ID: 929844379

View in Genome Browser
Species Human (GRCh38)
Location 2:45507217-45507239
Sequence GAAATTATGAGATGTGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 232}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929844379_929844381 8 Left 929844379 2:45507217-45507239 CCAGACACACATCTCATAATTTC 0: 1
1: 0
2: 1
3: 14
4: 232
Right 929844381 2:45507248-45507270 CTGTACAATCATATTAACAGTGG 0: 1
1: 0
2: 1
3: 11
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929844379 Original CRISPR GAAATTATGAGATGTGTGTC TGG (reversed) Intronic
902340669 1:15781621-15781643 GAAATGGTGAGATGTGGGTGTGG - Intronic
904730534 1:32587655-32587677 GATATTATGAAATATGTGTTTGG + Intronic
906712773 1:47943977-47943999 GAAATGATTAGTTGAGTGTCTGG - Intronic
907026031 1:51120041-51120063 GAAATGAAGAGAAGTTTGTCGGG + Intronic
907380070 1:54079841-54079863 CAAATTATGCTATGTGTTTCAGG + Intronic
907548622 1:55285251-55285273 GGAATTATGTGAGGTGTGGCAGG + Intergenic
909145003 1:71918799-71918821 GAAATGATGTGAAGTGAGTCAGG - Intronic
915030705 1:152878415-152878437 GAAATTGTGAATTGTGTGTGTGG + Exonic
915770233 1:158414533-158414555 GAAATTGTTAAATGTGTTTCTGG + Intergenic
915906417 1:159881271-159881293 GAGATTATAAGCTGTGTGGCCGG - Intronic
916690709 1:167187412-167187434 GAAATTCTGAGATGGGAGTGAGG + Intergenic
917553069 1:176055695-176055717 GAAATTACTAGATGTTTGGCAGG - Intronic
917654105 1:177108582-177108604 GAAAATAAGATATGTGTGTTGGG - Intronic
919536258 1:198791449-198791471 GCAATTAAGAAATGTGAGTCTGG - Intergenic
923640651 1:235756244-235756266 GGAATAAATAGATGTGTGTCTGG - Intronic
923856320 1:237848894-237848916 GATTTTATGAGTTGTGTATCAGG + Intergenic
924611611 1:245578164-245578186 AAATTCATAAGATGTGTGTCAGG + Intronic
1063979442 10:11441903-11441925 GATTTTAAGAGATGTATGTCAGG - Intergenic
1064023492 10:11828070-11828092 GAATTTAAGGGATCTGTGTCAGG + Intronic
1064306426 10:14171272-14171294 GAAATCCTGAGACCTGTGTCAGG + Intronic
1064578346 10:16768627-16768649 GAAACTTTGAGATTTGTCTCTGG - Intronic
1064751414 10:18533537-18533559 GAAAATATGAGGTGTGTTTTTGG + Intronic
1067011925 10:42722242-42722264 GAAACTTTGAGATTTGTCTCTGG + Intergenic
1067138406 10:43632603-43632625 ACAATTATGAGCTGTATGTCAGG - Intergenic
1067311665 10:45119616-45119638 GAAACTTTGAGATTTGTCTCTGG - Intergenic
1069894613 10:71672732-71672754 GAAATTAGGTGATGAGTGCCAGG - Intronic
1071384738 10:85107669-85107691 GAAGTTATGGCATGTGTGTAAGG + Intergenic
1071918293 10:90320894-90320916 GAAATGAGGAGATGTTGGTCTGG + Intergenic
1074118103 10:110472906-110472928 AAAATTATGAGATTTTTGCCAGG - Intergenic
1074191680 10:111143440-111143462 GAAATGATTAGATGAGTGCCAGG + Intergenic
1074457476 10:113607947-113607969 TAAATTGTAAGATGTTTGTCAGG - Intronic
1076600293 10:131653072-131653094 GAAATTATGATCTGTGTGGGAGG + Intergenic
1077468473 11:2745471-2745493 GAAAGTATGACATGGTTGTCAGG - Intronic
1077930262 11:6724022-6724044 GAAACTTTGAGTTGGGTGTCAGG - Intergenic
1080435185 11:32233709-32233731 TAAATTCTTAGATGTGAGTCAGG - Intergenic
