ID: 929849330

View in Genome Browser
Species Human (GRCh38)
Location 2:45569328-45569350
Sequence CACAGGAACGGGAGACCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 275}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929849330_929849338 21 Left 929849330 2:45569328-45569350 CCTGCTGGTCTCCCGTTCCTGTG 0: 1
1: 0
2: 1
3: 20
4: 275
Right 929849338 2:45569372-45569394 ACTCAATGTGAACACCCAATCGG 0: 1
1: 0
2: 2
3: 17
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929849330 Original CRISPR CACAGGAACGGGAGACCAGC AGG (reversed) Intronic
900432280 1:2607963-2607985 CTCAGGACCGGCAGCCCAGCCGG - Intronic
902893259 1:19460621-19460643 CTCAGGAGCTTGAGACCAGCCGG - Intronic
903457430 1:23497423-23497445 CACAGCAAAGGGTGACCAGCAGG - Intergenic
903834855 1:26197204-26197226 CACAAGAAAGGGAGACAGGCGGG - Intronic
904336719 1:29802631-29802653 AACAGGAACGGGAAACCTCCTGG - Intergenic
904977638 1:34470312-34470334 CAGAGCAAAGGGAGACCAGCTGG - Intergenic
907392246 1:54165713-54165735 CACAGGACCGGAAGCCCAGGAGG - Intronic
911038484 1:93573837-93573859 CCCAGGAATTCGAGACCAGCTGG - Intronic
912793916 1:112678702-112678724 CAGAAGAACGGGAGACCAGCAGG + Intronic
912924516 1:113902239-113902261 CCCAGGAATTTGAGACCAGCTGG - Intronic
913159574 1:116132939-116132961 AAGAGGTGCGGGAGACCAGCTGG + Intronic
913209222 1:116569810-116569832 GCCAGGAATCGGAGACCAGCAGG - Intronic
914742182 1:150473813-150473835 CACAGGGAAGGGAGCCGAGCTGG - Intronic
914950536 1:152110001-152110023 GAGAGGAACGGGAGACGAGAAGG - Exonic
916172784 1:162013268-162013290 CACAGGAAGGAGAGGTCAGCTGG + Intronic
918032426 1:180828085-180828107 CCCAGGAATTCGAGACCAGCTGG - Intronic
918713793 1:187764647-187764669 CATAGAAATGGGAGGCCAGCAGG - Intergenic
919957054 1:202428018-202428040 CCCAGGAGCTTGAGACCAGCTGG - Intronic
920209083 1:204315058-204315080 CACAGGAACTGGAAAACAGCTGG - Intronic
921182123 1:212639425-212639447 CACAGGAGTTCGAGACCAGCCGG + Intergenic
922342551 1:224669404-224669426 GACAGAAGCTGGAGACCAGCAGG - Intronic
922465936 1:225845650-225845672 CAGAGGCACGGGAGGCCTGCTGG + Exonic
923274507 1:232384755-232384777 AACAGGAACTGGAGATCAGCAGG - Intergenic
924456860 1:244225688-244225710 CCCAGGAGTTGGAGACCAGCTGG + Intergenic
924812568 1:247416224-247416246 GACAGGACCGGGAGAGCAGTGGG + Intronic
924943626 1:248829980-248830002 GTCAGGAGCTGGAGACCAGCCGG - Intergenic
1063578353 10:7282054-7282076 CTCAGGAGTTGGAGACCAGCTGG - Intronic
1064214879 10:13391877-13391899 CCCAGGAGCTTGAGACCAGCCGG - Intergenic
1064641303 10:17418269-17418291 CTCAGGAGCTTGAGACCAGCCGG - Intronic
1066115355 10:32234059-32234081 TTCAGGAGCTGGAGACCAGCCGG + Intergenic
