ID: 929858763

View in Genome Browser
Species Human (GRCh38)
Location 2:45657525-45657547
Sequence TATAGCCCCCAAAATGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 140}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929858761_929858763 20 Left 929858761 2:45657482-45657504 CCCTAGTAACTGCTCAATGCATA 0: 1
1: 0
2: 4
3: 42
4: 281
Right 929858763 2:45657525-45657547 TATAGCCCCCAAAATGAGCATGG 0: 1
1: 0
2: 0
3: 11
4: 140
929858762_929858763 19 Left 929858762 2:45657483-45657505 CCTAGTAACTGCTCAATGCATAT 0: 1
1: 1
2: 4
3: 30
4: 293
Right 929858763 2:45657525-45657547 TATAGCCCCCAAAATGAGCATGG 0: 1
1: 0
2: 0
3: 11
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929858763 Original CRISPR TATAGCCCCCAAAATGAGCA TGG Intronic
902551996 1:17224704-17224726 TATAGCCCTCAAAATAAAAAAGG - Intronic
903966640 1:27094772-27094794 TACAGACCTCAAAATGACCAGGG - Intergenic
907694697 1:56711741-56711763 TATAACTCCTAAAATGAGAAAGG + Exonic
909910593 1:81253137-81253159 GAAAGCCCCCAAAAAGAGCTTGG - Intergenic
911267898 1:95764537-95764559 TGTACCCCCCAAACTGGGCACGG + Intergenic
917679042 1:177347604-177347626 TATAGCCCGCAAGCTGAGAATGG + Intergenic
917770365 1:178270759-178270781 TAAAGCCCTTAAAATGGGCAAGG - Intronic
918373795 1:183888078-183888100 TTTAGATCCCAAAATGAGCTGGG - Intronic
918583866 1:186163497-186163519 TACAGCTCCCAGAATGAGCAAGG - Intronic
918599988 1:186346677-186346699 TACAGCCTTCAAAATGAACACGG + Intronic
920714146 1:208323737-208323759 TCCTGCCCCTAAAATGAGCAAGG + Intergenic
922600196 1:226845331-226845353 TAGAGCCTCCAACAAGAGCAAGG + Intergenic
922855527 1:228772060-228772082 TATAGCTGCGAAAATTAGCAGGG - Intergenic
1064591510 10:16897321-16897343 TGTAACCCACAAAATGTGCAAGG - Intronic
1066510826 10:36093970-36093992 TATATCCCCCAAAATTATCTTGG + Intergenic
1067195696 10:44116082-44116104 CATAGCCACCAAATTGACCAGGG + Intergenic
1072472703 10:95728122-95728144 TATAGCCCCCACATTGTTCAAGG - Intronic
1073202081 10:101743855-101743877 TATAGCCCACAAATTAAGAATGG - Intergenic
1073286301 10:102391261-102391283 AATTGCCACCAAAATCAGCACGG - Intergenic
1075151664 10:119938302-119938324 TTCAGCCCCCAAAATTTGCAGGG + Intronic
1075505269 10:123015679-123015701 TATAGCCAACAAACTGAGTATGG - Intronic
1075705093 10:124495670-124495692 TTCAGCCCCCAAATTGAACAGGG + Intronic
1076275470 10:129195050-129195072 TATAAGCACCCAAATGAGCATGG + Intergenic
1078767627 11:14314349-14314371 TTTAGGACCCAAAATGATCAAGG - Intronic
1081024110 11:37987189-37987211 TAAAGGCCCTAAAATGAGCATGG - Intergenic
1081272149 11:41097857-41097879 GATAGCCACCAATATGAACAGGG - Intronic
1084719787 11:70897306-70897328 TATAACCCACAAAAGGAGCCAGG + Intronic
1087733666 11:101807469-101807491 TATAGTCCCCAGAATGAACAGGG - Intronic
1089136848 11:116256105-116256127 TACACACCCCAAAATGGGCAAGG + Intergenic
1091107067 11:132932510-132932532 TAGAGCCCACAAAATGGGAAAGG - Intronic