1080780529 11:35425031-35425053 GGAATTATAAGCTGTGTGTCTGG + Intergenic
1081399748 11:42629179-42629201 AAAGTTATGAGATTTGTGGCAGG + Intergenic
1082612473 11:55318232-55318254 GAAATTATGAAATGTATGAATGG + Intergenic
1082729959 11:56783856-56783878 GAAATTATCAGATTTGTATAAGG - Intergenic
1082826792 11:57585758-57585780 GTAATGATGACATGTATGTCTGG - Intergenic
1083085858 11:60144460-60144482 GTGATTCAGAGATGTGTGTCAGG + Intergenic
1085260519 11:75202076-75202098 GATATTGTGAGATGTGTATTTGG - Intronic
1085595024 11:77801564-77801586 GAATTTAGGAGCTCTGTGTCAGG - Intronic
1086221496 11:84450460-84450482 GAAAACATGAGATGTGTTTGAGG + Intronic
1086837351 11:91641274-91641296 GAAAATATGATTGGTGTGTCTGG + Intergenic
1086914122 11:92508395-92508417 GCAAGTATGAGATTTGTATCAGG + Intronic
1087699745 11:101422957-101422979 GAAATTATGAGATACCTGACAGG - Intergenic
1087955059 11:104276062-104276084 AAAATTAATAGATGTGAGTCTGG - Intergenic
1088058780 11:105618676-105618698 GAGATTTGGACATGTGTGTCTGG + Intronic
1089264432 11:117248691-117248713 GAAATTATGAGGAGTGTACCTGG + Intronic
1089924262 11:122240884-122240906 AAAATTACCATATGTGTGTCTGG - Intergenic
1090424394 11:126597046-126597068 GAATTTCTGAGAGGTCTGTCTGG - Intronic
1093773572 12:23046391-23046413 GAAATGATGAAATGTGTATCTGG + Intergenic
1096527611 12:52220905-52220927 GAAATTAGGAGCTCTGTGTCAGG + Intergenic
1096865918 12:54562696-54562718 GAAAGTATGGGGTGTGTGTGTGG + Intronic
1098184954 12:67886530-67886552 GAAAATATGCGATCTGTGTTAGG + Intergenic
1100126583 12:91434240-91434262 TAAATTATGAGATGGGTTTATGG + Intergenic
1104259702 12:127171353-127171375 GAAATGATGGGATGTTTTTCTGG - Intergenic
1107037649 13:35917879-35917901 CAAATTCTGAAATGTGTGTCAGG - Intronic
1107694218 13:42984834-42984856 GAAATTAGGAAATGTTTTTCTGG + Intronic
1108909329 13:55523740-55523762 ATAATTATAAAATGTGTGTCAGG + Intergenic
1109175461 13:59149913-59149935 GAAAATAGGAGATGTGTTTTAGG - Intergenic
1109356244 13:61232616-61232638 GATGTTATGAGCAGTGTGTCAGG - Intergenic
1109398699 13:61795452-61795474 TAAATTATGTGAAGTCTGTCTGG + Intergenic
1109682132 13:65765844-65765866 TAAATTATAAGATGTCTATCTGG - Intergenic
1112285858 13:98103780-98103802 GAATTTAGGAGCTCTGTGTCAGG + Intergenic
1113143163 13:107176938-107176960 GAAATTATGACATTTGGGGCTGG - Intronic
1115250861 14:31345785-31345807 GACAGTATGAGAAGTGTGTATGG + Intronic
1117511256 14:56453785-56453807 GAGAATTTGAGAGGTGTGTCAGG + Intergenic
1118141867 14:63092903-63092925 GATTTTAGGAGATGTATGTCAGG - Intronic
1120285915 14:82501384-82501406 GTAATTATGTGAAGTGTTTCTGG - Intergenic
1121087162 14:91155395-91155417 GATATTATGAGATATGTATTTGG + Intronic
1124900237 15:33815830-33815852 GAAATTATTAATTTTGTGTCTGG - Intronic
1127688835 15:61374863-61374885 GAAAATATGAGATTTATGACAGG - Intergenic
1129880351 15:79002676-79002698 GAAATTATGAAATTTCTGGCAGG + Intronic
1130230565 15:82093630-82093652 GAAATTTTGGGATGTGGGGCGGG + Intergenic
1130380340 15:83366569-83366591 CAAATTCTGAGGTGTGTGTCTGG + Intergenic