1068100196 10:52543014-52543036 CACAGGGAAGGAAGATCAGCAGG - Intergenic
1068252561 10:54462740-54462762 GTCAGGAACTTGAGACCAGCCGG - Intronic
1069214406 10:65801612-65801634 CAAAGGAAAGGGAGAGCATCAGG + Intergenic
1069412385 10:68166816-68166838 CCCAGGAATTCGAGACCAGCCGG + Intronic
1070395952 10:76011409-76011431 CAGAGGTACGGGAGACGAGATGG - Intronic
1074415628 10:113264580-113264602 CAGATGAGCGGGAGAGCAGCAGG + Intergenic
1075243273 10:120798152-120798174 GTCAGGAGCTGGAGACCAGCCGG - Intergenic
1075282642 10:121153616-121153638 CAGAGGAACGTGAGATCTGCTGG - Intergenic
1075893042 10:125970600-125970622 GTCAGGAGCTGGAGACCAGCCGG + Intronic
1075953677 10:126504446-126504468 CACAGGAACTGAACACCAGCGGG + Exonic
1075992850 10:126852658-126852680 CTCAGGAAAGGGAGACCAGATGG - Intergenic
1076011872 10:126995426-126995448 GTCAGGAGCTGGAGACCAGCCGG + Intronic
1077352713 11:2100310-2100332 CACAGGACCTGAAGCCCAGCAGG - Intergenic
1078627267 11:12968880-12968902 CACAGAAACGGAACACCTGCAGG + Intergenic
1078766770 11:14305832-14305854 CCCAGGAATTCGAGACCAGCTGG + Intronic
1078844864 11:15111705-15111727 CACAGAAAAGGGAGGCCAGGTGG - Intergenic
1079106302 11:17574504-17574526 CACTGGAACGGCAAAGCAGCAGG - Intronic
1079454016 11:20621876-20621898 CAGAGGCACGGGCGACCAGCAGG + Intronic
1081673370 11:44954255-44954277 CACAGGAACCTGGGAGCAGCAGG + Intergenic
1083397344 11:62400929-62400951 CCCAGGAAAGGGAGGACAGCTGG + Intergenic
1085109368 11:73874102-73874124 CCCAGGAATTTGAGACCAGCAGG + Intronic
1085217619 11:74846052-74846074 CCCAGGAGTGGGAGACCACCAGG + Intronic
1085428755 11:76428092-76428114 CTCAGGCACTTGAGACCAGCCGG + Intergenic
1087955890 11:104287638-104287660 CACAGGGACGGGAGCAAAGCTGG + Intergenic
1088036173 11:105318668-105318690 CACAGCAACGGGATACCAAAAGG - Intergenic
1089558397 11:119329166-119329188 CCCAGGAATGGGTGACCACCAGG - Intergenic
1089774467 11:120826743-120826765 AACAGGCAGGGAAGACCAGCAGG - Intronic
1090361249 11:126174390-126174412 CACAGGACCGGCAGCGCAGCAGG + Intergenic
1091252497 11:134155381-134155403 CCCAGGAAGGGGAGACCTCCAGG + Intronic
1092180968 12:6446578-6446600 CCCAGGAGCTTGAGACCAGCTGG + Intronic
1096319897 12:50602465-50602487 CTCAGGAGTTGGAGACCAGCTGG - Intronic
1097091117 12:56506099-56506121 GACAGGACTTGGAGACCAGCTGG + Intergenic
1098321065 12:69244030-69244052 CCCAGGAGCTGGAGACTAGCTGG - Intronic
1099674919 12:85746465-85746487 CTCAGGAGCTAGAGACCAGCTGG - Intergenic
1100429212 12:94515618-94515640 CCCAGGAGCAGAAGACCAGCAGG + Intergenic
1101180924 12:102217447-102217469 CCCAGGAGTGGGAGACCACCAGG - Intergenic
1101707936 12:107238015-107238037 CCCAGGAAATGGAGTCCAGCTGG + Intergenic
1104898682 12:132176331-132176353 AGCAGGAACAGGGGACCAGCCGG - Intergenic