1091367048 11:135031114-135031136 AATAGCCCTAAAAATCAGCATGG + Intergenic
1091664794 12:2411463-2411485 TTTAGCCCACAGAAGGAGCAGGG - Intronic
1091701659 12:2667320-2667342 TATTGCCCCAACAAGGAGCACGG - Intronic
1095557316 12:43523116-43523138 TTTGGTCCCCAAAATGTGCAAGG + Intronic
1097082595 12:56443841-56443863 TATAGCCTGCAACCTGAGCAGGG + Intronic
1097300273 12:58010619-58010641 TACAGCCCACAAGATGAGAATGG - Intergenic
1103320838 12:120092173-120092195 TCTAGCCACCAAAATGGGAAGGG + Intronic
1108075810 13:46678548-46678570 TATACCCTCCAAAATGTGAATGG + Intronic
1108344112 13:49527478-49527500 TATAGAAGCCAAAATGAGAAAGG - Intronic
1119808072 14:77495744-77495766 TATATGCCCCAAAATGACGAGGG + Intronic
1121743621 14:96270793-96270815 TATAGCCTCTAAAATGAGGAAGG + Intergenic
1121831894 14:97059946-97059968 TATAGCCCTCAATCTGAGAATGG - Intergenic
1121963030 14:98278712-98278734 CAGAGGGCCCAAAATGAGCAAGG - Intergenic
1125270768 15:37936284-37936306 CTCAGCCCCCAAAATGAACAAGG - Intronic
1125620761 15:41059501-41059523 TATAGTCCCAAAAATTAGCTGGG + Intronic
1127556891 15:60096309-60096331 TAAAGCCTCCAGAAGGAGCATGG - Intergenic
1127735472 15:61835089-61835111 TGTAACCCCCAAGTTGAGCAGGG - Intergenic
1129936189 15:79451879-79451901 CTTAGCCCCCAAAATATGCATGG + Intronic
1135223857 16:20638504-20638526 AATAGCCACCAAAAATAGCAAGG + Intronic
1136869446 16:33792144-33792166 AACAGCCCCCAACATGGGCAAGG - Intergenic
1140291249 16:73659876-73659898 TAGAGCCACCCAAATGAACATGG + Intergenic
1141402584 16:83763467-83763489 TATAGCCCCCAAACTGAGGGTGG + Intronic
1203102727 16_KI270728v1_random:1323924-1323946 AACAGCCCCCAACATGGGCAAGG + Intergenic
1142947608 17:3445967-3445989 TAGAGCCTCCAAAAGGAACATGG - Intronic
1143407852 17:6689859-6689881 TGTAGACTGCAAAATGAGCATGG - Intronic
1144121773 17:12161768-12161790 TATAACCCACATAGTGAGCACGG + Intergenic
1149165958 17:53752272-53752294 TCTAACCCCCAAAATGTTCAAGG + Intergenic
1149297041 17:55270575-55270597 TACAGCTCCCAGAATGACCAAGG - Intronic
1149380395 17:56087778-56087800 TATAGGCACACAAATGAGCATGG - Intergenic
1151057408 17:71049311-71049333 TGTAGCACCCAAGATCAGCAGGG - Intergenic
1154309265 18:13254801-13254823 AAAAGCCCCCAAAATTAGCTGGG + Intronic
1155718856 18:28985052-28985074 TATATCCTCCAAAATGAAAAGGG - Intergenic
1156029603 18:32696720-32696742 TATAGCACCCAAAATAAGTCAGG - Intronic
1157188952 18:45564601-45564623 AATGCCCCCCAAAATGAGGAAGG + Intronic
1161147741 19:2689297-2689319 TGTAGCCTCCATAATGAGAAGGG - Intronic
1161420385 19:4173325-4173347 CCTCGCCCGCAAAATGAGCAGGG - Intergenic
1166660302 19:44642938-44642960 TATATCCCCGAAATTGAGCTAGG + Intergenic
1167127190 19:47557971-47557993 TATTCCCCCCAAAATGGGCAGGG + Intergenic
924993426 2:336190-336212 TAGAGCCCCCAAAAGAAGCAGGG + Intergenic
927331787 2:21873542-21873564 TATGGCACCAAAAAAGAGCATGG - Intergenic
