ID: 929847082

View in Genome Browser
Species Human (GRCh38)
Location 2:45541552-45541574
Sequence GCTCTCAGAAGACCCAAAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 462
Summary {0: 1, 1: 3, 2: 43, 3: 102, 4: 313}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929847082 Original CRISPR GCTCTCAGAAGACCCAAAGC GGG Intronic
900816066 1:4847037-4847059 GTCCTCACAAGATCCAAAGCCGG + Intergenic
901738533 1:11327551-11327573 CCTCTCGGAAGACCTGAAGCGGG + Intergenic
903353068 1:22729928-22729950 GCTCTCAGATGACTGAAAGGAGG + Intronic
904365694 1:30009808-30009830 GCTCAGAGAAGACCCACAGTGGG + Intergenic
904551827 1:31325215-31325237 GCTCTCAGGAGACCCAAAGTAGG - Intronic
904732660 1:32606628-32606650 GCTCTCAGGAGACCTGAAGTGGG + Intronic
906051775 1:42880474-42880496 GCTCTCAGGAGACCCAATGTAGG + Intergenic
906198994 1:43947383-43947405 GCTCTTAGGAGACCCAATGAAGG - Exonic
906472910 1:46146014-46146036 GCTCAGAGAAGAGCCAAAGCCGG + Intronic
907400001 1:54219270-54219292 GCTCTCAGCAGTCCCTCAGCAGG - Intronic
907985383 1:59524742-59524764 GCTCTCAGAAGACCCAAAGTGGG - Intronic
908683877 1:66692459-66692481 GCTGTCAGCTGACCCACAGCAGG - Intronic
909197826 1:72649185-72649207 GCTCTCAGGAGACCTAAAGCTGG - Intergenic
911025729 1:93434200-93434222 GCTCTCAGGAGACCCAAAGTGGG + Intergenic
911935136 1:103960509-103960531 GCTCTCAGGAGACCCAAAGTGGG + Intergenic
912062115 1:105686645-105686667 GCTCTCAGGAGACCCAAAGTGGG + Intergenic
912094506 1:106121492-106121514 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
912318506 1:108688606-108688628 GTTCTCAGAACACAAAAAGCAGG + Intergenic
916963776 1:169914656-169914678 GCTCTCAGAAGACAAAAAGCGGG - Intergenic
918638353 1:186807261-186807283 TCCATTAGAAGACCCAAAGCTGG - Intergenic
918820668 1:189250280-189250302 GCTCTCATAAGACCCAAACTGGG - Intergenic
919253950 1:195097009-195097031 GCTCTCAGGAGACCCATAGAGGG - Intergenic
919264045 1:195238075-195238097 ACTCTCAGGAGACCCGAAGTGGG - Intergenic
919302798 1:195791404-195791426 GTTCTCAGGAGACCCGAAGTAGG - Intergenic
921674649 1:217964790-217964812 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
921675283 1:217969108-217969130 GCTCTCAGGAAACCCAAAGTGGG - Intergenic
921766891 1:218983105-218983127 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
922141640 1:222893957-222893979 GTTCTCAGGAGACCCGAAGTGGG + Intronic
922204120 1:223431847-223431869 GCTATCTGAAGACCCGAAGGAGG + Intergenic
922731049 1:227948855-227948877 GGTGTCAGAGGACCCAGAGCTGG + Intergenic
923328205 1:232899005-232899027 GCTCTCAGGTGACCCAAAGTGGG - Intergenic
923871402 1:237997951-237997973 GCTTTCTGAAGAACCAAAGGAGG - Intergenic
1063283655 10:4660172-4660194 ACTCTCTGGAGCCCCAAAGCAGG + Intergenic
1064010359 10:11730485-11730507 GCTCTCAGGAGACTCAAAGTGGG - Intergenic
1065830355 10:29609080-29609102 GCTGTCAGGAGACCCAAAGTGGG - Intronic
1066188913 10:33037436-33037458 GCTCTCAGGAGACCTACAGTGGG - Intergenic
1067106633 10:43371064-43371086 GGTCCCAGAACCCCCAAAGCTGG + Intergenic
1067258667 10:44667038-44667060 GCTCTCAGGAGACCCGAAGTGGG + Intergenic
1068130531 10:52889988-52890010 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1068137466 10:52965080-52965102 GCTCTCAGGAGACCCAAAGTGGG + Intergenic
1068290972 10:55001197-55001219 GCTCTCAGGAGACCCGAAGTGGG - Intronic
1068300417 10:55131620-55131642 GCTCTTAAGAGACCCAAAGTGGG + Intronic
1068474472 10:57507481-57507503 GCTCTTAGGAGACCCGAAGTGGG - Intergenic
1068919281 10:62465653-62465675 GCTCTCAGGAGACCCAAAGTGGG - Intronic
1068938481 10:62658248-62658270 GCTCTCAGGAGACACAAAGTGGG - Intronic
1068980708 10:63059676-63059698 GGACTCTGAAGACCCACAGCGGG - Intergenic
1069042876 10:63712763-63712785 GCCCCCAGAAGACCCAAAGAGGG - Intergenic
1069212553 10:65779734-65779756 GCTTTCAGGAGACCCAAAGTGGG - Intergenic
1069249060 10:66245563-66245585 GCTCACAGAAGTCCCACAGAGGG + Intronic
1069561738 10:69435601-69435623 GCTCTCAGGAGACCTAAAGTGGG + Intergenic
1070201141 10:74207507-74207529 GCTCTCAGGAGACCCGAAGTGGG + Intronic
1071052970 10:81473618-81473640 GCTCTCAGGAGACAAAAAGTGGG - Intergenic
1071166751 10:82816335-82816357 GCTCTCAGGAGACCCGAAGTGGG + Intronic
1071819318 10:89264322-89264344 GCTCTCAGGAGACCCAAAGTGGG + Intronic