1106268044 13:28127434-28127456 CCCAGGATTTGGAGACCAGCCGG - Intergenic
1107533827 13:41309397-41309419 CTCAGGAGTTGGAGACCAGCCGG - Intergenic
1107979059 13:45716884-45716906 CCCAGGAATTTGAGACCAGCCGG + Intergenic
1107980753 13:45732200-45732222 CCCAGGAGTGGGAGACCACCAGG - Intergenic
1108922107 13:55688718-55688740 CCCAGGAATTTGAGACCAGCTGG - Intergenic
1109842458 13:67937270-67937292 CTCAGGAGCTGGAGACCAGCTGG + Intergenic
1112423456 13:99274926-99274948 CACAGGAGTTTGAGACCAGCCGG - Intronic
1113549568 13:111182101-111182123 CACAAGAATTGGAGACCAGGAGG + Intronic
1116791522 14:49345013-49345035 CCCAGGAGCTTGAGACCAGCCGG + Intergenic
1119238651 14:73040750-73040772 CCCAGGAGCGGGAAACCACCAGG - Intergenic
1119968325 14:78941802-78941824 AACAGCTATGGGAGACCAGCGGG - Intronic
1121619505 14:95336534-95336556 CATAGGATCCAGAGACCAGCAGG - Intergenic
1122233527 14:100319207-100319229 CCCAGGAGTGGGAGACCACCAGG - Intergenic
1122469539 14:101956774-101956796 ACCAGGAGCTGGAGACCAGCCGG - Intergenic
1122901776 14:104785033-104785055 CACAGCAAAGTGAGCCCAGCAGG + Intronic
1123440766 15:20289518-20289540 TGCAGGAACGGGAGATGAGCAGG - Intergenic
1125613071 15:40985697-40985719 CCCAGGAGCTTGAGACCAGCCGG + Intronic
1126957632 15:53951889-53951911 CAGTGGATCTGGAGACCAGCTGG + Intergenic
1127088892 15:55447565-55447587 GTCAGGAGCTGGAGACCAGCCGG + Intronic
1127400737 15:58583517-58583539 AACAGGAAAGGGAAACTAGCTGG - Intergenic
1129340587 15:74883283-74883305 CTCAGGAATTTGAGACCAGCTGG + Intergenic
1129395406 15:75242266-75242288 CCCAGGAATTTGAGACCAGCTGG + Intergenic
1129597646 15:76977046-76977068 CCCAGGAGCGGGGGACCACCAGG - Intergenic
1131164217 15:90130559-90130581 CCCAGGAGCGGGGGACCAGCAGG + Intergenic
1131803040 15:96091501-96091523 CCCAGGAGTTGGAGACCAGCTGG - Intergenic
1132127019 15:99236596-99236618 CCCAGGAGTTGGAGACCAGCCGG - Intronic
1132147254 15:99436322-99436344 CAAAGGAAAGGGAAACCAGTTGG + Intergenic
1132176546 15:99720408-99720430 CCCAGGAATTCGAGACCAGCCGG + Intronic
1132593579 16:737746-737768 CACAGGAAGAGGAGAGCAGAGGG + Intronic
1132718276 16:1303111-1303133 CCCAGGAATTTGAGACCAGCCGG + Intergenic
1133046329 16:3090301-3090323 CACAGGAAGGAGCGCCCAGCCGG + Exonic
1134172734 16:11981312-11981334 GTCAGGAGCTGGAGACCAGCTGG - Intronic
1134465111 16:14468829-14468851 CCCAGGAATAGGAGACCAGCTGG + Intronic
1136111847 16:28068352-28068374 GCCAGGAATTGGAGACCAGCAGG + Intergenic
1136417535 16:30113047-30113069 CACAGGATCTGGAGAGCTGCTGG - Exonic
1141286297 16:82675650-82675672 AGCAGGAACGTGAGTCCAGCAGG - Intronic
1141469597 16:84229448-84229470 CACAGGGCCAGGAGCCCAGCAGG + Intronic
1142658580 17:1411460-1411482 GTCAGGAATTGGAGACCAGCTGG + Intergenic
