ID: 929851863

View in Genome Browser
Species Human (GRCh38)
Location 2:45598773-45598795
Sequence AATCACATGGGACAGATAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 131}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929851857_929851863 25 Left 929851857 2:45598725-45598747 CCTCAGCTCTACAGCCACAATCA 0: 1
1: 0
2: 1
3: 33
4: 257
Right 929851863 2:45598773-45598795 AATCACATGGGACAGATAACAGG 0: 1
1: 0
2: 3
3: 14
4: 131
929851860_929851863 11 Left 929851860 2:45598739-45598761 CCACAATCATAGCAAGGGAAAGA 0: 1
1: 0
2: 0
3: 29
4: 254
Right 929851863 2:45598773-45598795 AATCACATGGGACAGATAACAGG 0: 1
1: 0
2: 3
3: 14
4: 131
929851856_929851863 26 Left 929851856 2:45598724-45598746 CCCTCAGCTCTACAGCCACAATC 0: 1
1: 0
2: 0
3: 17
4: 175
Right 929851863 2:45598773-45598795 AATCACATGGGACAGATAACAGG 0: 1
1: 0
2: 3
3: 14
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929851863 Original CRISPR AATCACATGGGACAGATAAC AGG Intronic
901857508 1:12053746-12053768 TATCTCCTTGGACAGATAACAGG + Intergenic
903028217 1:20444498-20444520 AATCACCTGGGACAGAGATGGGG + Intergenic
903513925 1:23897233-23897255 AATCACATGGGGCAGAAAACAGG + Intronic
903667400 1:25016500-25016522 AAGCACCAGGGTCAGATAACCGG - Intergenic
905644616 1:39616702-39616724 CATCACGTGGCACAGATAAGGGG - Intergenic
907967067 1:59342281-59342303 AATCACTGGGGACAGATTAACGG + Intronic
908695416 1:66835100-66835122 TATAACATGGGACATGTAACAGG - Intronic
910509886 1:87991859-87991881 AACCACATGGGATAGAAAAGTGG - Intergenic
912734107 1:112134793-112134815 AATCACACAGCACAGGTAACTGG - Intergenic
916288170 1:163133513-163133535 AATCACATGTGCAAGATATCTGG + Intronic
917153427 1:171968746-171968768 AAGCAAATGGGACAGAAGACTGG - Intronic
918288033 1:183077904-183077926 AAACACATGAGAGAGAAAACTGG - Intronic
920714734 1:208329149-208329171 AAGCAAATGTGACAGAGAACAGG - Intergenic
921542550 1:216433959-216433981 GGCCAAATGGGACAGATAACAGG + Intergenic
923443641 1:234047206-234047228 AATCACAAGGGACATAAAAGAGG - Intronic
1062889230 10:1045173-1045195 AATCACATGGGAGGGATAAATGG - Intronic
1066009323 10:31179828-31179850 AATGACCTGGGACTGCTAACAGG + Intergenic
1068463220 10:57353842-57353864 AAGCAGATGGGCCAGAAAACTGG - Intergenic
1069199372 10:65593385-65593407 AATCATATGCAACAGATAACAGG + Intergenic
1071695720 10:87867869-87867891 AATAACATGGGAAAGGCAACTGG + Intronic
1075038570 10:119089450-119089472 ATTAACATGGGAAAGATGACAGG - Intergenic
1076121879 10:127942984-127943006 AATCACGTGGGCCAGGAAACCGG + Intronic
1077439894 11:2563086-2563108 AATCACGTGGGAAAGATCACAGG - Intronic
1077713166 11:4555852-4555874 ATTCATATGGGATAGAAAACAGG + Intergenic
1078000337 11:7489664-7489686 AGTGTCATGGGACAGAGAACAGG + Intronic
1078770361 11:14344490-14344512 AATCACATGGAAAAGATATGTGG - Intronic
1081185004 11:40031301-40031323 AATCATTTTGGACAGAAAACAGG - Intergenic