1071981421 10:91007909-91007931 GCTCTCAATATACCCAGAGCAGG - Intergenic
1072871252 10:99123691-99123713 GCTCTCAGGAGATCCAAGGTGGG + Intronic
1073574945 10:104614557-104614579 CCTCACAGAAGTCCCAAAGTGGG - Intergenic
1074098704 10:110336095-110336117 GCTCTCACAGGACCCCCAGCAGG + Intergenic
1074301762 10:112240006-112240028 GCTCTCAGGAGACCCAAAATGGG + Intergenic
1075132049 10:119748561-119748583 GCTCTCAGGAGACCTGAAGTGGG + Intronic
1075778973 10:125004937-125004959 GCTCTTAGTAGTCCCCAAGCTGG + Intronic
1076489645 10:130849285-130849307 ACACTCAGCAAACCCAAAGCGGG + Intergenic
1076709535 10:132324361-132324383 GCTCTCAGAAGACCTATATGAGG + Intronic
1077057983 11:605215-605237 GCTCTCAGCAGCCCCAAAGAGGG - Exonic
1077865947 11:6222089-6222111 GCTCTCAAGTCACCCAAAGCAGG + Intronic
1077938893 11:6818690-6818712 CCTCTCAGGAGACCCAGAGTGGG - Intergenic
1078345499 11:10544460-10544482 GCTCTCAGGAGACTCTAAGTGGG + Intergenic
1079503911 11:21132957-21132979 GCTCTCAGGAGACCCGAAGTAGG + Intronic
1081010953 11:37812037-37812059 GCTCCCAGGAGACCCAAAATGGG + Intergenic
1081767322 11:45620758-45620780 GCTCTCAGGAGACCAAAAGTGGG + Intergenic
1083492464 11:63022980-63023002 GTTTTCAGAGAACCCAAAGCTGG + Intergenic
1083686858 11:64381635-64381657 GCTCTCAGGATGCCCAAGGCTGG + Intergenic
1083916136 11:65744791-65744813 GCTCTCAGGAGACCCGAAATGGG - Intergenic
1084261901 11:67984292-67984314 GCTCTTAGGAGACCCATCGCAGG - Intergenic
1085204410 11:74722050-74722072 GCTCTCAGAGGCTCCAAAGTGGG + Intronic
1085403979 11:76250835-76250857 GCTCTCAGGAGACCTGAAGTAGG - Intergenic
1085496925 11:76978487-76978509 GCTCTTGGGAGACCCAAAGTGGG - Intronic
1087500017 11:98938988-98939010 GCCCTCACAAGACCAGAAGCTGG - Intergenic
1089309954 11:117551513-117551535 TCCCTCAGAAGACTCTAAGCAGG - Intronic
1090041968 11:123299430-123299452 GCTCTCAGAAGACCTGAAGTGGG - Intergenic
1090043416 11:123310402-123310424 TCCCTCAGAAGAGACAAAGCAGG - Intergenic
1091992695 12:4969085-4969107 GGACTCAGAAAACCCAGAGCAGG + Intergenic
1093502392 12:19827803-19827825 GCTCTCAGGAGACCCAAAGAGGG + Intergenic
1093791062 12:23250649-23250671 AATCTCAGATAACCCAAAGCAGG - Intergenic
1096193061 12:49632618-49632640 GCCCCCAGAAGACTCACAGCTGG - Exonic
1096355483 12:50937717-50937739 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
1097360756 12:58655941-58655963 GCTCTCAGGAGACCTGAAGTGGG + Intronic
1098519609 12:71420782-71420804 GCTCTCAGGACACCCACAGTGGG + Intronic
1098917714 12:76274485-76274507 GCTCTCAGAAGAAACAGACCTGG - Intergenic
1098951642 12:76645666-76645688 GCTCGGAGGAGACCCAAAGTGGG - Intergenic
1099033775 12:77560390-77560412 GCTCTCAGGATACCCAAAGTGGG - Intergenic
1099049724 12:77768002-77768024 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
1101451466 12:104783043-104783065 GCTCTCAAAAGAGCCTATGCTGG + Intergenic
1101763938 12:107681872-107681894 GCTCAGAGAAGACCCACAGTGGG + Intergenic
1102518769 12:113466489-113466511 GCTCTCTGCAGCCCCAAAGACGG + Intronic
1106253472 13:28001615-28001637 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
1106487865 13:30188495-30188517 ACTTCCAGATGACCCAAAGCTGG - Intergenic
1107841206 13:44459422-44459444 GCTCTCAGGAGACCCAAAGTGGG - Intronic
1108249644 13:48551485-48551507 GTTCTCAGGAGACCCTAAGTGGG - Intergenic
1109348517 13:61145846-61145868 GCTCTCAGGAGACCCGAAATGGG - Intergenic
1109686695 13:65830124-65830146 GCTCTCAGGAGACCCGCAGTGGG - Intergenic
1109780816 13:67107599-67107621 GCTCTCAGGAGACCCAAAGTGGG - Intronic
1110342963 13:74414162-74414184 GCTTTCAATAGACCCAAAGTGGG - Intergenic
1110439097 13:75507753-75507775 GCTCCCAGGAGACCTAAAGTGGG + Intergenic
1111202785 13:84961722-84961744 GCTCTCAGGAGACCCGTAGTGGG + Intergenic
1111243775 13:85508604-85508626 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1111268875 13:85854058-85854080 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
1111304031 13:86382839-86382861 GCTCTCAGGAGACTCAAAGTGGG - Intergenic
1111485744 13:88896210-88896232 GCTCTCAGGAGACTCAAAGTAGG - Intergenic
1111595433 13:90404474-90404496 GCTCTCAGGAGACCCGAAGTGGG - Intergenic
1113229342 13:108195252-108195274 GCTCTCAAGAGACCCAAAATGGG - Intergenic