1130763123 15:86841520-86841542 CAAATCGTGAGATGTGTGTTGGG - Intronic
1130783022 15:87065112-87065134 AAAATTATGGGATGTTTATCAGG - Intergenic
1132023055 15:98381486-98381508 GATATTCTGAGATGGGTGTAAGG - Intergenic
1135898949 16:26438209-26438231 GAAATTGTTAGATGAGTGCCTGG + Intergenic
1137336063 16:47550395-47550417 GAAATTATGAGAACAGTTTCAGG - Intronic
1137591079 16:49694309-49694331 AAAATAATCAGATGTGTGGCGGG + Intronic
1137986046 16:53109041-53109063 GGAATAATGAGATGAGAGTCTGG + Intronic
1140665877 16:77226906-77226928 GAAGTTTAGAGATGTGTTTCAGG - Intergenic
1141733386 16:85836831-85836853 GAGAGTTTGAGAGGTGTGTCTGG + Intergenic
1144792375 17:17867576-17867598 GTAGTTATGAGGTGTGTGTTGGG + Intronic
1146988319 17:37243468-37243490 GATATTATGACCAGTGTGTCTGG - Exonic
1148092522 17:45031161-45031183 GAATTGGTGTGATGTGTGTCTGG - Intronic
1148189425 17:45668207-45668229 GAAATGATTAGATGTGTGATGGG + Intergenic
1149185443 17:53991830-53991852 GAAATAATCTGTTGTGTGTCTGG + Intergenic
1149790798 17:59475175-59475197 AAAATTATGACATTTGTGGCCGG + Intergenic
1150006872 17:61475438-61475460 GAACTGATGGGATGTGTTTCAGG + Intronic
1151282085 17:73084078-73084100 GAAGTTGGGAGATGGGTGTCTGG + Intronic
1151873969 17:76856071-76856093 GAACTGATGAGATGTTTGCCTGG + Intergenic
1155782900 18:29860694-29860716 GAAATAGTAAGATGTTTGTCAGG - Intergenic
1156012368 18:32510104-32510126 CAAATTATAATATGTGTGTTCGG + Intergenic
1156410337 18:36822136-36822158 GAAATTTTGAGAGCTGTGACTGG + Intronic
1156695819 18:39765268-39765290 GAATTTATGAGCTCTGCGTCAGG + Intergenic
1157775623 18:50393744-50393766 GAATTTAGGAGCTTTGTGTCAGG - Exonic
1158164009 18:54518608-54518630 GAAATAAAGAGATGCATGTCAGG - Intergenic
1158411012 18:57206219-57206241 GTGATTATGAGCTGTGTCTCTGG + Intergenic
1159160625 18:64639728-64639750 GAAATGAAGAGATGTGGTTCTGG - Intergenic
1159194570 18:65096089-65096111 GAAATATTGAGAGGTGTATCAGG - Intergenic
1160304350 18:77717919-77717941 GACATTATGAATTGTGTGGCAGG + Intergenic
1163954219 19:20620385-20620407 AAAATTATGAAATGAGTGTTTGG - Exonic
1167777346 19:51567312-51567334 GAAATAATGAGATGTATGGTGGG + Intergenic
926187771 2:10704919-10704941 AAAATAAAGAAATGTGTGTCTGG + Intergenic
927602154 2:24452938-24452960 GAAATTATGTTAAGCGTGTCTGG - Intergenic
929431423 2:41890630-41890652 GATTTTAGGGGATGTGTGTCAGG - Intergenic
929844379 2:45507217-45507239 GAAATTATGAGATGTGTGTCTGG - Intronic
929938645 2:46313745-46313767 TAAATTATGACATGTGGGGCTGG - Intronic
933083037 2:78017673-78017695 GAAAATATGAGAAGTTTTTCTGG - Intergenic
936509630 2:113134704-113134726 GAAATTATGAGATTAGTGAATGG + Intergenic
939382233 2:141450228-141450250 GAACTAATGAAATGTGTGTTTGG - Intronic
939452336 2:142390424-142390446 GAAATGATGAGATTTGTGATAGG - Intergenic
941646852 2:168049819-168049841 GAAATAACCAGATGTGTGTAAGG + Intronic
943800173 2:192047333-192047355 GATATTAGGAGATGTTTATCTGG - Intronic
943898735 2:193403971-193403993 GAATTTTTGAGATGTGAGTTAGG - Intergenic
944066882 2:195628710-195628732 GAAAATATGAGAAGTTAGTCTGG + Intronic