1083695026 11:64436919-64436941 AACCCCATGGGACAGAGGACAGG - Intergenic
1084700454 11:70783460-70783482 ACTCACATGGCCCAGATACCAGG + Intronic
1086982138 11:93209677-93209699 AATTGCATAAGACAGATAACTGG - Intergenic
1087083363 11:94193442-94193464 AATCACCTGGCACAGATTGCAGG - Intergenic
1087471101 11:98575364-98575386 AATCATGTGGGACAGAAATCAGG + Intergenic
1093353588 12:18134784-18134806 AATACCAAAGGACAGATAACAGG + Intronic
1094047244 12:26180554-26180576 AAGCACAGGGGACAGTTAAGGGG - Intronic
1098390649 12:69966537-69966559 AATCTCCTGGGACAGATGGCTGG - Intergenic
1101811386 12:108110976-108110998 AATCACATGGGAAAGAGAAGTGG + Intergenic
1104546708 12:129719554-129719576 AATCACACGGGACACATTTCTGG + Intronic
1106806733 13:33316210-33316232 AACCACATGTGAGAGATAACAGG - Intronic
1107194125 13:37627175-37627197 AAACACATCCGACAGATGACTGG + Intergenic
1108721419 13:53136695-53136717 AATCACATGGGTGAGCTAAGAGG - Intergenic
1113235819 13:108272232-108272254 AAAAACATGGGACAGACAAGTGG - Intronic
1114799601 14:25758587-25758609 GATTACATGGTACAGAAAACAGG - Intergenic
1115503392 14:34069523-34069545 GATCACATGTGACAGATGAATGG - Intronic
1115875494 14:37857254-37857276 AGCCACTTGGGACAGACAACTGG - Intronic
1118809546 14:69262771-69262793 AATCACATGGAAGAAATAACTGG - Intronic
1119193024 14:72697160-72697182 AATGACATGGTACAAATACCCGG - Intronic
1119538766 14:75425203-75425225 AATTAGATGGGACATAGAACAGG + Intergenic
1126336111 15:47588010-47588032 AAACACAGAGGAAAGATAACTGG + Intronic
1126439844 15:48675657-48675679 AATAACATGTGACTCATAACTGG - Intergenic
1126883047 15:53119772-53119794 ACTCACATGGGACAGATCAGAGG - Intergenic
1128017661 15:64361686-64361708 AATCTCATGGGAGAGATGAGGGG + Intronic
1137566803 16:49538395-49538417 AAGCACATGCGACAGACACCTGG + Intronic
1137737985 16:50739211-50739233 GATGAGATGGGAAAGATAACTGG - Intergenic
1138200877 16:55087489-55087511 AATAACCTGGGAAAGTTAACAGG + Intergenic
1139269971 16:65672666-65672688 AATCACCTGGGACAACTAAAAGG + Intergenic
1149720572 17:58840083-58840105 AAGCACATGGGACAGAGTACAGG + Intronic
1151790809 17:76304682-76304704 GCTCACATGGGACAGATAACTGG - Intronic
1153278239 18:3390172-3390194 CATCACTGGGGACAGAAAACCGG - Intergenic
1153710167 18:7790747-7790769 AATCACCTGGGAAAAATTACTGG + Intronic
1155398034 18:25407062-25407084 AATCTCATGGGAAAAATATCAGG - Intergenic
1156224548 18:35091224-35091246 AATCTCATGTGACAGTTCACAGG + Intronic
1157640437 18:49207368-49207390 AAACACATGGAACAGATACGTGG + Intronic
1157889466 18:51401610-51401632 ATTCACATGGGAAAGAGAAATGG - Intergenic
1161937443 19:7380888-7380910 GATCAGAGGGGACAGATACCTGG - Intronic
1164483677 19:28636567-28636589 AACCACAGGGGACAGACAGCAGG - Intergenic
1166670370 19:44706242-44706264 CATCATCTGGGTCAGATAACTGG - Intronic
925735116 2:6957187-6957209 AAGCACGTGGGACAGAGAAGGGG - Intronic