1114406052 14:22457300-22457322 GCTCTCAGCAGACCCAGGCCAGG - Intergenic
1114724441 14:24920653-24920675 GCTCCCAGAGGACCCTAAGAAGG + Intronic
1115267015 14:31511129-31511151 GTACTCAGGAGACCCAAAACTGG + Intronic
1115310542 14:31974432-31974454 GCCCTCAGGAGACCCGAAGTGGG + Intergenic
1115912582 14:38272789-38272811 GCTCTCAGAGGGCTCACAGCAGG - Intergenic
1115967808 14:38911892-38911914 GCTCTCCAAAGCCCGAAAGCTGG - Intergenic
1116159715 14:41253370-41253392 GCTCTCAGGAGACCGGAAGTGGG + Intergenic
1116448474 14:45038902-45038924 CCTCTCAGAAGACCTGAAGTGGG + Intronic
1116789952 14:49329669-49329691 GCTCTCAGGAGACCCAAAGTGGG + Intergenic
1116961696 14:50973723-50973745 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1120592352 14:86390853-86390875 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1120901969 14:89583469-89583491 GCCCTCACCAGACCCAATGCTGG + Intronic
1122386039 14:101348967-101348989 GCTCCCAGGAGACCTAAAGTGGG + Intergenic
1122622723 14:103068884-103068906 GTCCTCAGAGGACCCAAAGGTGG + Intergenic
1124154080 15:27209826-27209848 GGTCTCAGAAGACACCAACCTGG - Intronic
1124947508 15:34283558-34283580 GCTGTGAGAAGACCCTAAGATGG + Intronic
1126979598 15:54227126-54227148 GTTTTCAGGAGACCCAAAGTGGG + Intronic
1127258553 15:57310961-57310983 GCTCTGAGAGGACACAGAGCTGG - Intergenic
1128090283 15:64914626-64914648 GCTCACAGCAGGCCCAAAGGTGG - Intronic
1128107093 15:65053065-65053087 GCTCTCAGAAAAGCCAAACTTGG + Exonic
1128902829 15:71440970-71440992 GGTCTGAGAAGAGCCAAAGAAGG - Intronic
1129169774 15:73800536-73800558 CCTATCAGTAGACCCAAAGCTGG + Intergenic
1131568286 15:93506192-93506214 GCTCTCAGAAGACTCGCAGTGGG + Intergenic
1131605651 15:93900456-93900478 GCTCTCAGTAGACCTGAAGCAGG + Intergenic
1133211392 16:4265020-4265042 GCTCTCAGGTGGCCCAAGGCTGG - Intronic
1135042811 16:19130955-19130977 CCCCTCAGAAGTCCCACAGCAGG + Intronic
1135185401 16:20311219-20311241 GCTCTCAGAACAGCCAAGCCAGG + Exonic
1135986836 16:27190115-27190137 GCTCTCAGGAGACCAGAAGTGGG - Intergenic
1137343952 16:47637186-47637208 GCTCCCAGGAGACCCAAAGTGGG - Intronic
1138925065 16:61581115-61581137 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
1138998261 16:62478394-62478416 GCTCTCAGGAGACCTGAAGTTGG - Intergenic
1139015514 16:62684527-62684549 GTTCTCGGGAGACCCAAAGTGGG - Intergenic
1139625775 16:68187512-68187534 GCTCAGAGAAGACCCACAGAGGG + Intronic
1140784554 16:78327799-78327821 GCTCTTAGAGCACCCAGAGCTGG + Intronic
1141034449 16:80615549-80615571 GCTTACAGGAGACCCACAGCAGG - Intronic
1142255199 16:89010543-89010565 GCACTCAGAAAAGCCAAAGGAGG + Intergenic
1142304982 16:89279902-89279924 GCCCTCAGGGGAGCCAAAGCTGG - Exonic
1143109925 17:4547409-4547431 GGGCTCAGAATAACCAAAGCTGG + Intronic
1144553376 17:16260688-16260710 ATTCTCAGGAGACCCAAAGTGGG - Intronic
1145959509 17:28879314-28879336 CCTCACAGAAGACACAATGCAGG + Exonic
1146591496 17:34131600-34131622 GCTGTCAGCAGACCACAAGCTGG - Intronic
1146950143 17:36900008-36900030 GCTGGCAGAAGACCCAGGGCAGG + Intergenic
1149169490 17:53792433-53792455 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1150201441 17:63361840-63361862 GCTCTCAAGAGATCCAAAGTGGG + Intronic
1150868647 17:68880299-68880321 GCTCTCAGGAGACCCAAAGTGGG - Intronic
1153331257 18:3877983-3878005 TCCCTGAGAAGACCCCAAGCTGG - Intronic
1153428764 18:4992831-4992853 GCTCCTAGGAGACCCAAAGTTGG + Intergenic
1153536599 18:6108685-6108707 GCCCTCAGAAGGCCCAGAGGAGG - Intronic
1155215811 18:23642055-23642077 CCTCCCAGGAGACCCAAAGTGGG - Intronic
1155431472 18:25764058-25764080 GCTCTCAGGTGCCTCAAAGCAGG - Intergenic
1156442589 18:37206444-37206466 GCTCTCTGAGGATCCAAAGGGGG - Intronic
1156503432 18:37574376-37574398 ACTCTCATGTGACCCAAAGCAGG + Intergenic
1156980189 18:43277474-43277496 CTTCTCAGAAGAGCCAAAACAGG - Exonic
1157042847 18:44060837-44060859 GCTCAGAGAAGACCCACAGTAGG + Intergenic
1157111670 18:44826422-44826444 TCTCTCAAAAGACCCCAAGGGGG + Intronic
1159161296 18:64646439-64646461 GCTCTCAGGGGACCCAAAGTAGG + Intergenic
1160083537 18:75753552-75753574 GGTCTCAGGAGACCTAAAGTGGG + Intergenic
1160474122 18:79167343-79167365 GCTCTCAGGAGACGCTAAGTGGG + Intronic
1160996401 19:1884078-1884100 GCTCTCAGAGTCCTCAAAGCTGG + Intronic
