ID: 929859379

View in Genome Browser
Species Human (GRCh38)
Location 2:45663357-45663379
Sequence CTGTGGGAATTCAAAGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 449
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 399}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929859374_929859379 5 Left 929859374 2:45663329-45663351 CCTTTTATAAAACAGTGAATTTG 0: 1
1: 0
2: 4
3: 57
4: 620
Right 929859379 2:45663357-45663379 CTGTGGGAATTCAAAGGAGAGGG 0: 1
1: 0
2: 2
3: 47
4: 399
929859373_929859379 6 Left 929859373 2:45663328-45663350 CCCTTTTATAAAACAGTGAATTT 0: 1
1: 0
2: 5
3: 98
4: 822
Right 929859379 2:45663357-45663379 CTGTGGGAATTCAAAGGAGAGGG 0: 1
1: 0
2: 2
3: 47
4: 399
929859372_929859379 30 Left 929859372 2:45663304-45663326 CCATTCGGAAAATCAAGATTAAC 0: 1
1: 0
2: 0
3: 8
4: 141
Right 929859379 2:45663357-45663379 CTGTGGGAATTCAAAGGAGAGGG 0: 1
1: 0
2: 2
3: 47
4: 399

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929859379 Original CRISPR CTGTGGGAATTCAAAGGAGA GGG Intronic
900459466 1:2795498-2795520 CTGGGAGAATTCCAAGGTGAAGG + Intronic
900539209 1:3194429-3194451 CTGTTGGAATTTAAAGGATAAGG - Intronic
900609707 1:3539346-3539368 CTGTGGGAGATAAAAGTAGAGGG + Intronic
900724833 1:4209077-4209099 CAATGTGAATTCAAGGGAGAAGG - Intergenic
901217848 1:7564797-7564819 CTGTGAGGATTAGAAGGAGATGG + Intronic
901736732 1:11317349-11317371 CTTTGGGAATCCAAGGCAGAAGG - Intergenic
901925883 1:12565678-12565700 CTTTGGGAAGTCAAGGCAGAAGG + Intergenic
902516261 1:16991326-16991348 CTTTGGGAGGCCAAAGGAGAAGG - Intronic
902652079 1:17843667-17843689 AGGTGGGAAGTGAAAGGAGAAGG - Intergenic
902738582 1:18418187-18418209 CAATGGGAATTCATAAGAGAAGG - Intergenic
902902467 1:19528836-19528858 CTTTGGGAAACCAAAGCAGAAGG + Intergenic
903575136 1:24335178-24335200 CTGTGGGTCTTCAGGGGAGAGGG - Intronic
904058623 1:27688642-27688664 CTTTGGGAAGTCAAAGCAGGAGG + Intergenic
904309772 1:29621236-29621258 CAGTGGGAATGGGAAGGAGAAGG + Intergenic
904843546 1:33390487-33390509 TTGTGGGAATCCAAAAGAGATGG - Intronic
905474914 1:38219284-38219306 CTGTGGGGCTTCAGGGGAGAGGG + Intergenic
905497898 1:38409174-38409196 CTCTGGGGACTCAAAGGAAAGGG + Intergenic
906575552 1:46886296-46886318 AGGTGGGAAATCTAAGGAGAGGG + Intergenic
906596424 1:47081600-47081622 TGGTGGGAAATCTAAGGAGAGGG - Intronic
906923047 1:50085310-50085332 CTGTGTGACCTCAAAGGAAAAGG - Intronic
907379603 1:54075283-54075305 CTGTGGGAATACAGGGGAGACGG + Intronic
907567148 1:55445866-55445888 ATATGGGAGTTCAAAGGAGATGG - Intergenic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
907935818 1:59041425-59041447 CTGTGGGATTGTAAAGGACAGGG - Intergenic
908383334 1:63617175-63617197 CTGAGGGAGCTCAAAGGAGAAGG + Intronic
909578870 1:77208986-77209008 TAGTGGGAATGTAAAGGAGATGG - Intronic
910047166 1:82931870-82931892 CTATAGGAATTCAAGGTAGAAGG + Intergenic
910975165 1:92898724-92898746 CTTTGGGAAGTCAAGGCAGAAGG - Intronic
911221249 1:95249753-95249775 CTGTAAGAGTTAAAAGGAGAGGG + Intergenic
911424977 1:97697309-97697331 CTGTTTGGATGCAAAGGAGAAGG + Intronic
911604665 1:99890119-99890141 CTGTGGTAATAAAAAGGATATGG - Intronic
912161660 1:106992969-106992991 CTTTGGGGACTCAAGGGAGAAGG + Intergenic
912459086 1:109819329-109819351 TTCTGGGGATACAAAGGAGAGGG + Intergenic