926790150 2:16562507-16562529 AAACACATGGGTTAGATGACCGG + Intronic
927108182 2:19845344-19845366 AAGCATATTGGACAGCTAACAGG + Intergenic
928855805 2:35801294-35801316 AATCAGCTGGGACTGATAAATGG + Intergenic
929851863 2:45598773-45598795 AATCACATGGGACAGATAACAGG + Intronic
933220031 2:79677727-79677749 AATCACATGGCAAAGATATTTGG - Intronic
933838381 2:86264451-86264473 GGTCACATGGGAGAGATAAAAGG - Intronic
935222519 2:101027605-101027627 AAACACCTGGGAAAGATACCTGG - Intronic
935442738 2:103121423-103121445 AATGACCTGGGAAAGATAAAAGG - Intergenic
936407788 2:112222584-112222606 AATCACAAGGGACAGAAAATAGG + Intronic
936407793 2:112222722-112222744 AATCACAAGAGACAGAAAACAGG + Intronic
943485179 2:188470405-188470427 AATCAAATCGGACACATAAAAGG - Intronic
945391704 2:209273116-209273138 AATCATATAGGACAAATAACAGG - Intergenic
945565919 2:211399168-211399190 ATTCACATGGGGCATATAATGGG - Intronic
947324013 2:228955168-228955190 GACCACATGGAACAGATAAAGGG + Intronic
948246417 2:236489597-236489619 AAGCAGAAGGGACAGATCACTGG + Intronic
1172818557 20:37711112-37711134 GATCAGATGGGCCAGATAATGGG - Intronic
1178825086 21:36008543-36008565 CAATACATGGGACAGATATCTGG - Intergenic
1184379576 22:44136632-44136654 AATCACATGCTACAGAGAAGGGG - Intronic
952255632 3:31693052-31693074 AAACACTCGGGAGAGATAACAGG + Intronic
953167178 3:40475940-40475962 AGTCTCATGTGACAGATAACAGG - Intergenic
954243754 3:49314504-49314526 AATCACATTGGACATCTCACTGG - Intronic
956533769 3:70252563-70252585 AATAAAGTGGGCCAGATAACAGG + Intergenic
957073910 3:75586376-75586398 AAACACAGGGGACAGAGAAAGGG + Intergenic
957676939 3:83379129-83379151 ATTTACATAAGACAGATAACAGG + Intergenic
962943563 3:140147426-140147448 AATCATAGGGGACAGATGCCAGG - Intronic
963039522 3:141058541-141058563 AGGCACATGGGACATACAACAGG - Intronic
964448681 3:156788013-156788035 AACCACATGGAGCAGATAAATGG - Intergenic
965410889 3:168329719-168329741 AATCAGGTTGGACAGAAAACAGG + Intergenic
967608563 3:191477555-191477577 AATCACATGTGAAACCTAACGGG + Intergenic
972796551 4:42426684-42426706 AAGCTCATGGGACAGATCACTGG - Intronic
974046438 4:56902653-56902675 AAAGACATGGGAAAGAAAACAGG + Intergenic
976927950 4:90525239-90525261 AAACACCTGGGAAAGATAAAAGG - Intronic
977347520 4:95836078-95836100 AATAACATGGTACAGTTAAGAGG + Intergenic
978937204 4:114392231-114392253 AATAATATGGGACAGAAAAGTGG + Intergenic
987931470 5:24404558-24404580 AATCAGATGGGCCAAATAAATGG - Intergenic
989708201 5:44363724-44363746 AATGACATAGGACAAATACCAGG - Intronic
989794986 5:45457773-45457795 AATCACATGTGAAAGAGAGCTGG + Intronic
990920291 5:60957265-60957287 AATAAAATAGGAAAGATAACTGG - Intronic
991127068 5:63081366-63081388 GATCACCTGGGACAGAGAATGGG - Intergenic
991632703 5:68672485-68672507 AATCAAATCTGAAAGATAACAGG + Intergenic
993761095 5:91798486-91798508 AATCACAAGAGACAAAGAACGGG - Intergenic
