ID: 929848190

View in Genome Browser
Species Human (GRCh38)
Location 2:45555073-45555095
Sequence ATTTTTAAGGGGATCGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 7, 2: 39, 3: 87, 4: 200}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929848190_929848198 -7 Left 929848190 2:45555073-45555095 CCCTCCACGATCCCCTTAAAAAT 0: 1
1: 7
2: 39
3: 87
4: 200
Right 929848198 2:45555089-45555111 TAAAAATCCTAGCCCAGGCTGGG 0: 1
1: 1
2: 6
3: 77
4: 614
929848190_929848197 -8 Left 929848190 2:45555073-45555095 CCCTCCACGATCCCCTTAAAAAT 0: 1
1: 7
2: 39
3: 87
4: 200
Right 929848197 2:45555088-45555110 TTAAAAATCCTAGCCCAGGCTGG 0: 1
1: 0
2: 9
3: 62
4: 402
929848190_929848202 27 Left 929848190 2:45555073-45555095 CCCTCCACGATCCCCTTAAAAAT 0: 1
1: 7
2: 39
3: 87
4: 200
Right 929848202 2:45555123-45555145 ACATCTGTAATCCCAGAGTATGG 0: 1
1: 0
2: 17
3: 151
4: 1099

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929848190 Original CRISPR ATTTTTAAGGGGATCGTGGA GGG (reversed) Intronic
901729349 1:11267600-11267622 GTTTTTAAGGGGATTGTAGAGGG + Intergenic
904362563 1:29986270-29986292 GTTTTTAAGGGGACCATAGAGGG - Intergenic
904502083 1:30919057-30919079 ATTTCTAAGGGGATTGTTGAGGG + Intergenic
905078686 1:35297502-35297524 ATTTTTAAGGTTATCTTGAAAGG + Intronic
906850046 1:49238471-49238493 ATTCTTAAGTGGGTGGTGGAAGG + Intronic
907888284 1:58614244-58614266 GTTTTTAAGGAGATCCTGGAGGG - Intergenic
908960405 1:69690809-69690831 CTTTTTAAGGGAATCATAGAGGG + Intronic
910235842 1:85035716-85035738 ATTTTTTAGGGGAGAGAGGATGG - Intronic
911850383 1:102811184-102811206 GCTTTTAAGGGGTTCCTGGATGG + Intergenic
912062586 1:105691040-105691062 ATTTTTCATGGGATAGGGGAGGG - Intergenic
912102128 1:106222704-106222726 ATTTTTCAGAGGATCATAGAGGG - Intergenic
912581918 1:110728730-110728752 ATTTTTAAGGATAACGTGGTGGG + Intergenic
913118386 1:115717445-115717467 GTTTTTAAGAGGATCATGGAAGG - Intronic
913480610 1:119285684-119285706 GGTTTTAAGGGGATTATGGAGGG - Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
915638452 1:157202980-157203002 ATTTTTAAGGAGCTTGAGGAAGG + Intergenic
915657009 1:157369029-157369051 GTTTTTAAGGATATCGTGGAGGG + Intergenic
915671982 1:157497286-157497308 GTTTTTAAGGATATAGTGGAGGG - Intergenic
915878900 1:159644258-159644280 CCTTTTAAGGGGATCATGGAAGG + Intergenic
916434155 1:164761117-164761139 ACTTTTAAGGGTATGGAGGAGGG - Intronic
917090614 1:171349932-171349954 GATTTTAAGGGGATTGTGGAGGG + Intergenic
918217528 1:182405628-182405650 AGTTTTAAGGGGATCATGGAGGG - Intergenic
918366923 1:183817885-183817907 ACTGTTAAGGGTATCCTGGAGGG + Intronic
918979482 1:191537118-191537140 GCTTTTAAGGGGATCATGGAGGG - Intergenic
919382506 1:196876229-196876251 GACTTTAAGGGGATCATGGAGGG - Intronic
920752931 1:208698616-208698638 GTTTTTAAAAGGATCATGGAGGG - Intergenic
921330457 1:214030534-214030556 TTTTTAAAGGGGATTGAGGAGGG + Intronic
922421373 1:225463018-225463040 ATTTTTAAGGGGATCATGGAGGG - Intergenic
924034552 1:239923172-239923194 GTTTTTAAGGGGATTATGGAAGG + Intergenic
1064675464 10:17755698-17755720 AATTTTGAGGGAATGGTGGAAGG + Intronic