912839380 1:113025536-113025558 CTTTGGGAAGCCAAAGCAGATGG + Intergenic
915021052 1:152778637-152778659 CTGGGGGATTTCTGAGGAGAAGG + Intronic
915791624 1:158678245-158678267 CTTTGGGACAGCAAAGGAGAAGG - Intronic
917587006 1:176437370-176437392 CTATGAGAACTCACAGGAGAAGG - Intergenic
917923822 1:179772289-179772311 TTGGAGGAACTCAAAGGAGATGG - Intronic
918025338 1:180739138-180739160 CACAGGCAATTCAAAGGAGAAGG - Intronic
918202710 1:182282022-182282044 AAGTGGGAATTTTAAGGAGAAGG + Intergenic
918440012 1:184557407-184557429 CTTTGGGGATTCAGAGGAAAGGG - Intronic
919622695 1:199880585-199880607 CTTTGAGACTTCACAGGAGAGGG - Intergenic
920688361 1:208127159-208127181 CTTTGGGAAGTCCAAGGAGATGG + Intronic
921154561 1:212429063-212429085 CTGTGGGACTTCATAAGAAATGG - Intergenic
922092060 1:222405211-222405233 CTGTGGGAATAAGAAGGAGCCGG + Intergenic
923448837 1:234097657-234097679 CTGTGGGAATTAAGAGGAGGAGG + Intronic
923621145 1:235580628-235580650 CTGTGGTAATTCCAGGGAGTAGG - Intronic
923784682 1:237055497-237055519 TTGTGGGAATAGAAAGGAGCGGG + Intronic
923922777 1:238587461-238587483 CTTTGGGACGTCAAAGCAGACGG - Intergenic
924441830 1:244092650-244092672 CTGTGGGCATGATAAGGAGAAGG - Intergenic
1062795748 10:343892-343914 CAGTGGGAATTCACAGACGAGGG + Intronic
1064695860 10:17964646-17964668 CTCTGGGAGTTCAAAGAACATGG + Intronic
1064814554 10:19244327-19244349 CTTTGGGAATTCAAGGCAGGTGG + Intronic
1066150308 10:32609473-32609495 CTATGGAAATTCAAAGTAAAAGG - Intronic
1066379406 10:34888625-34888647 CTTTGGGAGTCCAAAGCAGAAGG - Intergenic
1068829982 10:61482894-61482916 ATGAGGGTATTCAAAAGAGAAGG - Intergenic
1068941714 10:62687218-62687240 CTGGCCTAATTCAAAGGAGAAGG + Intergenic
1069408558 10:68128192-68128214 CTGTGAGAATTCACAGCAAATGG + Intronic
1069839416 10:71329952-71329974 CTGTGGGAAGTCTAAGGAGTTGG + Intronic
1069953114 10:72033207-72033229 CTTTGGGAGGTCAAAGTAGAAGG + Intergenic
1069998832 10:72361004-72361026 CTATGGGAGTTCAAAGCAGGGGG - Intergenic
1071387572 10:85137800-85137822 CAGTGGGGACCCAAAGGAGAGGG + Intergenic
1071632214 10:87227338-87227360 CATTGGGAGCTCAAAGGAGAAGG + Intronic
1071645667 10:87359557-87359579 CATTGGGAGCTCAAAGGAGAAGG + Intronic
1071968315 10:90876232-90876254 CTGTGTGAATTCTGAGGACAAGG - Intronic
1072235703 10:93451594-93451616 CTGTTGGGATTAAAAGGCGAAGG + Intronic
1072902387 10:99419846-99419868 TTGTAGGAATTCAGAGGGGAGGG - Intronic
1073755120 10:106573034-106573056 CTGTGGGAATGGAAAGGTTAAGG + Intergenic
1074630129 10:115244778-115244800 CTGTGTGAATTCTAAATAGAAGG - Intronic
1074753072 10:116605759-116605781 CTGTGGGAATACAGAAGATAAGG + Intronic
1075226813 10:120637039-120637061 CTGTGGCAAATCAAGGAAGAGGG + Intergenic
1075263140 10:120979983-120980005 ATGTGGCATTTCAAAGGAGGAGG + Intergenic
1075864925 10:125710001-125710023 CTGATGGACTTCAAAGAAGATGG - Intergenic
1076566121 10:131400659-131400681 CTGTGGCAGTGCAAAGGGGAGGG + Intergenic
1077922572 11:6652733-6652755 CTGAGGGAATTCAAAACAGATGG + Intronic
1078590573 11:12637358-12637380 CTTGGGGAATTAAAAGAAGAAGG + Intergenic
1078603201 11:12751437-12751459 CTGTGGGAACACAGAGGAGTGGG + Intronic
1078899516 11:15628557-15628579 CTGAGCCAATTCAAAGGGGAGGG + Intergenic
1080005918 11:27406210-27406232 CTATGGGAATTCAAATTGGAAGG - Intronic
1080897197 11:36456499-36456521 CCCTGGAAATTCAGAGGAGAAGG - Intronic
