-219755030 GAGGGTTTATAGCAAGAAGATGG - Intergenic
946563567 2:220939829-220939851 CAGGTTTTTCAGCTTGAGGATGG - Intergenic
947464224 2:230326772-230326794 CAGCCATTTCAGCAAGGGGAAGG + Intergenic
948379197 2:237541201-237541223 CAGGGTTTCCACCAAGAAAAAGG + Intronic
948997183 2:241587483-241587505 CAGGGTTTCCAGCTTGTGGAGGG + Intronic
949056849 2:241932489-241932511 CAAGGTTTCCAGGAAGGGGAAGG - Intergenic
1169586590 20:7092570-7092592 AAGGGTTTTCAGGCTGAGGAAGG - Intergenic
1170805620 20:19628302-19628324 CAGTGATTTCAGCAAGATGGTGG + Intronic
1171487986 20:25497707-25497729 CTGGGCTGTCAGCAGGAGGAAGG - Intronic
1171571850 20:26259868-26259890 GAGGGTGTGGAGCAAGAGGAGGG - Intergenic
1172817415 20:37698715-37698737 CATGACTTTCTGCAAGAGGATGG - Intronic
1173258046 20:41408989-41409011 CATGGTTCTCAGCAAGAGCAGGG - Intronic
1173406966 20:42774775-42774797 AAGGGTCTTGAGCAAGAAGAGGG - Intronic
1174180316 20:48670304-48670326 CAGGGTTCTCAGCAGGGGCAGGG - Intronic
1174336828 20:49868381-49868403 CAGGGTTTTCAGAGAGGGGCAGG + Intronic
1174541681 20:51294647-51294669 CAGGGTTGGAAGAAAGAGGAAGG - Intergenic
1175498517 20:59432499-59432521 GAGGGTTCACAGCAACAGGATGG + Intergenic
1175954718 20:62603458-62603480 CAGGGTTGGCAAGAAGAGGAAGG - Intergenic
1177703790 21:24674223-24674245 CAGGCTTTTCAGCTTGAGGGTGG - Intergenic
1178609271 21:34066875-34066897 CGGGGCTTTAACCAAGAGGAGGG - Intergenic
1178702388 21:34844715-34844737 CAGGGCTTTTAGAAATAGGAGGG - Intronic
1179958388 21:44753964-44753986 AAAGGTCTTCAGCATGAGGAGGG - Intergenic
1180744281 22:18076981-18077003 CAGACTTTTCTGCAAGAGAACGG - Intergenic
1181552993 22:23651675-23651697 CAGGGAGTTGAGGAAGAGGAGGG + Intergenic
1183871169 22:40743531-40743553 CAGGGTTTTCACCATCAGGCCGG - Intergenic
1185267583 22:49912353-49912375 CAGGGTTGGCAGCAAGAGGTTGG - Intronic
951120438 3:18920698-18920720 CTGTGTTTTCAGAAGGAGGAAGG - Intergenic
953009478 3:39011068-39011090 GAGGTTTTGCAGCAAGAGAAAGG + Intergenic
953293119 3:41686340-41686362 CAGGGTTTCTTGGAAGAGGAAGG + Intronic
953365354 3:42340081-42340103 AAAGGTTTTAAGCAAGAGTATGG - Intergenic
953679361 3:45028072-45028094 CATGGGTTTCAGCGAGAGGCAGG - Intronic
954148327 3:48645316-48645338 CAGGGTTTTCAGCAGGATGCTGG - Intronic
954296460 3:49677049-49677071 GAGGGTGGTCAGCAAGAAGATGG + Intronic
954580867 3:51702348-51702370 CTGGGGCCTCAGCAAGAGGAGGG + Intronic
957210044 3:77247907-77247929 CAGGCTTTTCAGCTTGAGGGTGG - Intronic
957501795 3:81067150-81067172 GAGGGTTTTCATTAAGAAGAAGG - Intergenic
957508861 3:81161121-81161143 TAGGGTTTTCAGAAAGATTATGG - Intergenic
960935255 3:122895963-122895985 TAGGTTTTTCCCCAAGAGGAAGG - Intergenic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961488243 3:127232510-127232532 CAGGGAGGTCAGCAGGAGGATGG - Intergenic