929858763 2:45657525-45657547 TATAGCCCCCAAAATGAGCATGG + Intronic
930537116 2:52656822-52656844 TTTAGTCCCCAAAGTCAGCATGG - Intergenic
931535916 2:63276261-63276283 TATAGTCCACCAAATGAGAAGGG + Intronic
931700183 2:64903048-64903070 TATAGACCCCAAGCTGACCAGGG - Intergenic
933338936 2:80997171-80997193 CATAGCCCACAAAATAAGCCTGG - Intergenic
933592825 2:84251542-84251564 TAGAGCCCCTAAACTGAGAAGGG + Intergenic
936863829 2:117055187-117055209 CATAGCCCTGAAAATGATCAAGG - Intergenic
938952571 2:136268730-136268752 TCTAGCCCCCAAAATCATAAAGG + Intergenic
943002402 2:182345034-182345056 TTTAGCCCCCAAAACAAGCCAGG - Intronic
947204929 2:227651795-227651817 TAAAACCCCCAAAATTAGCCAGG + Intergenic
1169338529 20:4777226-4777248 TATACCCCCCAAAATTAGCTGGG - Intergenic
1170397617 20:15944825-15944847 GATAGTCTCCAAAATGAGAATGG - Intronic
1175052491 20:56168167-56168189 TATAGCCTCCACAAGGAGCGAGG - Intergenic
1175577948 20:60076713-60076735 TAAAGCCCCCAGAAATAGCAAGG - Intergenic
1177096736 21:16844966-16844988 TATGGCACCGGAAATGAGCAAGG + Intergenic
1177535360 21:22420470-22420492 TATAGCCTAAGAAATGAGCATGG + Intergenic
1177626715 21:23671809-23671831 TATAGCACACAAAATGTTCAAGG + Intergenic
1177949320 21:27514219-27514241 TATAACCCACAAAATGACCTAGG + Intergenic
1178815300 21:35923939-35923961 TGTATCTGCCAAAATGAGCAAGG + Intronic
1179261789 21:39764226-39764248 TTTAGCCCCCACAATGTGCCTGG + Intronic
1180167139 21:46036081-46036103 CATCGCCCCCATAGTGAGCAGGG + Intergenic
950884055 3:16347424-16347446 CCTAGCCTCCAAAAGGAGCATGG - Intronic
951302777 3:21018626-21018648 TATATCCAACAAAATGTGCAGGG - Intergenic
951790646 3:26479889-26479911 TAAAGCCCCAAAATTGAGGAAGG + Intergenic
953373190 3:42407125-42407147 TATAGCCCTCAAAATAATCCAGG + Exonic
954967715 3:54625869-54625891 TAGGACCCCCAAAATGATCACGG - Intronic
956532525 3:70236554-70236576 TACAGGCCCCAAAAGGAGTATGG - Intergenic
957429624 3:80085179-80085201 TAAAGCCCTCAAAGGGAGCATGG + Intergenic
957971898 3:87392582-87392604 AATAGACACCAAAAGGAGCAGGG + Intergenic
962872133 3:139506620-139506642 TTTAAACACCAAAATGAGCAGGG + Intergenic
963240180 3:142995220-142995242 TAGAGACTCCAAAATAAGCACGG + Intronic
972282898 4:37620021-37620043 TATAACCCCCAATTTGAGAAGGG + Intronic
975186152 4:71405808-71405830 AAAAGCCCCCAAAGTGAGCTGGG - Intronic
978174966 4:105718774-105718796 CCTAGCCCCCACAATAAGCAGGG - Intronic
978850328 4:113328108-113328130 TATAGCACACAACATGAGCGTGG + Intronic
981847901 4:149190747-149190769 TTTTGCCCCCAAAATCAACAAGG + Intergenic
981945567 4:150339616-150339638 TATGGACCCCAAAATGTTCATGG - Intronic
983059946 4:163147909-163147931 TCTAGAACCCAAAAAGAGCAAGG + Intronic
983302206 4:165940868-165940890 AATAGCCCCCAAAATGGTGAAGG - Intronic
986604996 5:9514026-9514048 TATAGCCTCCAGAGGGAGCAGGG - Intronic
989344659 5:40416457-40416479 TAGAGCCTTCAAAAGGAGCAGGG + Intergenic