1082640161 11:55649956-55649978 CTGTTTGATTTGAAAGGAGAGGG - Intergenic
1082952685 11:58834260-58834282 CTGTAAGAATACAGAGGAGAAGG + Exonic
1083954465 11:65975965-65975987 CTGTGGGAAGTCAAAAGCGTGGG + Intronic
1085261861 11:75210307-75210329 CTGTTGGATTCCAAAGCAGAGGG - Intergenic
1085804566 11:79623245-79623267 CTGTGGGAATTGATAGAGGAAGG - Intergenic
1086054679 11:82632576-82632598 ATGTGTGAATTCTAAAGAGATGG - Intergenic
1086923227 11:92611635-92611657 CTTTGGGAGTTTAAAGCAGACGG - Intronic
1088336884 11:108715268-108715290 CTTTGGGAATCCAAGGCAGAAGG + Intronic
1089392234 11:118110053-118110075 CTGTGGGAATTCCAGAGAAAGGG + Intronic
1089438056 11:118488304-118488326 CTATGGGAATATAAAGGAGTGGG - Intronic
1089878408 11:121748218-121748240 CTGTGGGATTGCAAAAGGGATGG - Intergenic
1089895530 11:121926867-121926889 ATGAGGGTCTTCAAAGGAGAAGG + Intergenic
1089965296 11:122650624-122650646 CTTTGGGAAATCAAAGCAGGAGG - Intergenic
1090020458 11:123123845-123123867 CTGTGGCAGCTCAGAGGAGATGG + Intronic
1090894214 11:130955159-130955181 CTGTGGGGCCTGAAAGGAGAAGG + Intergenic
1091267711 11:134283534-134283556 TTGTGGGATTTGAAAGGAAACGG - Intronic
1091408440 12:223596-223618 CTGTGGCATCTCAAGGGAGAAGG - Intronic
1092938289 12:13384507-13384529 CCATGGGAATGTAAAGGAGAGGG - Intronic
1094359518 12:29615157-29615179 CTGTGGCAATTAAAACCAGATGG + Intronic
1094706288 12:32917190-32917212 CTTTCAGACTTCAAAGGAGATGG - Intergenic
1094739799 12:33275567-33275589 CTGTGGGAGGCCAAAGAAGATGG - Intergenic
1095032269 12:37304982-37305004 CTGTAGGAATTCATTGGAAACGG + Intergenic
1095423969 12:42055366-42055388 CTTTGGGAAGTCTAAGCAGAAGG + Intergenic
1096951332 12:55476950-55476972 CTGTGGAAAATCTAAGGGGATGG + Intergenic
1097234875 12:57532531-57532553 CTGAGGGAGTGGAAAGGAGATGG + Intronic
1097249165 12:57622960-57622982 TGGTGGGAAGTCAAATGAGAGGG - Intronic
1097885322 12:64723055-64723077 CTGGTGGAATACCAAGGAGAAGG - Exonic
1098213979 12:68196236-68196258 CTTTGGGGATCCAAGGGAGAGGG - Intergenic
1099535979 12:83845243-83845265 CTCAGGGAATTCTAAGTAGATGG - Intergenic
1100061278 12:90579021-90579043 CTTTGGGATGTCAAAGCAGACGG + Intergenic
1101590804 12:106123635-106123657 CTCTGGGAATTGAAAGAACAAGG + Intronic
1101660343 12:106759728-106759750 GTCTGGGAACTCAAGGGAGAAGG - Intronic
1102096924 12:110248259-110248281 CTGTGAGAATTCAAACAAGTTGG + Intergenic
1102784512 12:115593388-115593410 CTGTGGGGATTCAGGGGAAAGGG - Intergenic
1102907225 12:116686144-116686166 CTATGGGAATACAAAAGGGAGGG - Intergenic
1103361279 12:120355865-120355887 CTCTGGGAATTCAGAGGAGGGGG - Intronic
1103806655 12:123579053-123579075 CTGTGGGAGGCCAAAGGGGATGG - Intergenic
1103852328 12:123941230-123941252 CTGTGGGAATGCAGAGGAACAGG - Intronic
1104520972 12:129474703-129474725 CTGGGGGAGTGCAAAGGTGAGGG + Intronic
1104599461 12:130142602-130142624 TAGTGGGATTTCAAAGGAGAGGG + Intergenic
1105961492 13:25345420-25345442 CTATGTGATTTAAAAGGAGAGGG + Intronic
1106365417 13:29074348-29074370 CTGTGGGAGCACACAGGAGAGGG - Intronic
1106605285 13:31223292-31223314 CTGGGGGAATGCAGAGGGGAAGG + Intronic
1106758525 13:32845719-32845741 CTGTGGGGAATCAGAGGAGATGG - Intergenic
1108526936 13:51293471-51293493 CTGTGGGCAAAGAAAGGAGAAGG - Intergenic
1109618652 13:64871703-64871725 CTCTGGGATATAAAAGGAGAAGG + Intergenic