946575742 2:221073476-221073498 GGCATAATGAGATGTGTGTCTGG - Intergenic
947108893 2:226697443-226697465 GAAATTATTAGATATGAGTGAGG - Intergenic
947931247 2:233967000-233967022 ATAATTATGAGCTGTGTCTCTGG + Intronic
948354550 2:237367700-237367722 GAAGTGAAGAGATGTGTGTGAGG + Intronic
1172755773 20:37283273-37283295 GATATTGTGAGAAGTGTGTGCGG - Intergenic
1173300370 20:41797058-41797080 GAAATAGTCAGATGTGTGGCTGG - Intergenic
1174184895 20:48699502-48699524 GAAATTAGGAGATGGATGTGGGG - Intronic
1174701706 20:52616074-52616096 GAGATATTGACATGTGTGTCTGG - Intergenic
1174705656 20:52653215-52653237 GAACTTAAGAAATATGTGTCAGG + Intergenic
1174729585 20:52902762-52902784 GAAATGATGAGAAGTGTGCTGGG - Intergenic
1175626348 20:60491138-60491160 TGAATAATGAGATGTTTGTCGGG - Intergenic
1177481114 21:21689817-21689839 AAAATTAAGAGATGAGAGTCAGG - Intergenic
1177845434 21:26282978-26283000 GAAATTATGAGAAGCCTGTGAGG - Intergenic
1178251552 21:31008246-31008268 GAAATTAGGGGAAGAGTGTCTGG + Intergenic
1178428399 21:32497971-32497993 GGAATTATGAGATTTGGGTGGGG + Intronic
1178721645 21:35015948-35015970 GAAATTATCAAATGTGTATTGGG + Intronic
1179194255 21:39150810-39150832 GGACTTATGAGCTCTGTGTCAGG + Intergenic
1179818770 21:43924414-43924436 GAATTTATGAGCTTTGTGTCAGG + Intronic
1182022579 22:27093751-27093773 GGAACTATGAGGTGTGTGTGTGG - Intergenic
951155363 3:19346458-19346480 GACATTATGAGATGCCTGTGTGG + Intronic
952125494 3:30295001-30295023 GAAAGTATGAGATGTGTGATAGG - Intergenic
952812229 3:37414439-37414461 GAGAGTATGCGATGTTTGTCTGG + Intronic
953546883 3:43870080-43870102 GAAATGCTGAGCTGGGTGTCTGG + Intergenic
953928129 3:46992631-46992653 GAAATGAGCAGATGTGTGTAAGG + Intronic
957523397 3:81349881-81349903 GAAATTATCACATTTGTGGCTGG - Intergenic
960021067 3:112954396-112954418 GATTTTAGGAGTTGTGTGTCAGG - Intronic
960657758 3:120024781-120024803 GAAATTCTGAAATGTGTGAGAGG + Intronic
960820177 3:121722087-121722109 GAGATTAGGAGATGTGTGGTAGG - Intronic
963778016 3:149459570-149459592 AAAATTATGACATATGAGTCAGG + Intergenic
963962518 3:151324828-151324850 CAAATGTTGAGATGTGTTTCTGG + Intronic
966365824 3:179186162-179186184 GAATTTAGGAGCTGTGTGCCAGG + Intronic
967401780 3:189070954-189070976 GAAATTCTCAGATTTGTTTCTGG + Intronic
970073238 4:12187084-12187106 GAAGTTATGAGATAGGTGACGGG - Intergenic
970349981 4:15192672-15192694 GAAATTCTAAGATGTGTGAATGG - Intergenic
971861380 4:32109854-32109876 GAAATTACAAGGTATGTGTCTGG - Intergenic
972414251 4:38823410-38823432 TAAGTTCTGAGATGTGTGTTAGG - Intronic
972715441 4:41641271-41641293 CAAATGAAGAGGTGTGTGTCTGG - Intronic
973646103 4:52952685-52952707 TAAATCATGAGATATGTATCAGG - Intronic
973670127 4:53208663-53208685 GGAATTATGAGAGGTGTATATGG - Intronic
974159340 4:58117935-58117957 TAAATAATGACATGTATGTCTGG - Intergenic
974701251 4:65450438-65450460 GAAATGCTGACATATGTGTCTGG - Intronic
975020127 4:69475611-69475633 GAAATTCAGATGTGTGTGTCAGG - Intergenic
977068280 4:92347287-92347309 GAAATTATAAAGTGTGTGTGAGG + Intronic