1162211147 19:9093292-9093314 ACTCTCAGAAAAGCCAGAGCAGG + Exonic
1164984471 19:32638359-32638381 GCTCTCAGGAGACCCACAGTGGG - Intronic
1165610689 19:37149737-37149759 GATCTCAGGAGACCACAAGCTGG - Exonic
1168360088 19:55732267-55732289 ACTGTCAAAAGACCTAAAGCAGG - Exonic
926129898 2:10296434-10296456 TCTCTCAGATGACCCAAGGGAGG - Intergenic
926883817 2:17578617-17578639 GCTCTCAGAAGGCCCACGGCTGG + Intronic
928331344 2:30360201-30360223 GCTCTCAGCTGGCCCATAGCAGG - Intergenic
928427351 2:31190068-31190090 GAGCTCAGAAGACCAAAATCAGG + Intronic
928470235 2:31568420-31568442 GCTCTCGGGAGACCCAAAGTGGG + Intronic
928637921 2:33266735-33266757 GCTCTCAGGATACCCACAGTGGG - Intronic
928796952 2:35034385-35034407 GCTCTCAGATGACCCAAAATGGG + Intergenic
928820478 2:35355598-35355620 GCTCTCAGGAGACACAAAGTGGG + Intergenic
928823464 2:35391406-35391428 GCTCTCAGGAGACCCGAAGTGGG + Intergenic
929847082 2:45541552-45541574 GCTCTCAGAAGACCCAAAGCGGG + Intronic
930313585 2:49771596-49771618 GCTCTCAGGAGACCTAAAGTGGG + Intergenic
931131325 2:59339537-59339559 CTGCTCAGAAGACACAAAGCAGG - Intergenic
931166481 2:59754625-59754647 GCCCTCAGAAGAAGCAAAGTGGG + Intergenic
931733824 2:65176833-65176855 GTTCTCAGGAGACCCAAATTGGG + Intergenic
931874266 2:66495333-66495355 GATCACTGCAGACCCAAAGCTGG - Intronic
931975632 2:67640982-67641004 GGTCTGAAGAGACCCAAAGCTGG - Intergenic
932398217 2:71462654-71462676 GCTCTCAGGAAACCCGAAGTGGG + Intronic
932644598 2:73487753-73487775 GTTTTCAGGAGACCCAAAGTGGG + Intronic
933042632 2:77487885-77487907 GGTCTCAGGAGACCCGAAGTGGG - Intronic
933354431 2:81195649-81195671 GCCCTCAGAGGAGCCAAAGCTGG - Intergenic
933420888 2:82043698-82043720 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
933454955 2:82508393-82508415 GTTCTCAGGAGACCCAAAGTCGG - Intergenic
933606485 2:84389621-84389643 GCTCTCAGGAGACCCAAAGTTGG + Intergenic
933811864 2:86037610-86037632 GCTCCCAGAAGACCAAGAACTGG + Intronic
934518176 2:95001863-95001885 GCAGTCACAATACCCAAAGCAGG + Intergenic
935188718 2:100758256-100758278 GCGCTGGGAAGACCAAAAGCAGG + Intergenic
935667588 2:105525859-105525881 GCTCTCAAGAGACCCAAAGTAGG - Intergenic
937331138 2:121030940-121030962 GCTCCCAGAAGCCCCACAGCTGG + Intergenic
937370802 2:121296044-121296066 GCTCTCAGGAGACCCAAAGTGGG + Intergenic
937737884 2:125313597-125313619 GCTCTCAGGAGACCCACAGTGGG - Intergenic
938697891 2:133851135-133851157 GCTCACAGATGACCAGAAGCAGG + Intergenic
939837717 2:147150639-147150661 GCTTTCAGGAGACCCAAATTGGG - Intergenic
940422799 2:153499248-153499270 GCTCTCAGGAGACCCAAAATGGG + Intergenic
940956916 2:159738526-159738548 GCTCTCAGGAGACCCAAAGTGGG + Intronic
941145832 2:161844158-161844180 GAACTCAGAAGAGGCAAAGCAGG + Intronic
941151450 2:161919610-161919632 GTTCTCAGGAGGCCCAAAGTGGG - Intronic
941998914 2:171627122-171627144 GCTCTCAGGAGACCCAAAATGGG - Intergenic
943064147 2:183069466-183069488 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
943179391 2:184524321-184524343 GCTCTCAGGAGACCCCAAATGGG + Intergenic
943191652 2:184685569-184685591 GCTCTCAGGAGACTAAAAGTGGG + Intronic
943928460 2:193819388-193819410 GTTCTCAGGAGACCCACAGTAGG + Intergenic
943932212 2:193868482-193868504 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
943960268 2:194254775-194254797 GCTCTCAGAAGACCCAAAGTGGG - Intergenic
944146793 2:196514769-196514791 GCTCTCAGGAGACTCAGAGTGGG - Intronic
945721370 2:213421936-213421958 GCTCTCAGGAGACCCAAAGTGGG - Intronic
946158931 2:217824361-217824383 GCTCACAGGACACCCAGAGCTGG + Intronic
948334890 2:237200212-237200234 GCTCTCAGGAGACCCGAAGTGGG + Intergenic
948434598 2:237944495-237944517 GCTCTCAGGAGACCCAGAGTGGG - Intergenic
1170221608 20:13947446-13947468 GCTTTCAGGAGACCCAAAGTGGG - Intronic
1170314884 20:15031491-15031513 GCTCTCAGGAAACCCATAGTGGG + Intronic
1170327893 20:15176597-15176619 GCCCTCAGGAGACCCGAAGTGGG - Intronic
1170964635 20:21055416-21055438 GCTCACAGAAGACACCAAGTGGG - Intergenic
1171286050 20:23938739-23938761 GCTCTCAGGAGACCCAAGATGGG - Intergenic
1172701199 20:36854663-36854685 GAGCCCAGAAGACCCAAAGCAGG + Intronic
1175138610 20:56843114-56843136 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