963410612 3:144922352-144922374 CAGGCTTTTCAGCTTGAGGATGG + Intergenic
964519676 3:157551143-157551165 GAGGGTATTGAGCAAGAGCATGG - Intronic
967131930 3:186478541-186478563 CAGGGGTTTCAGAAGGAGGTTGG - Intergenic
967531869 3:190557246-190557268 CTGGGTTTTCAGTGAGTGGAAGG - Intronic
967627898 3:191707870-191707892 CAGGTTTTTCAGCTTGAGGGTGG - Intergenic
968061712 3:195730901-195730923 CAGGGTTTTGAGGATGGGGATGG + Intronic
968754705 4:2409294-2409316 CGGGGATTCCAGCGAGAGGATGG - Intronic
969214418 4:5710925-5710947 CAGCGTCTTCATCAGGAGGATGG + Intergenic
970191363 4:13522557-13522579 CGGGGTTCTCCGCAAGAAGAAGG + Intergenic
970225158 4:13850080-13850102 CAAGGTTTGCAGCAGGAGAAAGG - Intergenic
972066492 4:34952867-34952889 CAGGCTTTTCAGCTTGAGGGTGG - Intergenic
972111709 4:35569838-35569860 CAGTTTTTTCAAAAAGAGGAAGG - Intergenic
973016998 4:45152888-45152910 CATCGTTTTCAGCAAGAGATTGG - Intergenic
978840802 4:113209549-113209571 CAAGGTTTTCAGCGGGAGAAAGG + Intronic
978937873 4:114399851-114399873 CAGGCTTTTCGGCAAGAGGATGG + Intergenic
981297263 4:143146640-143146662 CAGGCTTTTCAGCTTGAAGATGG - Intergenic
982862034 4:160464097-160464119 CAGGATTTTCAGCTTGAGGGTGG + Intergenic
983810015 4:172050196-172050218 CAAGGTTTGCAGCAGGAGAAAGG + Intronic
984292115 4:177808480-177808502 CAGGCTTTTCAGCTTGAGGGTGG + Intronic
984985865 4:185329035-185329057 GAGGGTTTTCATTAAGAAGAAGG + Intronic
985023030 4:185712082-185712104 CAGGCTTTTCAGCTTGAGGGTGG - Intronic
985958931 5:3284829-3284851 CATGGCATTCAGCAACAGGAAGG + Intergenic
988350869 5:30106066-30106088 CAGGCTTTTCAGCTTGAGGGTGG - Intergenic
990042221 5:51389091-51389113 CAGGGACTTCTGCAAGGGGAAGG - Intronic
990483134 5:56230653-56230675 CATGCTTTTAAGAAAGAGGAAGG + Intronic
990529931 5:56663412-56663434 CAGGGTTTTTGGAAAGAGAAAGG - Intergenic
993211107 5:84952302-84952324 CTGGCTTTTCAGAAAGAGAAAGG - Intergenic
993308308 5:86296658-86296680 AAGCGTTTTCAGCAAGAACATGG - Intergenic
994691836 5:103029051-103029073 CTTGGTTTTCAGGAGGAGGAAGG - Exonic
994816229 5:104591593-104591615 GAGGGTTTTCATTAAGAAGAAGG - Intergenic
995741919 5:115364529-115364551 CAGGCTTTTCAGCATAAGGATGG + Intergenic
997880958 5:137589251-137589273 GAGTGTTTCCAGGAAGAGGAAGG + Intronic
998707721 5:144782929-144782951 AAGGGTTTGCAGCAGGAGGTGGG + Intergenic
1000423324 5:161062145-161062167 CAGGGTTTTCAGCTTGGAGATGG - Intergenic
1001116372 5:168944201-168944223 AAGGGTTGTCAGCGATAGGAGGG - Intronic
1001207797 5:169780200-169780222 CAGAGTTTACAGCTAGGGGAAGG - Intronic
1004605288 6:17188959-17188981 CAGGGTTTTGAGCAGAAGTATGG + Intergenic
1006403263 6:33829945-33829967 CAGGGATGTGAGGAAGAGGAGGG - Intergenic
1006582694 6:35085995-35086017 CAGGGTGGTCAGCGTGAGGAGGG + Intronic