1064845617 10:19649041-19649063 ATCTTTTGTGGGATCGTGGATGG - Intronic
1064984629 10:21197920-21197942 TTTCTTAAGGGAATCATGGAGGG - Intergenic
1068953359 10:62800573-62800595 ATTTTTAAGAGGTTGGTGGTGGG - Intergenic
1069171420 10:65234535-65234557 GTTTTTATGGGGATCATGAAAGG - Intergenic
1069175133 10:65280902-65280924 ATTTCTAAGAGGATCATGGAGGG + Intergenic
1071361598 10:84851737-84851759 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1072852794 10:98914244-98914266 ATTTTTACGTGGATGGTGGCAGG - Intronic
1075036298 10:119071117-119071139 ATATTTAAGTAGATAGTGGAAGG - Intronic
1075154929 10:119967362-119967384 GTTTTTAAGGAGATTGTGGAGGG + Intergenic
1079036059 11:17021140-17021162 GCTTTTAAGGGGATTGTGGAGGG - Intergenic
1080574978 11:33590134-33590156 ACTTTTAAGGGGATGCTGTAAGG - Intronic
1080660245 11:34290242-34290264 ATTATTCATGGGATCGTGCAAGG - Intronic
1081110910 11:39132059-39132081 GTTTTAAAGGGGATGGTGGAAGG - Intergenic
1082170722 11:49001818-49001840 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1083574901 11:63783370-63783392 CTTTTGAAGGGGAGCCTGGAAGG - Intergenic
1084207274 11:67602973-67602995 TTTTTTAAGGAGATTGTGGAGGG + Exonic
1085853713 11:80151939-80151961 ATTTTCAAGGGAATAGTGAAGGG + Intergenic
1086695083 11:89834542-89834564 ATTTTTAAGGGGATTGTGGAAGG + Intergenic
1086711067 11:90009942-90009964 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1087106590 11:94415536-94415558 ATTTTTAAAGGGCTCTTGGCTGG - Intergenic
1088588012 11:111377072-111377094 TTTTTAAAGGGGATGCTGGAGGG - Intronic
1089267272 11:117273719-117273741 AGTTTTAAGGGGATTGTGGAAGG + Intronic
1091700634 12:2658283-2658305 ATTTTTAAGTAGATTTTGGAGGG - Intronic
1092501720 12:9053968-9053990 GCTTTTAAGGGGATCATGGAGGG - Intergenic
1093805037 12:23421883-23421905 ATCGCTAAGGGGATCATGGAAGG - Intergenic
1094413587 12:30193732-30193754 ATTTTTAAGGGCAGGGTGGCAGG + Intergenic
1094417294 12:30230871-30230893 GTTTTTAAGAGGATCATGGAGGG + Intergenic
1095281317 12:40354615-40354637 ATATTAAAGGGAATTGTGGAAGG + Intronic
1097011376 12:55955687-55955709 ATATATAAGGGGATCTGGGAAGG + Intronic
1098078187 12:66756011-66756033 ATTTTTAAAAGGATGGGGGAAGG - Intronic
1098950545 12:76636481-76636503 GTTTTTCAGGGGGTCATGGAGGG + Intergenic
1099620379 12:84996201-84996223 ATTTTTAAGGGGATTGTGAAGGG - Intergenic
1099738209 12:86597787-86597809 CTTTTTAAAGGGATTGTGGATGG - Intronic
1101405713 12:104426756-104426778 CTTTTGAAGGGGATCGGGGTGGG + Intergenic
1102190268 12:110982500-110982522 ATTTTTAAGGGCATGTTGGTAGG + Intergenic
1103179593 12:118898450-118898472 ATGTTTAAGTGGAGTGTGGAAGG + Intergenic
1105852924 13:24351636-24351658 ATTATTATGGGGCTCCTGGAAGG - Intergenic
1109141337 13:58716275-58716297 ATTTTTCTGGGGATCATGGGAGG + Intergenic
1109203164 13:59453240-59453262 ATTTTCAAGGAGAGCTTGGAAGG - Intergenic
1111102107 13:83601837-83601859 GTTTTTAAGGGGATCATGGTGGG - Intergenic
1112587389 13:100731316-100731338 ATTTTTAGGTGGATGGGGGATGG + Intergenic
1114505095 14:23204794-23204816 ATTTTGATGGGGATTGTGTATGG + Intronic