996105155 5:119492600-119492622 AATCACATTGGACAACTTACTGG + Intronic
997805194 5:136910612-136910634 AAGCACATGGGACAGACATCTGG - Intergenic
997880738 5:137587378-137587400 AATTACCTGGGCCAGAAAACTGG - Intronic
999023621 5:148199457-148199479 TAACACATGAAACAGATAACAGG - Intergenic
1004322857 6:14646459-14646481 AATGTCATGATACAGATAACTGG + Intergenic
1008912670 6:56752646-56752668 AATCACAAGGAACAAATCACTGG - Intronic
1014820434 6:125983100-125983122 AATCACAGGGGATAGATTCCAGG + Intergenic
1018106067 6:160487545-160487567 AATCATATGGTACCCATAACGGG - Intergenic
1020446079 7:8269315-8269337 AATGTCATGGGGCAGACAACTGG - Intergenic
1020558316 7:9697289-9697311 AATAATATGGCAAAGATAACTGG + Intergenic
1023170869 7:37389185-37389207 AGTGACAAGGTACAGATAACAGG - Intronic
1025093718 7:56082216-56082238 AATCTCAGGGGCCAGGTAACTGG + Exonic
1028716514 7:93977420-93977442 AAACAGATGGTACAGATTACGGG + Intronic
1030298954 7:107956351-107956373 AATCACCTGAAACAGATGACTGG + Intronic
1031029048 7:116714876-116714898 AATAATAGTGGACAGATAACAGG + Intronic
1032682612 7:134201133-134201155 AATCACATGAGCCACATAAAAGG - Intronic
1032723384 7:134569010-134569032 TATCAGATGGGTCAGATAAAGGG + Intronic
1033172070 7:139093159-139093181 AATCAAAGGTGACAGATAAGAGG + Intronic
1033499015 7:141929022-141929044 AATCACCTGAGACAGGAAACAGG - Exonic
1033500545 7:141944673-141944695 AACCACAATGGACAAATAACTGG - Intronic
1036498590 8:9293444-9293466 ATCCACATGGGACTGAAAACTGG - Intergenic
1037041245 8:14237606-14237628 AATCACATGGGGCAGTTAACCGG - Exonic
1037094896 8:14974367-14974389 AATCACATAGAACATACAACTGG + Intronic
1038592274 8:28850581-28850603 AAACACATGGGAAAGAAGACAGG - Intronic
1041191585 8:55361043-55361065 AGTCACATTGGACATATTACAGG + Intronic
1042907918 8:73792756-73792778 ACTCACATGGTACTGAGAACTGG + Exonic
1042965239 8:74344286-74344308 ATTCACATGGATCAGATTACTGG + Intronic
1043551892 8:81383363-81383385 AATCAAATGGGACTTATACCAGG - Intergenic
1044130500 8:88517742-88517764 AATCACATGGCTCAGAGAAGTGG - Intergenic
1044171441 8:89057395-89057417 AATCACAGGAGTCAGACAACAGG - Intergenic
1046035095 8:108831331-108831353 CATCACCTGGGACAGAGAAAAGG - Intergenic
1046965662 8:120162834-120162856 AATCACATAGGAGAGATGTCTGG - Intronic
1050331024 9:4546325-4546347 TATTACATGGGACAAATAATTGG - Intronic
1050949335 9:11567638-11567660 AACCACATGGCACAGAGAAATGG - Intergenic
1053506057 9:38644377-38644399 AATTCCTTGTGACAGATAACTGG + Intergenic
1056223486 9:84472400-84472422 AATTACTTGGGACACATACCAGG - Intergenic
1058329604 9:103742964-103742986 TCTGACAAGGGACAGATAACAGG - Intergenic
1058370821 9:104265494-104265516 AATCACAAGGAACATAGAACAGG + Intergenic
1058977069 9:110134992-110135014 AATTACATAGGCTAGATAACTGG + Intronic
1185825472 X:3245088-3245110 ACTCACTTTGGACAGATAATGGG + Intergenic
1188485876 X:30681542-30681564 AATAACATTAGACAGATAATGGG + Intronic