1144584065 17:16477468-16477490 GGCAGGAAGGGGAGACCAGGCGG + Intronic
1145321290 17:21768930-21768952 GCCAGGAGCTGGAGACCAGCTGG - Intergenic
1145321418 17:21769472-21769494 CATGGGAACGGGAGCGCAGCCGG + Intergenic
1147951674 17:44111135-44111157 GACAGGAAGGGGAGCTCAGCGGG + Intronic
1148122861 17:45222665-45222687 CCCGGGAGCGGGAGACCTGCTGG + Intronic
1149809623 17:59655268-59655290 GAAAGAAACGGGAGAACAGCTGG + Intronic
1150528002 17:65944172-65944194 CACAGGGAGGGGAGAGCATCAGG + Intronic
1150735415 17:67732782-67732804 CTCAGGAGTTGGAGACCAGCCGG - Intronic
1151560627 17:74867731-74867753 CACAGGGTCGGGGGTCCAGCAGG + Intronic
1151590630 17:75041862-75041884 CCCAGGAGCGGGGGACCACCAGG + Intronic
1152170023 17:78739723-78739745 CACAGGAGCTGGAGACCAGTTGG + Intronic
1152963427 18:94802-94824 CTCAGGAGCTCGAGACCAGCTGG + Intergenic
1153137307 18:1930597-1930619 CACAGGAGCAGGACACCAGGAGG + Intergenic
1153238993 18:3013783-3013805 CCCAGGAGTTGGAGACCAGCCGG - Intergenic
1155989744 18:32268113-32268135 CACAGGATCTGGGGGCCAGCTGG + Exonic
1156014871 18:32536349-32536371 CCCAGGAATTTGAGACCAGCCGG + Intergenic
1157552615 18:48591960-48591982 GCCAGGAACTTGAGACCAGCTGG - Intronic
1158952331 18:62505803-62505825 GACAGGGACGGGACACCACCAGG - Intergenic
1160336210 18:78042703-78042725 GGCAGGAGCAGGAGACCAGCAGG + Intergenic
1160441372 18:78895332-78895354 CACAGGACCTGGACACCTGCAGG - Intergenic
1161092041 19:2365752-2365774 CACAGGAAGTTGAGACCAGCTGG + Intergenic
1162811063 19:13164518-13164540 CACAGGAAAAGGAAACCGGCTGG - Intergenic
1163134524 19:15300032-15300054 CCCAGGAGCTGGAGACCAACTGG + Intronic
1163288702 19:16364862-16364884 CACAGGGAAGGGAGCCGAGCTGG - Intronic
1164640225 19:29819490-29819512 CCCAGGAGTTGGAGACCAGCCGG - Intronic
1165085767 19:33345889-33345911 CACAGGAGTTTGAGACCAGCCGG + Intergenic
1165810989 19:38611570-38611592 CCCAGGAGTTGGAGACCAGCTGG + Intronic
1166405169 19:42515461-42515483 CTCAGGAATTTGAGACCAGCTGG + Intronic
1166941988 19:46372899-46372921 CTCAGGAGCAGGAGCCCAGCAGG + Intronic
1167018335 19:46856483-46856505 CACATTAACGGGAGAGCCGCTGG - Intergenic
924968544 2:101170-101192 CACAGGGAGGGCAGCCCAGCAGG + Intergenic
926132912 2:10316367-10316389 CACAGGGGCTAGAGACCAGCAGG - Intronic
927551577 2:24005528-24005550 CACTGGAACGGGGGACTACCAGG + Intergenic
928021981 2:27712595-27712617 AACAGAAAAGGGAAACCAGCTGG + Intronic
928772864 2:34722555-34722577 CACAGGAGTTCGAGACCAGCCGG + Intergenic
929816564 2:45237530-45237552 CACAGCCACGGGGGACCACCAGG + Intergenic
929849330 2:45569328-45569350 CACAGGAACGGGAGACCAGCAGG - Intronic
935671765 2:105562137-105562159 AACAGAAAAGGGAAACCAGCTGG + Intergenic