1114786272 14:25603457-25603479 ATTTTTAAGAGGATCATGGTGGG + Intergenic
1114958049 14:27848338-27848360 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1115096414 14:29641871-29641893 ATTTTTAAAGGGATGATGGCAGG - Intronic
1115960871 14:38835573-38835595 ATTTTTAAATGAAGCGTGGAAGG - Intergenic
1117745880 14:58869140-58869162 ATTTTTAAGGGGATGGTCGCTGG - Intergenic
1118919702 14:70138967-70138989 ATATTTAATGGGATGTTGGATGG + Intronic
1119298320 14:73551255-73551277 GTTTTTAAAGGGATCATGGAGGG - Intronic
1119302616 14:73583442-73583464 GTTTTTAAAGGGATCATGGAGGG - Intergenic
1122567510 14:102671284-102671306 ATTTTTTAGGGTATAGGGGAGGG + Intronic
1124198014 15:27650221-27650243 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1124217253 15:27817607-27817629 GTTTCTAAGAGGATCATGGAGGG - Intronic
1124583709 15:30986011-30986033 ATTTTTCAGAGGATGGTGGAAGG + Intronic
1124878221 15:33616359-33616381 ATTTTTTAGAGGGTAGTGGAGGG + Intronic
1124988215 15:34644245-34644267 GTTTTTAAAGGGATCATCGAAGG + Intergenic
1127213885 15:56803799-56803821 ATTTTTAAGGAGATTGAGAAAGG - Intronic
1127292603 15:57583564-57583586 GCTTTTAAGGGGATCATGGAGGG + Intergenic
1128120232 15:65140648-65140670 ATTTTTAAGGGGGTTGTGGAGGG - Intergenic
1130026511 15:80275466-80275488 GTTTATAAGGAGATCATGGAAGG - Intergenic
1130689872 15:86072916-86072938 GTTTCTAAGCGGATCATGGAGGG - Intergenic
1130741586 15:86606285-86606307 GTTTCTAAGGAGATTGTGGAAGG - Intronic
1133849865 16:9492637-9492659 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1134347845 16:13407742-13407764 AGATTTAAAGGGACCGTGGAGGG + Intergenic
1134365226 16:13570936-13570958 ATTTTTAAGGGGATCATGAAGGG + Intergenic
1135164493 16:20126656-20126678 ATTTTTTAGGAGATCATGGAAGG + Intergenic
1136179743 16:28542859-28542881 GCTTTTAAGGGGATTATGGAGGG + Intergenic
1136563575 16:31055986-31056008 GTTTCTAAGGGGACTGTGGAGGG + Intergenic
1137278679 16:46956113-46956135 TTTTTTAAGGGGGTGGTGGTAGG + Exonic
1137507639 16:49068286-49068308 GTTTTTAAGGGGATGGTGGAGGG + Intergenic
1138416598 16:56875168-56875190 AGCTTTAAGGGGCTCTTGGATGG + Intronic
1138594072 16:58020132-58020154 TGTTTTAAGGCAATCGTGGATGG + Exonic
1139975201 16:70804434-70804456 GTTTTTAAGGGGATCCTGGAGGG + Intergenic
1140898425 16:79346588-79346610 ATTTTGAAGGTGATGATGGATGG + Intergenic
1141184470 16:81777545-81777567 TTTTTTAAAGAGATCTTGGAAGG - Intronic
1142018839 16:87767184-87767206 ATTTTAAATGGGAAGGTGGAAGG - Intergenic
1142564710 17:832495-832517 ATTTTTAAGGAAATGGTGGTGGG + Intronic
1143267538 17:5651428-5651450 GCTTTTAAGGGGATCATGGAGGG - Intergenic
1144449364 17:15363148-15363170 ATTTTTAATTGGATGGTGGTAGG + Intergenic
1146111755 17:30096034-30096056 ATTTTTAAGGGGCTCTTGCCAGG - Intronic
1148188044 17:45658676-45658698 ATTTTTAAGGGGATAATTTAGGG + Intergenic
1148220774 17:45860261-45860283 GTCTCTAAGGGGATTGTGGAGGG + Intergenic
1148333148 17:46824105-46824127 ATTTTGAAGTGGGTCTTGGAAGG - Intronic
1148972311 17:51494502-51494524 GCTTTTAAGGGGATTATGGAAGG + Intergenic
1151520656 17:74627019-74627041 ACTTTTAAGGGGATTGTAGAGGG + Intergenic