1109725260 13:66332231-66332253 CTGTGCCCATTCAAAGGAGATGG + Intronic
1110958001 13:81581050-81581072 CTGTAGTAATTGAAAGGTGAAGG + Intergenic
1111247417 13:85558266-85558288 CTTGGGAACTTCAAAGGAGAGGG + Intergenic
1112297354 13:98199763-98199785 GTGTGGGAATTCAGAGGGGCTGG + Intronic
1112479051 13:99757141-99757163 CTTTGGGAAGTCAAGGCAGAAGG - Intronic
1112494155 13:99892822-99892844 CTGTGGGAATTGAGAGAAGTGGG - Exonic
1112918495 13:104580548-104580570 ATGTGGGAATCCAAACTAGAGGG + Intergenic
1114307027 14:21432796-21432818 GTGTGGGTATTTAAAGGAGGTGG - Intronic
1114497108 14:23140424-23140446 CTGTGGCCCTTCAAGGGAGAGGG + Intronic
1115137386 14:30127304-30127326 CTGTGGATATTGCAAGGAGAGGG - Intronic
1115446306 14:33494378-33494400 CTGTGTGAAACCAAAGGAGAAGG + Intronic
1115543079 14:34441168-34441190 CTTTGGGAACTCAAAGCAGGTGG + Intronic
1115929384 14:38473748-38473770 CTGTGGGAAGCCAAGGCAGAAGG + Intergenic
1116273657 14:42804222-42804244 ATGTGAGAATTTAATGGAGATGG + Intergenic
1116645687 14:47526030-47526052 ATTTGGCAAGTCAAAGGAGAGGG - Intronic
1117757969 14:58996243-58996265 CTGTGAGCATTGCAAGGAGAAGG - Intergenic
1118644219 14:67821226-67821248 CTATGAGTATTCAAAGGGGAGGG + Intronic
1118732372 14:68677444-68677466 CAGTGGGCATCTAAAGGAGAGGG - Intronic
1118854213 14:69609022-69609044 TTCTGGCAATTCAAAGCAGAAGG + Intergenic
1119234034 14:73004752-73004774 CTGTGGGAGGCCAAAGCAGATGG + Intronic
1119598883 14:75961025-75961047 CTGTCGGAAGTCAATGTAGAGGG + Exonic
1120155239 14:81085958-81085980 CAGAGGGAATTCCAAGGATATGG + Intronic
1120215853 14:81679911-81679933 CTGTGGGACTTCAGAGGAAATGG + Intergenic
1120255239 14:82110465-82110487 CTGTAGGTATTTAAAGCAGACGG + Intergenic
1120580504 14:86242008-86242030 CTTTGGGGATTCAAAGGGGAAGG - Intergenic
1120866841 14:89302454-89302476 CCATAGGAATTCAAAGAAGAGGG - Intronic
1121293733 14:92799206-92799228 CTGTGGGAGGTCAAAGTAGGAGG - Intronic
1122557648 14:102590334-102590356 CTGTGGGAGGTGTAAGGAGAGGG + Intergenic
1122958785 14:105085088-105085110 CTGTGGGAAGTGAAGGCAGAGGG - Intergenic
1202908880 14_GL000194v1_random:98743-98765 CTGTGGGAGTCCAAGGGAGGTGG - Intergenic
1123702242 15:22923697-22923719 CTTTGGGAAGTCAAAGCAGGAGG + Intronic
1124994613 15:34710829-34710851 CTTTGGGAATCCAATGGAGAAGG + Intergenic
1125093294 15:35820555-35820577 CTGTGGAAATAAAAAGGAAAAGG - Intergenic
1125582578 15:40797124-40797146 CTTTGGGAAGCCAAAGCAGAAGG + Intronic
1126815532 15:52449754-52449776 CTTTGGGAAGCCAAAGGAGGAGG + Intronic
1127139189 15:55956535-55956557 CTGAGGTAATTCAAGGGAAAGGG - Intronic
1127586079 15:60379347-60379369 CTGGGGGAAAAAAAAGGAGATGG + Intronic
1128214000 15:65921950-65921972 CTGTGGGAGTGCAGAGGAGCTGG - Intronic
1128645871 15:69378596-69378618 CCCTAGAAATTCAAAGGAGAGGG + Intronic
1129910653 15:79223328-79223350 TTCTGGGAAATCAATGGAGAAGG - Intergenic
1129916681 15:79280268-79280290 ATGATGGAAGTCAAAGGAGAAGG - Intergenic
1130163637 15:81428147-81428169 CTGTGGGAATATAAAGGCAAAGG - Intergenic
1131643410 15:94316039-94316061 CAGTGAGATTTCAAAGCAGAAGG - Intronic
1132613623 16:829680-829702 CTGTGGGAGGCCGAAGGAGATGG - Intergenic
1134819757 16:17237393-17237415 GTGTGGGAAGGCAGAGGAGAGGG - Intronic
1137455770 16:48616730-48616752 CTGTGGGAGGCCAAAGCAGAAGG - Intronic