977114904 4:93011584-93011606 GAATTTAAAAGCTGTGTGTCAGG + Intronic
977403395 4:96563835-96563857 GAAATTTTGAAAGGGGTGTCTGG + Intergenic
978144321 4:105354095-105354117 GAAATTATGAGATCAGTTTCAGG - Intergenic
978177925 4:105756447-105756469 GAATTTAGGAAATTTGTGTCAGG + Intronic
980633226 4:135465747-135465769 GAAATTATGAGATCTGTGCTAGG + Intergenic
981389835 4:144176141-144176163 GAATGTTTGAGATGTGGGTCTGG - Intergenic
982261465 4:153497930-153497952 GAAGCTAGGAGATGTGTATCTGG - Intronic
982757896 4:159245878-159245900 GAAATTATGAAATGTCAGTTGGG - Intronic
982765744 4:159346590-159346612 GAAAATATTAGATATGTGGCAGG - Intronic
983052836 4:163068924-163068946 GAATTTAGGAGCTGTGTGCCAGG - Intergenic
983114557 4:163797028-163797050 CAAATTATAAGATATGTCTCTGG - Intronic
986867780 5:12009531-12009553 GGAATTATGAGATTTGGGTGGGG + Intergenic
988280730 5:29143338-29143360 GGATTTAGGAGATCTGTGTCAGG - Intergenic
988286228 5:29219986-29220008 GAAATGGTGAGATGGGTATCTGG + Intergenic
988556713 5:32242802-32242824 CAAATTATGAGACGTGTAGCAGG + Intronic
988666855 5:33338479-33338501 GAAGTTAGGAGATGTTTGTGAGG - Intergenic
990113328 5:52355556-52355578 GAAAGTTTGAGATGTATATCAGG + Intergenic
990154007 5:52853953-52853975 GAAAATGTGAGATGTCTGTTTGG + Intronic
990157775 5:52898937-52898959 GAAATGAGGAGTTGTATGTCTGG + Intronic
990797171 5:59556665-59556687 GTAACTATGAGATGGGTTTCTGG + Intronic
994120955 5:96112199-96112221 AATATTCTGAGAGGTGTGTCTGG + Intergenic
994511301 5:100707337-100707359 GAAATATAGAGATGTGTGACAGG + Intergenic
996191900 5:120554812-120554834 GAAATTATGAGAGGTGTTTCTGG - Intronic
996920769 5:128765195-128765217 GAAATCCTGAAATGTCTGTCCGG + Intronic
997280694 5:132642820-132642842 GAAATGGTGAGATGTATGTTTGG + Exonic
998297014 5:140980727-140980749 GATATTATGAGATTTGAGTAGGG + Intronic
998734167 5:145115979-145116001 TAAATTTTAATATGTGTGTCAGG - Intergenic
999408329 5:151326652-151326674 GAAATTATGGGATGAGAGACAGG - Intronic
1000451203 5:161389876-161389898 GAAATTATGAGCTGTGCAACTGG + Intronic
1000573935 5:162952183-162952205 GAGATTATGAGATTTGGGTGGGG + Intergenic
1002352776 5:178595151-178595173 GAAATTATTGGATATGTGTGTGG - Intergenic
1005829102 6:29656529-29656551 GAAGTCATGAGATGAATGTCAGG - Intergenic
1007198532 6:40085024-40085046 GAATTTAGGAGAGGTGTGGCAGG - Intergenic
1009405938 6:63312922-63312944 GAAATTATGAGTTCTGTTTTGGG + Intronic
1009723042 6:67500245-67500267 GACATTTTGGGATGTGTGTGTGG + Intergenic
1009890294 6:69672459-69672481 GAAATTAAGAAATATGTCTCTGG - Intergenic
1012191505 6:96286233-96286255 TAAATTATCAGATGTGTGATGGG - Intergenic
1015039222 6:128696753-128696775 GAAAGTATAAGATGTATATCAGG + Intergenic
1016746401 6:147585109-147585131 TTACTTATGAGAGGTGTGTCGGG + Intronic
1020428023 7:8091726-8091748 GAAATAATGGGATGTGTATGGGG - Intronic
1020804783 7:12775636-12775658 GAAAGTATGATAGGTGAGTCTGG + Intergenic
1022942419 7:35253696-35253718 GAAACTTTGAGCTGTGTTTCGGG - Exonic
1024849831 7:53699228-53699250 GGAATTTTGAGAAGTGTGTATGG - Intergenic