1152502569 17:80722430-80722452 GTTTTTAAGGGGAGGGTGGAAGG + Intronic
1155603886 18:27581611-27581633 GCTTTTAAGGAGATCATGGAGGG - Intergenic
1155851056 18:30774566-30774588 GTTTTTGAGGGGATCATGGAGGG - Intergenic
1157115560 18:44859434-44859456 ATTCCCAAGGGGATCATGGATGG + Intronic
1157324924 18:46662128-46662150 GCTTTTAAGGGGACCATGGAGGG - Intergenic
1157733506 18:50025401-50025423 GTTTTTAAGGGGATCACAGAGGG - Intronic
1158630150 18:59106223-59106245 ATTTTTAAGAAGTTCCTGGAAGG + Intergenic
1158705007 18:59784424-59784446 GTTTTAAAGGGGAAAGTGGATGG + Intergenic
1158872632 18:61703147-61703169 GTTTTTAAGGGGATTCTGGAGGG - Intergenic
1159190062 18:65029711-65029733 ATTTTGAAGCAGATCATGGAGGG - Intergenic
1159263885 18:66053687-66053709 ATTTTTAAGGGGTTGGTGGAAGG + Intergenic
1162244268 19:9386315-9386337 GTTTTAAAGGGGATCAGGGAGGG + Intergenic
1162883782 19:13681000-13681022 GGTTTTAAGAGGATCATGGAGGG + Intergenic
1163045323 19:14637290-14637312 ACTTTTAAAGGGATCATGGAGGG - Intronic
1165302079 19:34976672-34976694 GATTTTAAGGGGATCATGGAAGG - Intergenic
1166331671 19:42081345-42081367 ATGCTTAAGGGGATGCTGGAGGG - Exonic
1167580882 19:50341837-50341859 ATTTTTAAGTAGATCTGGGATGG + Intronic
925948309 2:8887260-8887282 TTTTTTGAGGGGGTGGTGGAGGG - Intronic
928089076 2:28363242-28363264 ATCTTTCAGGCGAGCGTGGAAGG - Intergenic
929419994 2:41780838-41780860 GTTTTTAAGGGGATCATGGAGGG - Intergenic
929848190 2:45555073-45555095 ATTTTTAAGGGGATCGTGGAGGG - Intronic
930117313 2:47729610-47729632 GTTTTTAAGGGGATCATGGAGGG + Intronic
930350252 2:50243719-50243741 ATTTTTAAGGGGATCAGAGGAGG + Intronic
930660158 2:54045246-54045268 GTTTTTAAGGGGATCGTGGAGGG - Intronic
930833521 2:55770834-55770856 TTTTTTAAGGGGATCCCAGAAGG + Intergenic
932360205 2:71098671-71098693 ATTTGTAAGTGGATAATGGAGGG + Intergenic
932841297 2:75085283-75085305 GTTTTTTAGGAGATCATGGAGGG - Intronic
933644113 2:84796149-84796171 ATCTTTGAGGGGGTGGTGGAAGG + Intronic
934479252 2:94619706-94619728 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
934520750 2:95018779-95018801 TTTTTTAAGGGGTTTGGGGAAGG + Intergenic
934911003 2:98254362-98254384 ACATTTAAGGGGATTGTGAATGG + Intronic
935142845 2:100369149-100369171 ATTTTTAAGGGGATTATGAAGGG + Intergenic
935516997 2:104052330-104052352 ATTATCAAGGGGATGGTGGCAGG - Intergenic
937816491 2:126256511-126256533 GCTTTTAAGGGGATCATGGAGGG - Intergenic
938208332 2:129442670-129442692 GTTTCTATGGGGATCATGGAGGG - Intergenic
938251054 2:129816027-129816049 GTTTTTAAGGGGAATATGGAGGG + Intergenic
939476169 2:142689902-142689924 ATTTTTAATGGGATAATAGATGG - Intergenic
939496630 2:142934238-142934260 CTTTTTAAGGGCAATGTGGATGG + Intronic
940031185 2:149263335-149263357 ATTTTTAGGGGGACCAGGGATGG - Intergenic
940158176 2:150681404-150681426 GTTTTTAAGAGGATCATGGAGGG + Intergenic
941614700 2:167706046-167706068 CTTTTTAAGGGGGTCGGGGGAGG + Intergenic
942326738 2:174782354-174782376 ACTTCTAAGGAGATGGTGGAAGG - Intergenic
942738110 2:179139808-179139830 GTTTTTAAGGGGATCATGTAGGG - Intronic
944074307 2:195710817-195710839 ATTTTGAAGGGGCTTGTGGAAGG + Intronic