1175296630 20:57913244-57913266 GCTCTGTCAAGACCCTAAGCAGG + Intergenic
1177037352 21:16060545-16060567 GCTCTCAGGAGATCCAAAGTGGG + Intergenic
1177344610 21:19853720-19853742 GCTCTCAGGGGACCCGAAGTGGG + Intergenic
1177459950 21:21397067-21397089 GCTCTCAGTAGACCCTAAGTGGG + Intronic
1178947416 21:36959729-36959751 GCTCTCAGGAGACCTGAAGTGGG - Intronic
1179028409 21:37699487-37699509 GCTCTCAGAAGAGCAAAACATGG - Intronic
1181099767 22:20531444-20531466 CCTCTCCCAAGACCCAGAGCTGG + Intronic
1181622480 22:24100561-24100583 TCTCACAGTAGACCCAAGGCTGG - Intronic
1181843824 22:25689798-25689820 GTTCTCAGAAGCCCAGAAGCTGG + Intronic
1182314876 22:29439042-29439064 TCTCTCAGAAGAACAAAATCAGG + Exonic
1182549349 22:31092593-31092615 CCCCTGAGAAGGCCCAAAGCTGG - Intronic
1184865786 22:47201298-47201320 GCTCAGAGAAGACCCACAGGGGG + Intergenic
1184963499 22:47949155-47949177 CCTCTCTGTAGACCCAGAGCTGG - Intergenic
1185331286 22:50253111-50253133 GCTCTCAGAAACCTCAGAGCTGG - Exonic
949707704 3:6837958-6837980 GCTCTCAGAGGTGCCAAATCAGG + Intronic
951767521 3:26216042-26216064 TCCCACAGAAGATCCAAAGCAGG - Intergenic
953289895 3:41650134-41650156 GCTCCCAGGAGACCCAAAGTGGG - Intronic
954609967 3:51939212-51939234 ACTCTCAGGAAAGCCAAAGCTGG + Intronic
955111848 3:55958121-55958143 GCTCTCAGGAGACCCGAAATGGG + Intronic
955596140 3:60592756-60592778 GCTCCCAGAAGAAACAGAGCTGG + Intronic
957156531 3:76551360-76551382 GCTCTCAGGAGACCTGAAGTGGG - Intronic
957417936 3:79929869-79929891 GCTCTCAGGAGACCCACAGTGGG - Intergenic
957459359 3:80497146-80497168 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
957646700 3:82939568-82939590 GCTCTCAGGGGACCCAAAGTGGG - Intergenic
957853658 3:85845244-85845266 GCTCTCACAAGACAGATAGCAGG + Intronic
958561998 3:95759353-95759375 GCTCTCAGGAAACCCAAAGTGGG + Intergenic
958584428 3:96068803-96068825 GCTCTCAGGAGACCCAAACTGGG + Intergenic
958675510 3:97264760-97264782 GCTCTGAGGAGACCCACAGTGGG + Intronic
959252575 3:103966458-103966480 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
959374267 3:105568689-105568711 GGTCTAAGTAGACCAAAAGCTGG - Intronic
959842260 3:110991145-110991167 GCCAGCAGAAGACCCAGAGCGGG + Intergenic
959897139 3:111617635-111617657 GCTCTCAGGAGACCTGAAGTGGG - Intronic
960207495 3:114920011-114920033 TCTATCAGAAGACACAAAGAAGG + Intronic
960306527 3:116068410-116068432 CCAGTCAGAAGACCCAAAGCAGG - Intronic
961311435 3:126004382-126004404 GCTCTCAGGAGACCCGGAGTGGG - Intergenic
963346314 3:144099601-144099623 GTTCTCAGAGGACCCAAAGTGGG - Intergenic
964075137 3:152684197-152684219 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
964494152 3:157270622-157270644 GAGCTGAGAAGACCCACAGCAGG + Intronic
965013962 3:163131885-163131907 GCTCTCAGGATTCCCAAAGTGGG - Intergenic
965601569 3:170459454-170459476 GCTCTCAGAAGAACCTGACCTGG - Intronic
966167695 3:177039536-177039558 AATCTCTGAAGCCCCAAAGCAGG + Intronic
967335944 3:188344865-188344887 CCTCTCATAAGACCCAGATCAGG - Intronic
968094339 3:195917547-195917569 ACTATCAGCAGACCCAAAGAAGG + Intergenic
968142908 3:196273495-196273517 GCCCTCAGGAGACCCCAAGCGGG + Intronic
968838289 4:2981399-2981421 GCTCTCAGGAGACCCAAAATGGG + Intronic
969179275 4:5424622-5424644 GCTCTCAGGAGACCTGAAGTGGG - Intronic
970484685 4:16513167-16513189 GAGCTCAGAGGACCAAAAGCAGG - Intronic
971834600 4:31747726-31747748 GCTCTCAGGAGACCCAAAGTGGG + Intergenic
972788234 4:42346792-42346814 GCTCTCAGGAAACCCAGAGTGGG - Intergenic
973534485 4:51867510-51867532 GCTTTCAGCAGACCCAAAGTGGG + Intronic
974023484 4:56711813-56711835 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
974432619 4:61817552-61817574 GCTCTCAGGAGACCTGAAGTGGG - Intronic
974515041 4:62897601-62897623 GCTCTCAGGAGACCCAAACTGGG - Intergenic
974628940 4:64458145-64458167 GCTCTCAGGAGACCCATAGTGGG - Intergenic
974697976 4:65398840-65398862 GCTTTAAGGAGACCCAAAGTGGG - Intronic
974894910 4:67927044-67927066 GCTCACAGGAGACCCACAGTGGG - Intronic
975023598 4:69521092-69521114 GCTCTCAGGAGACCCTAAGTGGG - Intronic
975044452 4:69783998-69784020 GCTCAGAGAAGACCCACAGTGGG - Intronic
975299772 4:72775626-72775648 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