937461553 2:122092604-122092626 TACAGGAACGGAAAACCAGATGG - Intergenic
939003878 2:136764917-136764939 CAGAGGAACGCCAGACCATCCGG + Intergenic
940302245 2:152187267-152187289 CCCAGGAATGCAAGACCAGCTGG - Intergenic
940914362 2:159238357-159238379 CCCAGGAGCTTGAGACCAGCAGG - Intronic
942840946 2:180360061-180360083 CACAGGAAATGGAGAGAAGCAGG + Intergenic
943393389 2:187299759-187299781 CACAGCAAAAGGAGAGCAGCAGG + Intergenic
944710815 2:202333580-202333602 CCCAGGAGCGGGGGACCACCAGG + Intergenic
945251247 2:207768171-207768193 CACACGAACGGGCCCCCAGCGGG + Exonic
946252850 2:218424005-218424027 AAAGGGAAAGGGAGACCAGCCGG - Intronic
946334734 2:219029266-219029288 CCCAGGAGTGGGAGACCACCAGG + Intronic
947307629 2:228764866-228764888 CCCAGGAAAGGGAGAGGAGCTGG + Intergenic
947397252 2:229698301-229698323 TGCAGGAAATGGAGACCAGCAGG - Intronic
948884882 2:240877532-240877554 CACAGGGCCTGGAGAACAGCTGG + Exonic
948963703 2:241359582-241359604 CAGGGGAACAGGAGACCAGGTGG - Intronic
1171045391 20:21805655-21805677 AACAGAAATGGGAGACCAACTGG - Intergenic
1176185206 20:63774639-63774661 CACATGAGCGCGAGACCAGAAGG + Intronic
1176251097 20:64120415-64120437 CAAAGAATTGGGAGACCAGCAGG + Intergenic
1176725794 21:10431530-10431552 CTCAGGAATTTGAGACCAGCTGG - Intergenic
1177182130 21:17755921-17755943 CCCAGGAGTTGGAGACCAGCTGG - Intergenic
1177591248 21:23170771-23170793 CTCAGGAGTTGGAGACCAGCCGG - Intergenic
1177689460 21:24486173-24486195 GCCAGGAGTGGGAGACCAGCCGG + Intergenic
1177920719 21:27148913-27148935 GAGAGGAGGGGGAGACCAGCAGG + Intergenic
1178684375 21:34699833-34699855 CACAGGAACAGAAGACCCACTGG - Intronic
1179492096 21:41747258-41747280 CACCGGCAGGGGAGGCCAGCTGG - Intronic
1180261717 21:46674816-46674838 CACAGGGAGGGCAGCCCAGCAGG - Intergenic
1180824232 22:18851899-18851921 CATAGCAAAGGAAGACCAGCCGG + Intronic
1180859408 22:19068713-19068735 CACAGCCATGGGGGACCAGCAGG - Intronic
1181122298 22:20679481-20679503 CTCAGGAGTTGGAGACCAGCTGG - Intergenic
1181122869 22:20683891-20683913 CTCAGGAGTTGGAGACCAGCTGG - Intergenic
1181124660 22:20695053-20695075 CATAGCAAAGGAAGACCAGCCGG + Intergenic
1181180127 22:21061584-21061606 CTCAGGAGTTGGAGACCAGCTGG + Intronic
1181188504 22:21122649-21122671 CATAGCAAAGGAAGACCAGCCGG - Intergenic
1181210696 22:21287844-21287866 CATAGCAAAGGAAGACCAGCCGG + Intergenic
1181398814 22:22639044-22639066 CATAGCAAAGGAAGACCAGCCGG - Intergenic
1181501545 22:23318400-23318422 CATAGCAAAGGAAGACCAGCCGG - Intergenic
1181650608 22:24257015-24257037 CATAGCAAAGGAAGACCAGCCGG + Intergenic
1181706773 22:24653723-24653745 CATAGCAAAGGAAGACCAGCCGG - Intergenic
1183512892 22:38246142-38246164 CACAGGGACGGGAGGGCAGGTGG + Intronic