944755649 2:202759363-202759385 TTTTTTGTGGGGATGGTGGAAGG - Intronic
944966903 2:204945250-204945272 GTTCCTAAGGGGATCATGGAGGG + Intronic
945160695 2:206887388-206887410 TTTTTTCAGGGGCTCATGGATGG - Intergenic
945374278 2:209061125-209061147 GATTTTAAGGGGATGGTGCAGGG + Intergenic
945891640 2:215436349-215436371 ACTTTTTAGGGGATGGGGGAAGG + Intergenic
947238739 2:227971431-227971453 ATTTTTCAGTGGATCGCAGAGGG - Intergenic
947308851 2:228778282-228778304 GTTTTTAAGGGGATCATGGAAGG - Intergenic
947920462 2:233866915-233866937 CTTTGTAAGGAGATGGTGGATGG - Intergenic
947965150 2:234274075-234274097 ATTTTTAAGGGCAACTTGGTGGG - Intergenic
948157795 2:235798479-235798501 TTTTTTAAGGACATGGTGGAAGG + Intronic
949013039 2:241692761-241692783 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1170066081 20:12312015-12312037 TTTTTTCAGGGAATCTTGGAAGG - Intergenic
1170496449 20:16929757-16929779 ATTGTGAAGGGGATTGTGAAGGG + Intergenic
1171166195 20:22974093-22974115 GTTTTTAAGAGGACTGTGGAGGG - Intergenic
1171354061 20:24530103-24530125 ATTTTTAAGGATAATGTGGAGGG - Intronic
1172653562 20:36522807-36522829 ATTTCTAAGGGGGTTGGGGATGG + Intronic
1173972615 20:47164329-47164351 ATTTGTAAGGGGATTGTTGGGGG - Intronic
1173975280 20:47182313-47182335 ATTTTTAAGCGTATAGTGCATGG - Intronic
1175665703 20:60857999-60858021 AGTTTTCAGGGAATCATGGAGGG - Intergenic
1176678172 21:9800780-9800802 ATTTGTGTGGGGATGGTGGAAGG + Intergenic
1178307282 21:31501256-31501278 ATTGGTAAGGGGCTCCTGGAGGG - Intronic
1178730371 21:35096733-35096755 ATCCTTAAGTGGATCGTAGAAGG - Intronic
1179125506 21:38587297-38587319 ATGTTCAAGGGGATGGGGGAGGG + Intronic
1181791378 22:25269572-25269594 TTTTTTACGGGGATCATGGAGGG + Intergenic
1181827072 22:25525683-25525705 TTTTTTAAGGGGATCATGGAGGG + Intergenic
1183283510 22:36947561-36947583 GTTTTTAAGGGGATTATAGAGGG - Intergenic
1183642029 22:39098589-39098611 ATTTTTAATGGGTTAGAGGATGG + Intronic
949606211 3:5657093-5657115 TTTTTAAAGGGGATCATGGAGGG + Intergenic
949991587 3:9583625-9583647 GCTTTTAAGGGGATCGTGGAAGG + Intergenic
952594934 3:35005789-35005811 ACTTTTAAGGGGATTGTGGAGGG + Intergenic
952693133 3:36233598-36233620 GCTTTTAAGGGGATGATGGAGGG - Intergenic
954820840 3:53326179-53326201 AATGTTAATGGGATTGTGGAAGG - Intronic
956108541 3:65847307-65847329 ATTGTTAAGGGTATCCTGGATGG + Intronic
956602873 3:71041385-71041407 ATTATTAAGGAGGTCTTGGAAGG + Exonic
957008726 3:74981124-74981146 ATTTTCATGGGGATCTGGGAAGG + Intergenic
957270762 3:78027434-78027456 ATTTTTATGGTGATCCAGGAAGG - Intergenic
957806894 3:85159369-85159391 GATTTTAAGGGAATTGTGGAAGG + Intronic
957962651 3:87278791-87278813 ATTTTTGAGGTGAACATGGATGG - Intergenic
958019100 3:87977081-87977103 ATATGTAAGGGGATGGTGGGAGG - Intergenic
958514991 3:95102768-95102790 ATTTTTAAGGTGCTTGTTGAGGG + Intergenic
958529774 3:95311792-95311814 ATTTTTCAGGTTATAGTGGAGGG - Intergenic
958622813 3:96583504-96583526 ATTTTTAAGGGCATCATTAATGG + Intergenic
961202292 3:125055131-125055153 ATTTTTAAGGGGTTCTAGGACGG - Intronic
962064063 3:131960814-131960836 GGTTTTAAGGGGATTATGGAGGG - Intronic