1138849653 16:60611833-60611855 CTGTGTGAATATAAAGGATATGG - Intergenic
1140182149 16:72730607-72730629 CTATGGGAATGAAAAGGAGGGGG + Intergenic
1140191559 16:72821426-72821448 ATGTGGGAACTCAATGGAGACGG - Intronic
1140675716 16:77327338-77327360 CTTTGGGAACTCAAGGGAAAGGG - Intronic
1140692909 16:77501469-77501491 CTGTGTGTTTTCAAATGAGAGGG - Intergenic
1141137006 16:81473022-81473044 CTGAGGGTATGCAGAGGAGATGG - Intronic
1141286662 16:82679126-82679148 GTTTGGGAATGCAAAGGAGCTGG - Intronic
1143675609 17:8430386-8430408 CTGTGGAAATTCTGACGAGATGG - Intronic
1145955408 17:28851190-28851212 CTTTGGGAGGTCAAAGCAGATGG + Intronic
1146568665 17:33934860-33934882 CTGTGAGAATTGATAGGAGCTGG - Intronic
1149285284 17:55157127-55157149 TTATGGAACTTCAAAGGAGAGGG + Intronic
1151343494 17:73486892-73486914 CTGTGGGAAGGCACAGGTGAGGG + Intronic
1151902378 17:77025033-77025055 CTGTGGGAGTTCAGAGGAGAGGG - Intergenic
1152294912 17:79461451-79461473 CTGTTGGAGTTCAAAGAAGGCGG - Intronic
1152555172 17:81049503-81049525 CTGTGGGCTTTAAAAGGGGAAGG - Intronic
1153175835 18:2371915-2371937 CTCTGGGAATTTAGAGGAGAGGG - Intergenic
1153501174 18:5751542-5751564 CACTGGGAATTCCAAGGAGCTGG + Intergenic
1154111930 18:11577679-11577701 CTGTTGGAAGTTAAAGGGGAAGG + Intergenic
1155194391 18:23459522-23459544 CTATGGGAACACAAAGGAAAGGG + Intronic
1156071432 18:33215841-33215863 CTTTGGGAAGTCAAAGCAGGAGG + Intronic
1156105743 18:33657963-33657985 TTGTGGGATTTCAAAGTATAAGG + Intronic
1156172001 18:34496517-34496539 GTGTGGGACTTGAAAGGAAAAGG - Intronic
1156193574 18:34747500-34747522 CTTTGGGGACTCAGAGGAGAAGG - Intronic
1156494121 18:37514747-37514769 ATGTGGATTTTCAAAGGAGAGGG - Intronic
1156548205 18:37986943-37986965 GTGTGGGAATTGCAAGGAGGCGG - Intergenic
1157074472 18:44449996-44450018 CTGTGGGAACAGAAAGCAGAAGG - Intergenic
1158751049 18:60261496-60261518 CAGTAGGAATTCAAAGGAAGAGG + Intergenic
1158813529 18:61066569-61066591 CTCTGTGATTTCAAAAGAGAAGG - Intergenic
1158952983 18:62513242-62513264 CTTTGGGAAGCCAAAGGAGGAGG - Intergenic
1161857282 19:6773100-6773122 CTCTGGGCCTGCAAAGGAGAGGG + Intronic
1162101081 19:8339277-8339299 CTCTGGGAAGCCAAAGCAGAAGG + Intronic
1164196287 19:22965584-22965606 CACTGGGAATTCTAAAGAGAAGG - Intergenic
1166430808 19:42725614-42725636 CTTTGGGAAGTCACAGCAGAAGG + Intronic
1166625218 19:44345534-44345556 CTTTGAGAATTCAAAAGAAAAGG + Intronic
1166772671 19:45293820-45293842 CTGTGGGAACCCAAAGGAGGAGG + Intronic
1167105331 19:47427147-47427169 CTTTGGGAAGCCAAAGCAGAAGG - Intergenic
1168012756 19:53546442-53546464 TTGTGGATACTCAAAGGAGAGGG - Intronic
1202633540 1_KI270706v1_random:21971-21993 CTGTGGGAGTCCAAGGGAGGTGG + Intergenic
1202652341 1_KI270707v1_random:18096-18118 CTGTGGGAGTCCAAGGGAGGTGG - Intergenic
1202659794 1_KI270708v1_random:57625-57647 CTGTGGGAGGCCAAAGGAGGTGG + Intergenic
925073124 2:987177-987199 CTGTAGGAACTTAGAGGAGATGG + Intronic
926646381 2:15294183-15294205 CTCTGGGAATACACAGGAGTGGG + Intronic
928161744 2:28933156-28933178 ATGTGGAAATGCAAAGGACATGG + Intronic
928449494 2:31365852-31365874 CTGTGAGAATTCAAAGCAGGGGG + Intronic
929372262 2:41240616-41240638 CTTTGGGAAGGCAAAGCAGATGG - Intergenic
929397692 2:41542241-41542263 CTGAAGGAATTCAAAGGAGTGGG - Intergenic
929859379 2:45663357-45663379 CTGTGGGAATTCAAAGGAGAGGG + Intronic