1185045248 22:48525410-48525432 CACTGGAATCGGAGTCCAGCAGG - Intronic
1203216251 22_KI270731v1_random:7586-7608 CATAGCAAAGGAAGACCAGCCGG - Intergenic
1203274369 22_KI270734v1_random:77803-77825 CATAGCAAAGGAAGACCAGCCGG + Intergenic
949195041 3:1295040-1295062 CTCAGGAGTTGGAGACCAGCTGG + Intronic
949340267 3:3022012-3022034 CTCAGGAGCTCGAGACCAGCCGG + Intronic
950224988 3:11226120-11226142 CACAGTAAGGTGAGACCAGGTGG + Intronic
950508914 3:13414070-13414092 CACAGGAACAGGAGGCAGGCAGG + Intronic
950954999 3:17043278-17043300 CAGAGTCACGGGTGACCAGCAGG - Intronic
951656073 3:25009851-25009873 CAGTGGAAGGGGAGACAAGCAGG + Intergenic
954249710 3:49358320-49358342 CACTGTAAGGGGAGGCCAGCAGG + Exonic
954592222 3:51792683-51792705 CACAGCAGCGGGTGAGCAGCAGG - Intergenic
954955061 3:54511612-54511634 CAAAGGAATGGGAGTCCAGATGG + Intronic
955300059 3:57769532-57769554 CCCAGGAATTTGAGACCAGCCGG - Intronic
955370508 3:58347181-58347203 CCCAGGAATTCGAGACCAGCCGG - Intronic
959948853 3:112155669-112155691 CTCAGGAATGGGAGGCCACCAGG + Intronic
960708586 3:120505277-120505299 GACAGGAATTCGAGACCAGCTGG - Intergenic
960718272 3:120599179-120599201 CACAGGAATGGGAGAAGAGAAGG + Intronic
960971105 3:123140877-123140899 CACAGGCATGGGAAGCCAGCTGG - Intronic
962454490 3:135552728-135552750 CAGAGCAATGGGAGACAAGCAGG + Intergenic
963432248 3:145223234-145223256 CCCAAGAACGGTGGACCAGCTGG + Intergenic
965746183 3:171928682-171928704 CACAGGAGTTTGAGACCAGCCGG + Intronic
968094743 3:195920966-195920988 CTCAGGATGGGGAGACCACCAGG - Intergenic
968153374 3:196357560-196357582 CACAGGAGTTGGAGACCAGCTGG + Intronic
968560621 4:1279410-1279432 GGCAGGAACTGGAGACCTGCTGG - Intergenic
968646573 4:1744129-1744151 GACAGGCAGGGGAGGCCAGCAGG - Intronic
971354165 4:25879461-25879483 CTCGGGACTGGGAGACCAGCCGG + Intronic
971421880 4:26481359-26481381 GCCAGGGACGGGAGTCCAGCAGG - Intergenic
971995024 4:33954730-33954752 AACAAGCACAGGAGACCAGCAGG - Intergenic
972346265 4:38195027-38195049 CACAGGACTGGAAGAGCAGCAGG + Intergenic
978584093 4:110259442-110259464 GCCAAGAACTGGAGACCAGCTGG - Intergenic
979350757 4:119642104-119642126 CACAGGAGCTGGGGACCAACTGG - Intergenic
979523855 4:121697161-121697183 CCCAGGCCCGCGAGACCAGCGGG - Intergenic
983078134 4:163350779-163350801 CACTGGAAGGGGAGAACAGATGG - Exonic
984439643 4:179750229-179750251 CACAGAAACTCAAGACCAGCCGG - Intergenic
985336155 4:188897243-188897265 CACAGGAGTTTGAGACCAGCCGG - Intergenic
986133858 5:4956197-4956219 CAAAGGAAAGGGAGGTCAGCCGG + Intergenic
986297781 5:6454090-6454112 CCCAGGAATTTGAGACCAGCTGG - Intronic
986712799 5:10499948-10499970 CTCAGGAGTTGGAGACCAGCTGG + Intergenic