962095490 3:132288312-132288334 GTTTTTAAGGGGATCATGGAGGG + Intergenic
963946288 3:151149157-151149179 AGTTTTACGGGGATGGAGGATGG + Intronic
964649249 3:158992400-158992422 AGTTATAAGGGGATAGTGGGGGG - Intronic
967335458 3:188339095-188339117 ATTTTTGAGGGGAGAGAGGATGG + Intronic
968939173 4:3629156-3629178 GTTTTTAAGGGGATCATGGAAGG - Intergenic
972844745 4:42974178-42974200 GTTTTTAAGTGGATCATGGAGGG + Intronic
974480538 4:62437581-62437603 GTTTTTAAGGGGATTATGGAGGG + Intergenic
974595385 4:64008106-64008128 GTTTGTAAAGGGATCCTGGAAGG - Intergenic
975021581 4:69497334-69497356 GTTTTTAAGGGGTTAATGGAGGG - Intronic
975650916 4:76592056-76592078 ATTTTTTAGGGGGTGGTGGAAGG + Intronic
976008439 4:80458727-80458749 ATTTTTGGGGAGATCCTGGAGGG - Intronic
976665805 4:87589807-87589829 ATTTTTAAAGAGATTGTGGAAGG - Intergenic
977059483 4:92239545-92239567 GTTTATAAGGGGATCATGGAAGG - Intergenic
977404858 4:96584191-96584213 ATTTTTAATAGGATCTTGGGAGG + Intergenic
978579176 4:110215640-110215662 GTTTTTAAGGGGATCGTAGAGGG + Intergenic
979006690 4:115307830-115307852 ATTTTTAAGGTGATGGAGGATGG - Intergenic
980535798 4:134120490-134120512 ATAAATAAGGGGATCTTGGAAGG - Intergenic
981650925 4:147057895-147057917 ATTTTTAAAAGGATCTTGGTTGG - Intergenic
982539198 4:156646058-156646080 ATCCTTAAGGGGATTCTGGAAGG - Intergenic
982642826 4:157984435-157984457 ATTTTTAAGTGAATCATGGCTGG + Intergenic
983249179 4:165325880-165325902 GCTTTTAAGGGGATCCTGGAGGG + Intergenic
983451564 4:167918212-167918234 GTTTTTAAGGGGATCATGGAGGG + Intergenic
983844932 4:172506332-172506354 GTTTTTATGAGGATCATGGAGGG - Intronic
984893036 4:184510358-184510380 GCTTTTAAGGGGATCATGAAGGG + Intergenic
986524663 5:8660947-8660969 ATTTTGTAGGGGTTGGTGGAAGG - Intergenic
986920712 5:12676076-12676098 GATTTTGAGGGGATCGTGGAGGG + Intergenic
987049089 5:14134766-14134788 ATGCTTATGGGGCTCGTGGAGGG - Intergenic
987170027 5:15245420-15245442 ATTTTTAATGGAATTTTGGAAGG + Intergenic
989304014 5:39930538-39930560 ATTTTTAAGGAGATCCTTGAAGG - Intergenic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
989700002 5:44252627-44252649 GTTTTTAAGGGGATCATTGAGGG + Intergenic
989809460 5:45656032-45656054 ATTTTTGAGGGGCTCCTTGAAGG - Intronic
991092701 5:62708391-62708413 GTTTTTAAGGGAATTGTGAAGGG + Intergenic
994798480 5:104338318-104338340 ATTTTTCAGGGGATTGTGTTAGG - Intergenic
994937549 5:106273985-106274007 GTCTTTAAGGGTATCATGGAGGG + Intergenic
994995687 5:107059578-107059600 ATTTTTAAAGGGACCTTGTAAGG - Intergenic
996276185 5:121668725-121668747 GTTTTTAAGGGGATCGTGGAGGG + Intergenic
997045475 5:130311762-130311784 ATTTTTAAGGTATTGGTGGATGG - Intergenic
999859267 5:155627956-155627978 ATTTTTAAGGGGAAATTGGAGGG + Intergenic
1002304618 5:178275869-178275891 GTGTTTAAGGGGATCATGGAGGG - Intronic
1004305023 6:14492804-14492826 GCTTTTAAGGGGACTGTGGAAGG - Intergenic
1005433942 6:25787841-25787863 ATTTTTAAGGGAGTCTTGGAGGG - Intronic
1006493721 6:34406164-34406186 ATTTTTAAGGGGACGATGGCGGG - Intronic
1006605767 6:35256746-35256768 ATTTTTAAGTGGATGATGGTAGG + Intergenic