932069659 2:68606644-68606666 ATGTGGGGATTGAAAGGAAATGG + Intronic
933769762 2:85735648-85735670 CTATGAGAATTCCTAGGAGATGG - Intergenic
936662734 2:114560209-114560231 CTGTGGGAGTTGGGAGGAGAAGG + Intronic
938216048 2:129516688-129516710 CTTTGGGAACTCAAGGGAAAGGG - Intergenic
939021695 2:136965082-136965104 CTGTGGGAAAACAATGGAGCAGG - Intronic
939535072 2:143417413-143417435 CTGGGGGAAGTAAAATGAGAGGG + Intronic
939866677 2:147480904-147480926 CTGTGGGAGTTCACAAGAGAGGG + Intergenic
942300559 2:174557242-174557264 CTGGGGGAAGACAAAGGAGAAGG + Intergenic
942726851 2:179019023-179019045 CTGTGGGTGTCCAAAGAAGAGGG - Intronic
943959490 2:194243639-194243661 CTTTGGGAATCCAAAGCAGGTGG + Intergenic
944041475 2:195360284-195360306 TTCTGGGAATTCAAAAGAGTTGG - Intergenic
944713424 2:202356256-202356278 CTGTGGGGATACAAACAAGAAGG + Intergenic
945035788 2:205702927-205702949 CTCTGGGAGTTCAGAGGAAAGGG - Intronic
945816470 2:214610846-214610868 CTGGGGGAATTCTAAGGTGCAGG + Intergenic
946347036 2:219118972-219118994 CTGTGGGACACCAAAGCAGATGG - Intronic
946414155 2:219531103-219531125 CTTTGGGAAGCCAAAGCAGAAGG + Intronic
946889332 2:224259214-224259236 CTGGGGGAATTCTGAAGAGAGGG + Intergenic
947903980 2:233746267-233746289 CTGTGGGGATTCAAGGAAGGTGG + Intronic
947992616 2:234498479-234498501 CCTTGGGAATTCCAAGGATAGGG - Intergenic
1168949433 20:1786506-1786528 CTGTGAATATTCAAAGAAGAAGG - Intergenic
1169989401 20:11484189-11484211 CTGTGGGAATTCAAAGAGCTAGG - Intergenic
1170344011 20:15363172-15363194 CTGTGGGAATTCTCAAGGGAGGG - Intronic
1170667942 20:18403039-18403061 CTTTGGGAACTCTGAGGAGAGGG - Intronic
1170820097 20:19750232-19750254 CTGTGGGAGGTCAAGGGAGGCGG + Intergenic
1171379485 20:24723639-24723661 TTGTGGGAATTGAAAGGATGGGG + Intergenic
1172706674 20:36887240-36887262 CTGTAGGAATTCAAACTAGAGGG + Intronic
1172915334 20:38439266-38439288 GTGAGGGAATTCCAAGAAGAGGG + Intergenic
1173197540 20:40928255-40928277 CTGTGGGAGTGCAGAGGAGAGGG - Intergenic
1174370552 20:50084444-50084466 TTGGGGGAATACAAAGAAGATGG + Intronic
1174690485 20:52499409-52499431 CTTTGGGAAGTCAAGGCAGAAGG - Intergenic
1176599806 21:8781557-8781579 CTGTGGGAGTCCAAGGGAGGTGG + Intergenic
1177284594 21:19033281-19033303 CAGTGGGAAGTCAAAGAAGTGGG + Intergenic
1177629116 21:23703709-23703731 CTTTGGGAAGTCAAGGCAGATGG + Intergenic
1177642996 21:23868015-23868037 CTGTGGGAAGTCGAAGCAGACGG + Intergenic
1180367173 22:11951319-11951341 CTGTGGGAGTCCAAGGGAGGTGG - Intergenic
1180378907 22:12120018-12120040 CTGTGGGAGTCCAAGGGAGGTGG + Intergenic
1180645841 22:17338008-17338030 CCGATGGAATTCAGAGGAGAAGG - Intergenic
1180749627 22:18115340-18115362 CAGAGGGAGTTCCAAGGAGAAGG - Intronic
1181043229 22:20202769-20202791 CTGTGGGACTGCAGGGGAGACGG + Intergenic
1182148334 22:28011350-28011372 CTTTGGGAAGCCAAAGCAGATGG + Intronic
1182689726 22:32150627-32150649 CTGAAGGAAGGCAAAGGAGAAGG + Intronic
1182689845 22:32151701-32151723 CTGAAGGAAGGCAAAGGAGAAGG + Intronic
1182689973 22:32152776-32152798 TTGAGGGAAGGCAAAGGAGAGGG + Intronic
1182714464 22:32345864-32345886 CTGTGGCAATTTAAATTAGACGG - Intergenic
1183104469 22:35606412-35606434 CTGTGGGAACCCAGAGGAGAGGG - Intergenic
1183482112 22:38070815-38070837 CTGTCGGGATTCAAAGAAGAGGG - Intronic