976478823 4:85515035-85515057 TCTCTCAGAAGATCCGCAGCAGG - Intronic
977410325 4:96653813-96653835 GCTCTCAGGAGACCCAGGGTGGG - Intergenic
978229851 4:106385509-106385531 GCTCAGAGAAGACCCACAGTGGG + Intergenic
978249318 4:106610975-106610997 GCTCAGAGGAGACCCACAGCAGG - Intergenic
978545844 4:109872265-109872287 GCTCTTACAAGACAGAAAGCAGG - Exonic
979010827 4:115366127-115366149 GCTCTCAGGAGACCCAAAATAGG - Intergenic
979637832 4:122977790-122977812 GCTCTCAGGAGACCTGAAGTGGG + Intronic
979648927 4:123107365-123107387 GCTCTCAGGAGACCCAACATAGG + Intronic
981889162 4:149715731-149715753 GCTCTCAGGAGACCCGAAGTGGG + Intergenic
982181505 4:152752090-152752112 GTTCTCAGGAGACTCAAAGTGGG - Intronic
982856179 4:160385389-160385411 GCTCTCAGGTGACCCAGAGTGGG + Intergenic
983323827 4:166227828-166227850 GCTCTCAGAAGACCCAAAGTTGG - Intergenic
984375381 4:178922596-178922618 GTTCTCAGGAGACCCAAAGTGGG - Intergenic
984763855 4:183384687-183384709 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
986061524 5:4196152-4196174 TCTCTCTGAAGACTCACAGCGGG + Intergenic
986136245 5:4981621-4981643 TCTCTCAGAGGGACCAAAGCTGG + Intergenic
986164342 5:5260663-5260685 GCTCTCCTAAGTTCCAAAGCAGG - Intronic
986556476 5:9014936-9014958 GCTCTCAGCAGGCCCAAGGAAGG + Intergenic
987815962 5:22901464-22901486 GCTCTTAGGAGACCCAAAGTGGG + Intergenic
987875455 5:23675137-23675159 GCTCTCAGGAGCCCCAAAGTGGG - Intergenic
989425398 5:41290602-41290624 GCTCTCAGGAGACCCAGAGTGGG + Intergenic
989730422 5:44641582-44641604 GCTCTCAGGAGACCCAAAGTGGG + Intergenic
991039626 5:62162266-62162288 GCTCTCAGGAGACCCAAAGAGGG + Intergenic
991230913 5:64331578-64331600 GTTCTCAGGAGACCCACAGTGGG - Intronic
994246899 5:97488773-97488795 GCTCTCAGGAGACTCATAGTGGG + Intergenic
994452062 5:99955660-99955682 GCTTTCAGGAGACCCAAAGTGGG + Intergenic
994518010 5:100794510-100794532 GCTCTCAGAAGACCCACACCGGG - Intergenic
994633645 5:102317725-102317747 GCTCTAAGAAGAGACAAAGAAGG - Intergenic
994692322 5:103034309-103034331 GCTCTCAGGAGACCCAAAGTGGG + Intergenic
994916273 5:105983198-105983220 GGTCTCAGGTAACCCAAAGCTGG - Intergenic
995146071 5:108787834-108787856 GCTCTCAGGAGACTCAAAGTGGG - Intronic
995927058 5:117386754-117386776 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
997289116 5:132712355-132712377 GATCTCATAATAGCCAAAGCTGG + Intronic
997847269 5:137298256-137298278 GCTCTCAGGAGACCCCATTCTGG - Intronic
999227218 5:150035686-150035708 GCACTCAGAGAACACAAAGCGGG + Intronic
999767719 5:154754466-154754488 GATCTCAGAAGTCCCAATCCAGG + Intronic
1000618735 5:163459711-163459733 GCTCTGACCAGACCCAAACCTGG + Intronic
1001170241 5:169412600-169412622 TTTCTAAGTAGACCCAAAGCTGG + Intergenic
1002771853 6:296921-296943 GCTTTCAGAGGACACACAGCAGG - Intronic
1002986279 6:2192290-2192312 GCTCAGAGAAGACCCACAGTGGG - Intronic
1004013037 6:11707717-11707739 ACTCTCTCAAGACACAAAGCAGG + Intergenic
1004518841 6:16343619-16343641 GCTCACTGAAGACTGAAAGCTGG + Intronic
1005594768 6:27368525-27368547 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
1006463766 6:34178902-34178924 GCTCTCAGGAGACCCGGAGTGGG + Intergenic
1006766205 6:36509235-36509257 GCTCTCAGGAGACCCAAAGTGGG + Intronic
1008126353 6:47673563-47673585 GCTCTCTGGTAACCCAAAGCTGG - Intronic
1008231644 6:48990463-48990485 GCTCTCAGAATACCCAAAGTGGG - Intergenic
1009582742 6:65557808-65557830 GCTCTCAGGAGACCCAAAATGGG + Intronic
1009643058 6:66362555-66362577 GCTCTCAAGAGACCCATAGCAGG + Intergenic
1011284130 6:85705904-85705926 GCTCTCAGGAGACCCAAGATGGG + Intergenic
1011642673 6:89430730-89430752 GGTCTCATGAGAGCCAAAGCAGG - Intergenic
1011784946 6:90833165-90833187 CCTCGCAGAAGACACCAAGCAGG - Intergenic
1012071903 6:94631849-94631871 GCTGTCAGAAGAATCAAATCTGG + Intergenic
1012100858 6:95084217-95084239 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
1012691479 6:102318753-102318775 GGTCCCAGAAGAACAAAAGCTGG - Intergenic
1012709598 6:102582268-102582290 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1013438539 6:110138542-110138564 GCTCTCAGGACACCGGAAGCGGG + Intronic
1013803069 6:113969897-113969919 GCTCTCTAAATCCCCAAAGCAGG + Intronic