1011870971 6:91892221-91892243 ATGTTTAAGGGGATTGTGGAGGG - Intergenic
1014499845 6:122172813-122172835 ATTTTTGATGGTATTGTGGATGG - Intergenic
1016276160 6:142355406-142355428 ATTCTAAATGGGATCATGGAAGG + Intronic
1017358695 6:153541317-153541339 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1017358936 6:153543202-153543224 GGTTTTAAGGGGATCATGGAGGG - Intergenic
1018220574 6:161574122-161574144 ATATTTAAGAAGACCGTGGACGG + Intronic
1019553194 7:1614167-1614189 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1021224743 7:18013923-18013945 GTTTTTAAGGGAATCATGGAGGG + Intergenic
1021525113 7:21578185-21578207 ATTTTACAGGGGATCATGGAGGG - Intronic
1023969536 7:44980761-44980783 ATTTTTAAGTGGTTAGTGGTGGG - Intergenic
1026286037 7:68963581-68963603 TTTTATAAGGGGATCCTGGAGGG + Intergenic
1026556092 7:71409854-71409876 GCTTTGAAGGGGATCATGGAAGG + Intronic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1027171837 7:75878355-75878377 ATTTTAAAGGGCATTGTGAAGGG + Intronic
1027194681 7:76021611-76021633 GTTTTTAAGGGGATTGGGGAGGG - Intronic
1029459354 7:100686348-100686370 ATTTGCGAGGGGATCGAGGAGGG - Exonic
1029900544 7:104034763-104034785 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1031173675 7:118322176-118322198 ATCTTTAAGAGGATTGTGGAAGG + Intergenic
1031455268 7:121971428-121971450 ATTTTTATGGGGAGTGTTGAGGG + Intronic
1033180561 7:139173609-139173631 CTTTTTAAGGAGATGGTGGATGG - Intronic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034925740 7:155120062-155120084 GGTTTTAAAGGGATCATGGAGGG - Intergenic
1036560262 8:9895802-9895824 ATTTTCAAGGGGCTGGGGGAAGG + Intergenic
1038525881 8:28272885-28272907 GTTTTTAGGGGGATCATGGAGGG + Intergenic
1038597601 8:28903253-28903275 ATTTGTGAGGGGATCAGGGAGGG + Intronic
1038952420 8:32430231-32430253 ATTCTTAAGGGCATCTTGAAGGG - Intronic
1040936911 8:52791003-52791025 GTTTTTAAGGAAATCATGGAGGG + Intergenic
1040945442 8:52880358-52880380 AATTTTAAGGGGATTGTAGTGGG + Intergenic
1040974052 8:53170332-53170354 ATTTTTAAGGGGGTCATGGATGG - Intergenic
1040985572 8:53290630-53290652 GTTTTTAAGGAGATCATGAAGGG + Intergenic
1041936763 8:63340612-63340634 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1045145664 8:99341088-99341110 CTTTGTAAGGAGATGGTGGATGG - Intronic
1045147872 8:99367964-99367986 ATTTTTAAAGGGATTGGGGAAGG + Intronic
1045797192 8:106060056-106060078 GTTTTTAATGGGATCATGGAGGG - Intergenic
1045892094 8:107169334-107169356 ATTTTGAAGGAGGTAGTGGAAGG + Intergenic
1046470138 8:114661912-114661934 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1048265933 8:132985938-132985960 ATTTTGCAGGGGGTTGTGGAGGG + Intronic
1048700488 8:137083221-137083243 GTTTTTAAGGGAATCTTGGTGGG + Intergenic
1048893825 8:138970878-138970900 GTTTTTAAGGGGACCATGGAGGG + Intergenic
1049053822 8:140219574-140219596 GGTTATAAGGGGGTCGTGGAAGG - Intronic
1049639685 8:143709397-143709419 GTTTTTAAAGGGATTGTGGCGGG - Intronic
1049864109 8:144922504-144922526 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1052240162 9:26261957-26261979 GTTTTTAAGGAGATCATGGAGGG + Intergenic