991324597 5:65416578-65416600 TATATCCCCAAAAATTAGCCAGG + Intronic
994276853 5:97849127-97849149 TATAGCCACCACCATGATCAAGG + Intergenic
999261977 5:150244057-150244079 TCTAGCACCCAAGATGAGAAGGG + Intronic
999285091 5:150389930-150389952 AATAGCCCCCAAAGCCAGCATGG + Exonic
1001780038 5:174360637-174360659 TATAGCTACAAAAATGAGCAGGG - Intergenic
1004862993 6:19824697-19824719 TAAAAACCCCAAGATGAGCAGGG - Intergenic
1006665363 6:35689149-35689171 TATGGCCCCCACAAAGGGCAAGG - Intronic
1008463520 6:51804072-51804094 GATACCCACCAAAATGATCATGG + Intronic
1011227540 6:85124277-85124299 TATAGCCATCAAAATGAACTTGG - Intergenic
1017863318 6:158420278-158420300 TATGGCCCACAAACTGAGAATGG - Intronic
1019816463 7:3204658-3204680 GACAGCACCCAAAATGTGCAAGG - Intergenic
1020674999 7:11172391-11172413 TATAGGCCAAAAAATGAGCTAGG - Intergenic
1020927101 7:14343266-14343288 AATAGCTCCCAAAATAAGCCAGG + Intronic
1023121224 7:36910907-36910929 TTTTTCCCCCAAAATGAGCTTGG + Intronic
1023525515 7:41098540-41098562 TATAGGCCCTAACATGAGGAAGG - Intergenic
1024675784 7:51636777-51636799 GTTAGCCCACAAAATGCGCATGG - Intergenic
1024792355 7:52981135-52981157 TATATCCCTGTAAATGAGCATGG + Intergenic
1025156389 7:56610724-56610746 TATAGACACAAAACTGAGCATGG + Intergenic
1032827787 7:135589203-135589225 GAAATCCCCCAAAATGAACATGG - Intronic
1033585041 7:142768370-142768392 CATGTCCCCCAAATTGAGCATGG + Intergenic
1034150592 7:148912126-148912148 TAGAGCCCTCAGAAAGAGCATGG - Intergenic
1035330337 7:158092579-158092601 TATAGCCCACAAGATGGGAAAGG - Intronic
1035586519 8:779304-779326 TACAGCTCCCAGCATGAGCAAGG - Intergenic
1036053720 8:5227773-5227795 TATAGCCCCAAGAAGGATCAAGG - Intergenic
1039690832 8:39862839-39862861 TATAGCTGTCAGAATGAGCAGGG - Intergenic
1040538512 8:48330529-48330551 TCTAGCCCTCAAAAGGTGCAGGG - Intergenic
1040600657 8:48880604-48880626 TAGAGCCCTCAGAAGGAGCAGGG - Intergenic
1045452341 8:102340141-102340163 TATAGCCCCCATAAGTAGCAAGG + Intronic
1050027377 9:1349884-1349906 TAAAGCCTCCAAAGAGAGCATGG + Intergenic
1054979969 9:71194498-71194520 TAGAGTCCCCAAAGTGAGCTTGG + Intronic
1058538032 9:105982429-105982451 TGGTGCCCCCAAAATGAGCTGGG - Intergenic
1059251242 9:112889809-112889831 GATAGCACCCACAAAGAGCAAGG + Exonic
1059375556 9:113878158-113878180 CAAACCCCCCAAAATGATCAAGG - Intronic
1059841371 9:118221267-118221289 AATAGCCCCCAAAGTAAGTATGG - Intergenic
1062173152 9:135146502-135146524 TAGAGCCTCCAGAGTGAGCACGG - Intergenic
1188410114 X:29861546-29861568 TATAGCATCCAAAATAAGCAAGG + Intronic
1193230757 X:79042510-79042532 AATAGTCCCCAAAATGAAGAAGG - Intergenic
1193451794 X:81679816-81679838 TATAGCCCTGAGAATAAGCAGGG - Intergenic
1194889675 X:99363352-99363374 CATAGCCACCTAAATCAGCATGG - Intergenic
1197770858 X:130088379-130088401 TAGAGACCCCAAGATGTGCAGGG + Intronic
1201462849 Y:14246515-14246537 TATACCCCCCATAAAGATCATGG - Intergenic