949797051 3:7862820-7862842 CTGGGGGAATGCACAAGAGAAGG + Intergenic
949817673 3:8077490-8077512 TTGTGTGAATTCAAAATAGATGG + Intergenic
951981205 3:28568813-28568835 ATGTGGGAGATCATAGGAGAGGG + Intergenic
953323617 3:41993884-41993906 ATCTGGGAAGTCATAGGAGAAGG - Intergenic
953451701 3:43011769-43011791 CTGTGTGAAGTCACAGGAGGAGG + Intronic
953451961 3:43013227-43013249 CTGTGGGAAGTCACAGGAAGAGG + Intronic
953452041 3:43013705-43013727 CTGTGGGAAGTCACAGGACAGGG + Intronic
955748164 3:62160537-62160559 CTGTGGGATGTCAGAGGAGCCGG + Intronic
956085327 3:65602530-65602552 CTGTGGGAGTTAGAAGGAAATGG + Intronic
956272423 3:67462206-67462228 CTGTGGGAAGAAAAAGGAGCAGG - Intronic
956386659 3:68726309-68726331 CTGTGGAAAGTCAATGCAGATGG - Intergenic
956671446 3:71695225-71695247 CTGTCTGAATTCAAAGCAGAAGG - Intronic
958094418 3:88924146-88924168 GTGAGGGAATAGAAAGGAGAAGG + Intergenic
958705877 3:97654791-97654813 CTGTAGGAACTCAAAGGGCATGG + Intronic
959946704 3:112133054-112133076 CTGTGGGAGAGCAGAGGAGATGG - Intronic
960853566 3:122080017-122080039 ATGTGGGAATTCCAAGCAGCAGG + Intronic
961115185 3:124323281-124323303 CTGTGGGGATTCAGAGGGAAGGG - Intronic
961132920 3:124485440-124485462 CTGTGGGCAGTCGAAGGAGTGGG + Intronic
961837211 3:129672352-129672374 CTTTGGGAGGTCAAAGGAGAAGG + Intronic
962797579 3:138862522-138862544 CTGGGAGAATTCAAAGGTGGTGG - Intergenic
964698468 3:159536609-159536631 CTGTGAAAGTTCTAAGGAGAAGG + Intronic
965616151 3:170594561-170594583 CTTATAGAATTCAAAGGAGATGG - Intronic
965699202 3:171442356-171442378 CTGGGGGTATTCAAAGCAGCAGG - Intronic
966149121 3:176847381-176847403 CTGTGGCAATGCCAAGGAGGGGG + Intergenic
969195354 4:5558889-5558911 CTGTTGGAATGGAGAGGAGAAGG + Intronic
969761055 4:9182260-9182282 CTGTGGGAATTCAACAGCCATGG + Intergenic
972140282 4:35950776-35950798 ATGTTGGAAGGCAAAGGAGAAGG + Intronic
972264852 4:37450326-37450348 CTTTGAGAACTAAAAGGAGAGGG - Intergenic
972545442 4:40076067-40076089 CTTTGGGAAGCCAAAGGAGGAGG - Intronic
973363164 4:49183979-49184001 CTGTGGGAGTCCAAGGGAGGTGG + Intergenic
973397929 4:49612881-49612903 CTGTGGGAGTCCAAGGGAGGTGG - Intergenic
974029319 4:56762038-56762060 CTCTGGAAATTCAAAGGCTAGGG - Intergenic
974201340 4:58645324-58645346 CTTTGGGAAACAAAAGGAGAAGG + Intergenic
974321873 4:60360810-60360832 CTGTTGTGATTCAAAGGAAAAGG - Intergenic
974462873 4:62210609-62210631 CTGTGGGGCTTTAAAGGAAAGGG + Intergenic
975373301 4:73613059-73613081 CAGTGTGGATTCAAAGGACATGG - Intronic
976202962 4:82598012-82598034 CTGTGGGAAGGCAAAGTCGAAGG - Intergenic
976361834 4:84188424-84188446 CTGTGGAAACTCAAAGGAGGAGG - Intergenic
976776945 4:88717569-88717591 CTGTGGGAATTCCAATTACATGG + Intergenic
977573830 4:98657352-98657374 TTGTAGAAATGCAAAGGAGAAGG - Intronic
980080949 4:128343487-128343509 CTTTGGGAGGTCAAAGCAGAAGG - Intergenic
980606583 4:135099215-135099237 CTTTGGGAAATCAAGGGGGAAGG + Intergenic
981001282 4:139831667-139831689 CTTTGGGTACTCATAGGAGAAGG - Intronic
981400099 4:144303639-144303661 CTATGGTAACTGAAAGGAGATGG + Intergenic
981621939 4:146710641-146710663 CTGTAGGACTTCAAGGGAGCTGG + Intronic
981955768 4:150471356-150471378 CTGTGGTGATTAAAAGGACAGGG - Intronic
984143681 4:176035082-176035104 CTGAGGGATTTCCAAGGAGCAGG + Intergenic
1202760525 4_GL000008v2_random:105497-105519 CTGTGGGAGTCCAAGGGAGGTGG + Intergenic