1014227118 6:118861540-118861562 GCTCTCAGGAGACCCGAAGTGGG + Intronic
1014384766 6:120786469-120786491 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1014391746 6:120872918-120872940 GCTCTCAAGAGACCCAGAGTGGG - Intergenic
1014418704 6:121214912-121214934 GCTCTCAGGAGACCAGAAGTGGG + Intronic
1016163258 6:140907848-140907870 GCTCTCAGGAGACCCAAAGTGGG + Intergenic
1017129066 6:151092566-151092588 GCTCTCACAGGACCCGATGCAGG + Exonic
1017205457 6:151800294-151800316 GCTCTCAGAAGAGCCTGAGCAGG + Intronic
1017420446 6:154267633-154267655 GCTCAGAGAAGACCCATAGTGGG + Intronic
1017587977 6:155947588-155947610 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
1017987035 6:159453025-159453047 GATCACAGAAGACGCAAAGGAGG + Intergenic
1019448256 7:1082567-1082589 TCTCACCCAAGACCCAAAGCCGG + Intronic
1020959677 7:14787064-14787086 GCTCTCAGGACACCCAAACGGGG - Intronic
1021201267 7:17730830-17730852 TCTCGCAGGGGACCCAAAGCAGG - Intergenic
1021269974 7:18574090-18574112 GTTCTCAAGAGACCCAAAGTGGG + Intronic
1021343079 7:19488706-19488728 GCTCTCAGGAGACCCAAAATGGG + Intergenic
1021431096 7:20559926-20559948 GCTCTCAGGAGACCTAAAGCGGG + Intergenic
1021677715 7:23097739-23097761 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1022186750 7:27976667-27976689 GCTCTCAGAAGACCATAAACAGG + Intronic
1022249327 7:28591660-28591682 GCTATCAGAAGACCAAAAAAGGG + Intronic
1022391933 7:29950834-29950856 GCTCTCAGGGGACCCAAAGTGGG - Intronic
1022971686 7:35523568-35523590 GCTCTGTGATCACCCAAAGCAGG - Intergenic
1024024672 7:45400310-45400332 GCTCTCAGGACACCCAAAGTAGG - Intergenic
1024857000 7:53794224-53794246 GTTCTCAGGAGACCCAAAGTGGG + Intergenic
1025953282 7:66163008-66163030 GCTCTCAGAAGGAACAAACCTGG + Intergenic
1026295934 7:69052483-69052505 GTTCTCATAAGACTCAAATCTGG - Intergenic
1026539647 7:71268815-71268837 GCCCTCAGAATTCCCCAAGCAGG - Intronic
1027687338 7:81294509-81294531 GCTCTCAGGAAACCCAAAGTGGG + Intergenic
1027734877 7:81920185-81920207 GCTCTCAGGGGGCCCAAAGTGGG + Intergenic
1027924878 7:84447628-84447650 GCTCTTAGGAGACCCGAAGTGGG - Intronic
1028035086 7:85972200-85972222 GCTCTGAGAAGACCTGAAGTGGG + Intergenic
1028136809 7:87230926-87230948 GCTCTCAGGAGACCCGAAGTGGG - Intergenic
1028401910 7:90433681-90433703 GCTTTTAGGAGACCCAAAGTTGG + Intronic
1030359490 7:108580047-108580069 GCTCTCAGGGAACCCAAAGTGGG - Intergenic
1030899235 7:115102058-115102080 GCTCTCAGAGGGCTCAAAGTAGG - Intergenic
1031921921 7:127608696-127608718 GCTCTCAGAAGACCGGAAGTAGG + Intergenic
1032919230 7:136527214-136527236 GCTCACAGGAGACCCAGAGTGGG + Intergenic
1033566654 7:142585406-142585428 GGACTCAGGTGACCCAAAGCTGG - Intergenic
1034101759 7:148456980-148457002 GCTCTCAGGAGACCCGAAGTGGG + Intergenic
1034919881 7:155071001-155071023 GCACTCCGAAGACCGAGAGCAGG - Exonic
1036591301 8:10171046-10171068 GCTCTCAAAAGACCTACAGCTGG - Intronic
1036907684 8:12720770-12720792 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
1038913945 8:31998982-31999004 TCTTTAAGAAGACCCAAAGCAGG + Intronic
1039210107 8:35204283-35204305 GCTCTCAGGAGACTCAAAGTGGG + Intergenic
1039484199 8:37898861-37898883 CTTCCAAGAAGACCCAAAGCTGG + Intronic
1041205457 8:55494558-55494580 GCTCAGAGGAGACCCAAAGTGGG + Intronic
1043180538 8:77082605-77082627 GCTCTCAGGAGACCCGAAGTGGG + Intergenic
1043695246 8:83208877-83208899 GCTCTCAGGAGATCCAAAGTGGG - Intergenic
1043702805 8:83312578-83312600 GTTCTCAGGAGACCCACAGTGGG + Intergenic
1043737662 8:83768269-83768291 GCTTTCAGGAGACCCACAGTGGG + Intergenic
1043750281 8:83926180-83926202 GCTCTCAGGAGGCCCAAACCGGG + Intergenic
1043798600 8:84578562-84578584 GCTCTCAGGAGACCTGAAGTGGG + Intronic
1044053712 8:87542372-87542394 GCTCTCTAGAGACCCAAAGTGGG + Intronic
1044756771 8:95471195-95471217 GGTATCAGAGCACCCAAAGCAGG + Intergenic
1045300684 8:100907902-100907924 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
1045680844 8:104658291-104658313 GCACCAGGAAGACCCAAAGCTGG + Intronic
1045873415 8:106950660-106950682 GCTCTCAAGAGACCCAAAGTGGG - Intergenic
1046186994 8:110734533-110734555 GCTCTAAGGAGACCCACAGTGGG + Intergenic
1046195772 8:110860978-110861000 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1046407289 8:113790889-113790911 GCTCTGAGGAGACCCACAGTTGG + Intergenic