1006657673 6:35610082-35610104 CAGGCCTTTCTGCAAAAGGATGG + Intronic
1006874679 6:37285096-37285118 CAGGGGTTGCAGAAAGTGGAAGG + Intronic
1006937845 6:37730746-37730768 CGGGGTGTTCAGCATGAGCATGG + Intergenic
1008420536 6:51294141-51294163 CATGGTATTCAGCAGGTGGATGG - Intergenic
1008460601 6:51765358-51765380 AAGGGTTTTATGCAGGAGGATGG - Intronic
1009571427 6:65390412-65390434 TAGGGTTTTCAGAAGGAGAAGGG + Intronic
1009948247 6:70364758-70364780 CAGGCTTTTCAGCTGGAGGGTGG + Intergenic
1010947860 6:81999184-81999206 GAGGGATGTCAGCAAGATGATGG + Intergenic
1012955678 6:105567434-105567456 CAGAGTTTTCATCAATAAGATGG + Intergenic
1013308605 6:108872734-108872756 AAGGGTTTTCAGCAAGAGGGTGG - Intronic
1013386363 6:109635645-109635667 GAGTTTCTTCAGCAAGAGGATGG - Intronic
1013516250 6:110888910-110888932 CAGTGCTTTCAGCAAGAGGGTGG - Exonic
1014155389 6:118103558-118103580 CAGTGTGTTCGGCAAGTGGATGG - Intronic
1015106891 6:129547492-129547514 GAGGTTTTACAGCAAGAGAAAGG + Intergenic
1015221850 6:130813270-130813292 CAGGGTCTTCAGGGAGATGAGGG - Intergenic
1015681449 6:135813247-135813269 CAGCTTTTTCAGGAAGGGGACGG + Intergenic
1016183163 6:141171497-141171519 CAGGCTTTTCAGCTTGAGGGTGG + Intergenic
1017584810 6:155909099-155909121 CAAGCTTTTCAGCTTGAGGATGG - Intergenic
1018616348 6:165690518-165690540 CAGGGTTTTGAGCAAGGGAGGGG - Intronic
1018939973 6:168302623-168302645 AAGGGTTTGCAGCAGGAGGGAGG + Intronic
1021956495 7:25830296-25830318 AAGGGTTTTCAGCAATACAAAGG + Intergenic
1024063098 7:45713512-45713534 AAGTGATTTCAGCAAGAGTAGGG + Intronic
1024706694 7:51969373-51969395 CAGGGATCTGAGGAAGAGGAAGG + Intergenic
1025942443 7:66083997-66084019 CAGGGAGTTGAGGAAGAGGAGGG - Intronic
1026569656 7:71518165-71518187 GAGGGTTTTAAGCAGGAGCATGG + Intronic
1026901703 7:74040916-74040938 CAGGGCTTTCAGCAAGGGCTGGG - Intronic
1029245059 7:99193371-99193393 CATGGTTCTCAGGAAGACGAAGG + Intronic
1031063467 7:117077318-117077340 CAGGTTTTTCAGCTGGAGGGTGG + Intronic
1032696861 7:134344643-134344665 CTGTGTTTTCAGCTAGAGGAAGG + Intergenic
1034493833 7:151408815-151408837 CAGGGTTTACAGCAATGAGAGGG + Intronic
1036764367 8:11537983-11538005 CGGGGGAGTCAGCAAGAGGAGGG - Intronic
1037244662 8:16819302-16819324 CAGGGTTTCCAGCAACAAGAGGG - Intergenic
1037701023 8:21273899-21273921 ATGGGTTTTCAGCTGGAGGAGGG + Intergenic
1040664250 8:49613023-49613045 TAGGGATTTCAGCAAGAGTGTGG + Intergenic
1040667023 8:49646170-49646192 CAAGGTTTTCAGAGAGAGGGTGG - Intergenic
1043574654 8:81643739-81643761 CAGGTTTCTCAGCAAGTGAAAGG - Intergenic
1043970594 8:86524262-86524284 CAGGATTTTCAGCCAGGGCATGG + Intronic
1044510306 8:93069611-93069633 CAGAGTTTTCAGTCAGAGGGAGG - Intergenic
1044523553 8:93226280-93226302 AAGAGAATTCAGCAAGAGGAGGG + Intergenic