1052732625 9:32307470-32307492 ATTTTTAAGGGGATTGTGGAGGG - Intergenic
1053455806 9:38232469-38232491 ATTTTGTAGGGGAGCGAGGAAGG - Intergenic
1053678577 9:40463859-40463881 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1053928562 9:43092213-43092235 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054285147 9:63161083-63161105 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
1054291655 9:63299397-63299419 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054389671 9:64603940-64603962 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054506041 9:65912436-65912458 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
1055295336 9:74827538-74827560 ATCTTTGGGGGGATCATGGAAGG + Intronic
1056415253 9:86369141-86369163 GTTTTTAAGGAGATTTTGGAGGG + Intergenic
1056579287 9:87878724-87878746 GTTTTTAAGGAGATTGTGGAGGG - Intergenic
1057287697 9:93773488-93773510 ATTTTAAAGGGGATCATGGAGGG + Intergenic
1057594032 9:96399331-96399353 CTTTTTTGGGGGATGGTGGAGGG + Intronic
1057840106 9:98479482-98479504 ACATTTCAGGGGATCTTGGATGG - Intronic
1058327702 9:103718757-103718779 ATTTTTAAGGGGATCATTGAGGG + Intergenic
1058664310 9:107296256-107296278 ATTTTTAAGGTGGTGGGGGAAGG - Intronic
1061863968 9:133482582-133482604 GCTTTTAAGGGGATCATGGAGGG + Intergenic
1185809149 X:3088895-3088917 TTTTTTAGGGGAATCATGGAGGG + Intronic
1186225632 X:7396134-7396156 GCTTTTAAGGGGATTGTGGAGGG + Intergenic
1186316397 X:8375154-8375176 AGTTTTAAGGGGCTCTTGGAGGG - Intergenic
1186670573 X:11763787-11763809 CTTTGTAAGGAGATGGTGGATGG + Exonic
1188325839 X:28799857-28799879 ATTTTTGCGGGGAGAGTGGATGG + Intronic
1188440822 X:30214292-30214314 ATTTGCAAGGAGATCATGGAGGG + Intergenic
1189032876 X:37467754-37467776 ATTGTTATGGGGATATTGGAAGG + Intronic
1189933674 X:46041741-46041763 GTTTTTAAGAGGATCATGGAGGG + Intergenic
1190980245 X:55451254-55451276 ATTTTAAAGGTGACCGTTGAAGG - Intergenic
1192324308 X:70119204-70119226 GTTTCTAAGGGGATCATGGAGGG + Intergenic
1192587389 X:72329744-72329766 ATTTTTAAGCGAATTGGGGAGGG - Exonic
1193336815 X:80299351-80299373 ATATTTAATGGGATTGGGGATGG - Intergenic
1193667319 X:84337920-84337942 TTTTTTAAGGGGCTGGTGGAGGG - Intronic
1194364790 X:93001897-93001919 ATTTTTAAGGGCATCTTTAATGG - Intergenic
1194429819 X:93788159-93788181 AGTTGCAAGGGGATAGTGGAAGG - Intergenic
1194763646 X:97824005-97824027 TTTTTTAAGGGGATGGGGGAGGG - Intergenic
1195390587 X:104358071-104358093 GTTTTTAAGCGGATTGTGGAGGG + Intergenic
1195527685 X:105910678-105910700 GTTTTTAAGGGGATTGTAGAGGG + Intronic
1196279961 X:113812492-113812514 ATTTTTGAAGGGATCATGGAGGG - Intergenic
1197648251 X:129040217-129040239 AATTTTAAGGGCATCCTTGAAGG + Intergenic
1199029574 X:142980982-142981004 ATCTTTAAAGGGAAAGTGGATGG - Intergenic
1199619102 X:149683400-149683422 GTTTTTAAGAGGATCATGGAGGG + Intergenic
1199699853 X:150366990-150367012 ATTTTTAAGGAGATCTTGTAAGG - Intronic
1200673016 Y:6118155-6118177 ATTTTTAAGGGCATCTTTAATGG - Intergenic
1201595235 Y:15660761-15660783 GCTTTTAAGGGGATCGTGGAAGG + Intergenic