988436063 5:31177006-31177028 CACAGCCATGGGATACCAGCAGG - Intergenic
988458969 5:31415350-31415372 CACAGGAAATGGAGACCATCTGG - Intronic
989158498 5:38367552-38367574 CACAGGAACAGAAGAACATCTGG - Intronic
989408271 5:41086732-41086754 CACAGGAAAGAGAAACCAGAAGG - Intergenic
991019141 5:61961940-61961962 CACAGGCACACGAGGCCAGCAGG - Intergenic
991928407 5:71727868-71727890 CACAGAAACTGGAAACCAGCGGG - Intergenic
993640704 5:90402060-90402082 CACAGGAGTTTGAGACCAGCTGG - Intronic
996351958 5:122553829-122553851 AACAGGTATGGGAGAACAGCTGG - Intergenic
997348034 5:133207859-133207881 CTCAGGAGTCGGAGACCAGCAGG - Intronic
997432291 5:133848757-133848779 CACAGTCAGGGGAGAACAGCCGG + Intergenic
998104466 5:139459663-139459685 CAGAGGGACGGGAACCCAGCTGG - Intronic
1002777954 6:344498-344520 CTCAGGAATTTGAGACCAGCCGG - Intronic
1002908562 6:1470770-1470792 CACAGGAATGAGAGTCCAGCAGG + Intergenic
1003059347 6:2850696-2850718 CACAGGAATTTGAGACCAGCTGG - Intergenic
1004365000 6:15005131-15005153 CGCAGGAATTCGAGACCAGCTGG - Intergenic
1005709311 6:28488332-28488354 GGCAGGAATTGGAGACCAGCCGG + Intergenic
1006046158 6:31300455-31300477 CACAGCAAAGGGAAACCATCTGG + Intronic
1006675655 6:35761037-35761059 CTCAGGAGCTTGAGACCAGCTGG - Intergenic
1007298147 6:40844399-40844421 CACAGGAAATGGAGAACAGCAGG + Intergenic
1008691679 6:53986329-53986351 CACAGGAGAAGGAGGCCAGCAGG + Intronic
1013201220 6:107898052-107898074 CTCAGGAATTCGAGACCAGCAGG + Intronic
1015174392 6:130290904-130290926 CAGAGGAAAGGGAAAACAGCAGG - Intronic
1015775025 6:136805087-136805109 CCCAGGAGTTGGAGACCAGCCGG - Intergenic
1016442098 6:144095032-144095054 AACAGCACTGGGAGACCAGCAGG - Exonic
1017063362 6:150507177-150507199 GTCAGGAGCTGGAGACCAGCTGG - Intergenic
1018488901 6:164271775-164271797 CACAGGTCCGGGAGGCCAGGAGG + Intergenic
1020187017 7:5966971-5966993 CCCAGCAATGGGACACCAGCTGG + Exonic
1020295900 7:6757801-6757823 CCCAGCAATGGGACACCAGCTGG - Exonic
1020615182 7:10451249-10451271 CACAGGAACCCGAGAGCTGCAGG - Intergenic
1026135864 7:67660188-67660210 CACCAGAACTGGAGGCCAGCAGG + Intergenic
1026923081 7:74170648-74170670 CCCAGCAAATGGAGACCAGCCGG - Intergenic
1026982573 7:74535509-74535531 CAGAGGAACGGAAGCCCAGCTGG + Intronic
1031450133 7:121905871-121905893 CCCAGGAAAGGGATACCAACAGG - Intronic
1031613125 7:123850380-123850402 CACAGGAACGCACCACCAGCCGG + Intronic
1034506849 7:151499154-151499176 CTCAGGAGCTTGAGACCAGCTGG + Intronic
1034612073 7:152380020-152380042 CTCAGGAATTCGAGACCAGCTGG + Intronic
1034894340 7:154866216-154866238 TACAGGAAAGGAAGACTAGCAGG - Intronic
1034947852 7:155275312-155275334 CACAGGAATGGGAGACAGACAGG - Intergenic
1035355622 7:158274507-158274529 CACAGGCACGGGGGAGCCGCAGG + Intronic