1046738956 8:117808691-117808713 CCTCTCAGAGGTTCCAAAGCAGG + Intronic
1047318318 8:123754783-123754805 GCTCTCAGGAGACCCAATGTTGG + Intergenic
1047543904 8:125797266-125797288 GCTCTCAGGAGACCTGAAGTAGG + Intergenic
1048547897 8:135404370-135404392 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
1049140530 8:140950066-140950088 GCTCTCAGGAGACCCAAAGTGGG - Intronic
1049441655 8:142612437-142612459 GCTCTCAGATGCCCCACAGCCGG + Intronic
1049717613 8:144100367-144100389 CCTCACAGCAGAACCAAAGCAGG + Intronic
1050426207 9:5515509-5515531 GCTTTCAGGAGACCCAAAGTGGG + Intronic
1050947986 9:11550122-11550144 GCACTCAGGAGATCCAAAGTGGG - Intergenic
1052437172 9:28444060-28444082 GCTCTCAGGACACCCAAAGTTGG - Intronic
1052567036 9:30168115-30168137 GCTCTCAGAAGACCATAGGGAGG + Intergenic
1052623558 9:30944617-30944639 GCTCTCAGGAGACACGAAGTTGG - Intergenic
1053617437 9:39782095-39782117 GCTCAGAGAAGACCCACAGTGGG - Intergenic
1053875619 9:42541458-42541480 GCTCAGAGAAGACCCACAGTGGG - Intergenic
1054236080 9:62560266-62560288 GCTCAGAGAAGACCCACAGTGGG + Intergenic
1054266729 9:62925342-62925364 GCTCAGAGAAGACCCACAGTGGG + Intergenic
1054550222 9:66594796-66594818 GCTCAGAGAAGACCCACAGTGGG + Intergenic
1055765082 9:79653832-79653854 AATTTCAGAAGAACCAAAGCTGG - Intronic
1055816571 9:80213366-80213388 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
1056994402 9:91443037-91443059 GCTCTCAAGAGACCTAAAGTGGG + Intergenic
1057009018 9:91585076-91585098 GCTCTGAGAACACCCAAACCTGG - Intronic
1057498643 9:95579578-95579600 GAGTTCAGAAGCCCCAAAGCTGG - Intergenic
1058510850 9:105714264-105714286 GCTCAGAGAAGACCCACAGTGGG - Intronic
1059104853 9:111502160-111502182 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1060494646 9:124109435-124109457 GCTATCAGGAGAACCAAAGGAGG - Intergenic
1060618842 9:125044524-125044546 GCTCTCAGGAGACCCCTAGTAGG - Intronic
1061743196 9:132722287-132722309 GCTCTCAGGAGACCCGAAGTGGG + Intergenic
1062348766 9:136128554-136128576 TCTCTCAGAAGACCCCAGGGAGG - Intergenic
1185843318 X:3413751-3413773 GCTCTCAGAGGAACCAAACAGGG + Intergenic
1186223584 X:7374954-7374976 GTTCTCAGGAGACCCAAAATGGG + Intergenic
1186607610 X:11108457-11108479 TTTCTCAGAAGACCCAAGCCTGG - Intergenic
1186608612 X:11116461-11116483 GCCCTCAGAATACCGACAGCAGG - Intronic
1187388726 X:18872040-18872062 GCTCTCAGAGGATCCGCAGCAGG + Intergenic
1188194974 X:27222373-27222395 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
1189262090 X:39686516-39686538 GCTCTCAACACAGCCAAAGCTGG + Intergenic
1189319200 X:40077374-40077396 GCTGTCTGACGACCAAAAGCAGG + Intronic
1189919347 X:45888176-45888198 GCTCTCAGAAGAGCCAAGTTTGG + Intergenic
1190369550 X:49727601-49727623 GCTCAGAGAAGACCCATAGTGGG - Intergenic
1190621235 X:52288622-52288644 GCTTTCAGGAGACCCAAAGTAGG - Intergenic
1191016396 X:55813995-55814017 GCTCAGAGGAGACCCAAAGTGGG - Intergenic
1192470533 X:71395027-71395049 GCTTTCAGAAGACCCTCAGAAGG + Intronic
1193467598 X:81867819-81867841 ACTCAGAGAAGACCCAAAGTGGG + Intergenic
1193537686 X:82733672-82733694 GCTCTCTGAAGACAGAAATCAGG - Intergenic
1194212248 X:91082909-91082931 GTTCTCAGGAGACCCAAAGTGGG - Intergenic
1194891456 X:99384481-99384503 GCTCTCAGGAGACCCACAGTGGG + Intergenic
1197035718 X:121870833-121870855 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
1198189523 X:134288332-134288354 GCTCTCAGGAGACTTAAAGTGGG - Intergenic
1198227538 X:134659408-134659430 GCCCACAGAAGAACCAAAGGTGG + Intronic
1199286625 X:146061653-146061675 CCTCCCAGAAATCCCAAAGCAGG + Intergenic
1200749123 Y:6928932-6928954 GCTCTCAGGAGACCTAAAGTGGG + Intronic
1200871083 Y:8099141-8099163 TCTCTCAGTAGACCAATAGCAGG - Intergenic
1200977316 Y:9227074-9227096 GATCTCAGGAGACACAAAGTGGG + Intergenic
1201231878 Y:11872828-11872850 GCTCTCAGAGGAACCAAACAGGG - Intergenic
1201855625 Y:18537345-18537367 GCTCTCAGGAGACAGAAAGCAGG - Intergenic
1201877696 Y:18783040-18783062 GCTCTCAGGAGACAGAAAGCAGG + Intronic
1202360790 Y:24107981-24108003 GCTCTCAGGAGACAGAAAGGAGG + Intergenic
1202509988 Y:25562137-25562159 GCTCTCAGGAGACAGAAAGGAGG - Intergenic