1044536773 8:93365924-93365946 CAGGGATATTAGCAAGAGGATGG + Intergenic
1044592069 8:93922945-93922967 CTGGGTGTGCAGGAAGAGGACGG + Exonic
1044733395 8:95251543-95251565 AAGGGTGTTGAGCAGGAGGACGG + Intronic
1045064193 8:98431081-98431103 CAGGGTTTTCATCCAAAGGTTGG + Exonic
1045534549 8:103014892-103014914 CAGGTTTCTCAGCATGAGCACGG + Intergenic
1046631541 8:116626927-116626949 CAGGCTTTTCAGCAGGTGGAGGG + Intergenic
1048876105 8:138837950-138837972 CAGGGTTGTCACCTTGAGGAGGG + Intronic
1049378777 8:142301784-142301806 CAGGGTTTTCAGGAAGATCGGGG - Intronic
1049439121 8:142601213-142601235 CAGGCTTTGCAGCCAGAGGCAGG - Intergenic
1051797865 9:20894488-20894510 AAGGCTTTGGAGCAAGAGGAAGG - Intronic
1052569073 9:30198344-30198366 CAGAGTTTGCAGCAAGACAAAGG + Intergenic
1053315648 9:37049134-37049156 CAGGGTTTTCCCCAATAGGCTGG + Intergenic
1053447099 9:38161178-38161200 ATGGGGTTTCAGCAACAGGAAGG - Intergenic
1055485192 9:76749640-76749662 GAGGTTTTGCAGCAAGAGAAAGG - Intronic
1056045632 9:82712675-82712697 CAGGCTTTTCATGCAGAGGAAGG + Intergenic
1056081902 9:83103742-83103764 CAGGGGTCTAAGGAAGAGGATGG - Intergenic
1056280640 9:85038303-85038325 CAGAGTTTTCAGTAGGGGGATGG - Intergenic
1056985909 9:91363647-91363669 CAGGGAGTTCAGCCAGTGGAAGG + Intergenic
1057176274 9:93002672-93002694 CAGTGATGTCAGCAAGATGATGG - Intronic
1057826268 9:98374614-98374636 CAGGGTTTTTAGTCGGAGGATGG - Intronic
1059235293 9:112755520-112755542 CAGGGTCTTGAGCAGGAGGGGGG + Intronic
1061134903 9:128728298-128728320 CAGGGTTCTGAGGAAGCGGAAGG + Intergenic
1061386966 9:130296105-130296127 CAGGGCTGGCAGGAAGAGGAGGG + Intronic
1185712508 X:2315239-2315261 GAGGCTTTGCAGCAAGAGAAAGG - Intronic
1186663903 X:11699214-11699236 CAGGTTTTTCAGAAAAAGGCAGG - Intergenic
1189497130 X:41518953-41518975 CAAGGGATACAGCAAGAGGAAGG + Intronic
1190212577 X:48459954-48459976 CAGGGATCTCAGCCAGAGGGTGG - Intronic
1191721289 X:64230717-64230739 GAGCGATTTCAGTAAGAGGAGGG + Intergenic
1193087638 X:77461334-77461356 CAGCCTTTTCAGGAGGAGGAAGG - Intergenic
1194788080 X:98111517-98111539 CAGGGGTTTTAGCAAGAGGGAGG - Intergenic
1196300723 X:114047449-114047471 TAGGCTTTTCAGCCTGAGGATGG - Intergenic
1196944086 X:120806897-120806919 CAGAGGTTTCCTCAAGAGGAAGG + Intergenic
1198619686 X:138492278-138492300 CAGCTTTTTCAACAAGAGCAGGG + Intergenic
1199606133 X:149581122-149581144 AAGGGTTTCCTGCAAGATGAGGG - Intergenic
1199632988 X:149788246-149788268 AAGGGTTTCCTGCAAGATGAGGG + Intergenic
1200380219 X:155829304-155829326 CAGTGCTTTCAGCAAGAGGGTGG + Intergenic
1200961845 Y:9003101-9003123 CAGAGATTTCAGAGAGAGGAAGG + Intergenic
1201418177 Y:13769351-13769373 TCTGGTTTTCAGCAAGAAGATGG + Intergenic
1201630246 Y:16063668-16063690 GAGGGTTTTCATTAAGAAGAAGG + Intergenic