1035445607 7:158940389-158940411 CACAGCAACAGGTGAGCAGCAGG - Intronic
1036477800 8:9109563-9109585 CCCAGGAAGGGGAGAACAGAGGG - Intronic
1036705045 8:11040309-11040331 CCCAGGAATTTGAGACCAGCCGG + Intronic
1036727051 8:11229848-11229870 CACAGGGCTGGGAGCCCAGCAGG + Intergenic
1040917167 8:52574337-52574359 GTCAGGAGCTGGAGACCAGCCGG + Intergenic
1040945529 8:52881158-52881180 CAAAGGCACTGGAGGCCAGCTGG - Intergenic
1043477726 8:80621667-80621689 CTCAGGAATTCGAGACCAGCTGG - Intergenic
1044559947 8:93603123-93603145 CACAGGAAGGGGACATCAGAGGG + Intergenic
1044729777 8:95220495-95220517 CACAAGGACGGGAGACCATGAGG - Intergenic
1047208203 8:122820159-122820181 GACAGGGACTGGAGAGCAGCCGG - Intronic
1047978002 8:130150666-130150688 CTCAGGAGCTTGAGACCAGCTGG + Intronic
1048069133 8:131003565-131003587 CACAGGATCTGGAAAACAGCTGG - Intronic
1049280402 8:141741270-141741292 CACAGGGAGGGCAGCCCAGCCGG - Intergenic
1049748638 8:144273439-144273461 CACAGGAAAGGGACAGCAGAGGG + Intronic
1052252830 9:26419971-26419993 TACAGGATCTGGAGACCAGCTGG + Intergenic
1052967945 9:34355616-34355638 CCCAGGAATTTGAGACCAGCTGG - Intergenic
1055681937 9:78724522-78724544 CACAGCATTGTGAGACCAGCTGG + Intergenic
1056198932 9:84255883-84255905 CACAGCAACGAAACACCAGCAGG - Intergenic
1057813563 9:98277120-98277142 CCCAGGAATTGGAGACTAGCTGG + Intergenic
1058548845 9:106091666-106091688 CACAGGAAAGGAAGTCCAACAGG - Intergenic
1059284314 9:113159765-113159787 CAGAAGTACGGGAGACAAGCTGG - Intronic
1060610205 9:124957201-124957223 CCCAGGAGTTGGAGACCAGCTGG - Intronic
1061792278 9:133064966-133064988 CACAGGGACAGGGGACCGGCTGG + Intronic
1062359488 9:136180811-136180833 CAGAGGTACGGGAGCCCAGAGGG + Intergenic
1062410419 9:136421353-136421375 AACCTGAAGGGGAGACCAGCAGG + Intronic
1062619078 9:137411438-137411460 CACAGGAAGGCGGGACCGGCGGG + Intronic
1185610611 X:1392024-1392046 CAGCGGAACGGGAGGACAGCCGG + Exonic
1186042659 X:5498603-5498625 CCCAAGAACTGGAGCCCAGCTGG - Intergenic
1186105616 X:6202546-6202568 CTCAGGAGTTGGAGACCAGCCGG - Intronic
1186312892 X:8339551-8339573 CCCAGGAGCTGGAGACCATCTGG + Intergenic
1187145905 X:16637144-16637166 CCCAGGAGTCGGAGACCAGCTGG - Intronic
1187348538 X:18489838-18489860 TCCAGGAATTGGAGACCAGCTGG + Intronic
1192306858 X:69969892-69969914 GCCAGGAACTTGAGACCAGCCGG + Intronic
1195091504 X:101463966-101463988 CTCAGGAGTTGGAGACCAGCCGG - Intronic
1197743115 X:129911003-129911025 CACAGGATCAGGAGAAAAGCTGG + Exonic
1199447325 X:147940471-147940493 CACAGGATCTGGTGAACAGCAGG - Intronic
1199870589 X:151894886-151894908 GACATGATCGGGAGACCAGGCGG - Intergenic
1201526877 Y:14946193-14946215 CCCAAGAACTGGAGCCCAGCTGG - Intergenic