1026231141 7:68485171-68485193 AAAATTAAGAGATTTTTGTCTGG - Intergenic
1028318844 7:89436274-89436296 GAAATTTTTGGATGTGGGTCTGG - Intergenic
1030928849 7:115496921-115496943 GGAATTATGTCATATGTGTCAGG - Intergenic
1031226947 7:119051403-119051425 GAAATTCTGAAATGTGGGTCAGG - Intergenic
1032858224 7:135854550-135854572 GTATTTAGGAGCTGTGTGTCAGG - Intergenic
1033458589 7:141525017-141525039 GAATTTAGGAGCTCTGTGTCAGG - Intergenic
1035309133 7:157953650-157953672 GAAAAAATGAGATGTCTGTGAGG - Intronic
1035476994 7:159150826-159150848 CAAATGAGGAGATTTGTGTCCGG - Intergenic
1036531310 8:9590364-9590386 GAAATTATGACAGCTTTGTCAGG - Intronic
1037811951 8:22091789-22091811 GAAATTATGAGATAATTGTAGGG + Intronic
1038602673 8:28962593-28962615 GAAATTATGAGATTTATTTAGGG - Intronic
1038729740 8:30116271-30116293 GATGTTATGAGCTGTGTGCCAGG - Intronic
1043028866 8:75106262-75106284 GAAATTAGGAGCTCTATGTCAGG + Intergenic
1043305296 8:78786721-78786743 GATTTTATGGGTTGTGTGTCAGG - Intronic
1043841074 8:85105552-85105574 GAAAATATGAGATGTTAGTGAGG + Intergenic
1045374652 8:101559093-101559115 GAAATTAAGAGATGTTTGTGTGG + Intronic
1045446591 8:102271743-102271765 GAAATTAGGAGATGTGAATGAGG - Intronic
1046010502 8:108540772-108540794 GAAATTATGAAAGATGTGTCTGG - Intergenic
1046053063 8:109045890-109045912 GAGATTATGAGATTTGGGTGGGG + Intergenic
1046521613 8:115332958-115332980 GAAAATGTGTGATGTGTGTGTGG + Intergenic
1047015429 8:120718593-120718615 GAAAATATTAGAAGTGGGTCTGG + Intronic
1047030411 8:120873069-120873091 GTAATTATAATATGTGTGTTTGG + Intergenic
1048550363 8:135427913-135427935 GGAAATATGGGGTGTGTGTCCGG - Intergenic
1050005859 9:1129566-1129588 TAAATTATGTGCTGTGTGTTTGG + Intergenic
1052040144 9:23728933-23728955 GATTTTCTGAGATGTGGGTCAGG - Intronic
1052165598 9:25322994-25323016 GAAATCATGAGACCTGTGTTTGG + Intergenic
1053091870 9:35286091-35286113 GAGATTAGGAGCTCTGTGTCAGG - Intronic
1053361664 9:37491798-37491820 GAAATTCACAGATGGGTGTCCGG - Intronic
1058453517 9:105118359-105118381 GGAAATGTGAGATGTGTGTGTGG - Intergenic
1060143000 9:121226697-121226719 GGAATTAGGAGTTCTGTGTCAGG - Intronic
1187425935 X:19177113-19177135 GACATTTTGAGATTTGTGTTGGG - Intergenic
1189204527 X:39226477-39226499 GAAATGATGATTTGTGGGTCGGG + Intergenic
1191152110 X:57230264-57230286 CAAATTATGACATGTGACTCAGG + Intergenic
1193937141 X:87636901-87636923 GAAATTATGAGCTTTGTGTTTGG - Intronic
1196046565 X:111261925-111261947 GAAATTAAGAGAGGTGTATTGGG - Intronic
1196551319 X:117029255-117029277 GAAATTATGAGTCATATGTCTGG - Intergenic
1196745475 X:119068064-119068086 GAAATTATGAGAACAGTGCCAGG + Intergenic
1196980964 X:121213194-121213216 GAAATTGTGAGTTGTGTGCTTGG + Intergenic
1197278563 X:124508685-124508707 GATATTATGAGATTTTTTTCTGG + Intronic
1198138037 X:133774072-133774094 GAAAATATGAAATGAGTTTCTGG + Intronic
1198252813 X:134897668-134897690 AAATTTATGAGATGTTTGTGGGG - Intronic
1199074859 X:143515279-143515301 GAAATTTCTAGATGTGGGTCTGG - Intronic