986664229 5:10086201-10086223 CTCTGAGAATTCAGAGGAGATGG + Intergenic
987323439 5:16791290-16791312 CTGTGGGAATTAAGAGAAAATGG - Intronic
987516583 5:18918115-18918137 ATGGGGGAAGGCAAAGGAGAAGG - Intergenic
988082532 5:26431990-26432012 CAGAGGGAATTCACAGGACAGGG - Intergenic
990880492 5:60532406-60532428 CTGTGGGAAATCAAATGATGTGG + Intergenic
992120413 5:73586611-73586633 CAGGGGGAATTAAAAGGACATGG + Intergenic
992134250 5:73727216-73727238 CTGTGGGAATACTAAGAAGATGG + Intronic
993834557 5:92801828-92801850 TTCTGGGAAATAAAAGGAGAGGG + Intergenic
994097772 5:95862613-95862635 CTGTGGGAATAAAAAGCAGAGGG - Intergenic
995312138 5:110726159-110726181 CTCTTGGACTTCAAAAGAGAAGG - Intronic
996187945 5:120502604-120502626 CTGTGGGAATTCAGAGGTCTTGG + Intronic
997515461 5:134485556-134485578 CTGTTGTAATTAAAAGGGGATGG + Intergenic
997526093 5:134554199-134554221 CTGTGGGGATTGGAAGGGGAGGG + Intronic
998482038 5:142470600-142470622 CTGTGGGAATTGACGGGAAAGGG + Intergenic
999089676 5:148925183-148925205 CTCTGGGAATCCATAGGACAAGG - Intronic
1000173831 5:158730249-158730271 CTGTGAGGACTCAGAGGAGAGGG - Intronic
1000203820 5:159038098-159038120 CTCTGGGATTGCAAAGGACAAGG - Intronic
1001416531 5:171548731-171548753 CTTTGGTAATTCAAGGGAGGAGG - Intergenic
1003763499 6:9209514-9209536 TTATAGGAAATCAAAGGAGAGGG + Intergenic
1004296875 6:14420975-14420997 CTGTGGGAAAGCAAAGGAGGAGG - Intergenic
1004550969 6:16646757-16646779 CTGTGGGAACACAAAGGAGTGGG - Intronic
1004899557 6:20181703-20181725 CTGTGGGTGTCCAAAGGGGAGGG + Intronic
1005183171 6:23130580-23130602 CTTTGGGAATGCAGAAGAGAAGG + Intergenic
1007136766 6:39529972-39529994 CTCTGTGAATTCAAAGGAGAAGG - Intronic
1007207634 6:40165385-40165407 CTGTGGGAATACACAGAAGGTGG + Intergenic
1007246971 6:40470011-40470033 CAGTGGGAATTCAAAAGGAAGGG - Intronic
1008036752 6:46753444-46753466 CTGTGGCAATGCACAGGGGAGGG + Intronic
1008199748 6:48571725-48571747 CTCCGGGAAATCAAAGGAAACGG + Intergenic
1008560907 6:52723744-52723766 CTTTGGGAAGCCAAAGCAGACGG - Intergenic
1010081435 6:71868682-71868704 CTTTGGGAAGCCAAAGCAGAAGG + Intergenic
1010931331 6:81807251-81807273 GTCTGGGAAGTCAAAGGATATGG + Intergenic
1011015301 6:82748004-82748026 CTTTTGGAATTCAAAGTATAAGG - Intergenic
1011825599 6:91302099-91302121 CTTTGGGAAGCCAAAGCAGAAGG - Intergenic
1012473105 6:99592030-99592052 CATTGGGAATTGAAATGAGAGGG - Intergenic
1012699354 6:102433940-102433962 CTGTGGGATTTCAAGTGAGCAGG + Intergenic
1013006910 6:106082264-106082286 CTGTGGGAAAGAACAGGAGAAGG - Intergenic
1013759634 6:113501823-113501845 GGGAGGGAATTCAAAGTAGATGG - Intergenic
1013798039 6:113907623-113907645 CTGTGGGATTTCCAAGGTTAAGG + Intergenic
1015395712 6:132732193-132732215 CTGTGGGAAGCCAAAGCAGGAGG - Intronic
1015778493 6:136839272-136839294 CTGTATGAATACAAAGGAAAGGG - Intronic
1016727569 6:147392750-147392772 CTCTGGGAAGTCAAGGGAGGAGG - Intergenic
1016853973 6:148648009-148648031 CTATGGGTGTTCACAGGAGATGG + Intergenic
1017453248 6:154574378-154574400 CTTTGGGAACTCAAGGCAGAAGG + Intergenic
1022074758 7:26956370-26956392 CTCGGGGAAGTCAAGGGAGAAGG + Intronic
1022342847 7:29485453-29485475 CTGTGAGCATTCAAAGAGGAGGG + Intronic
1022474550 7:30701400-30701422 CTGTGAGATTTCACAGGAGAGGG - Intronic
1022547238 7:31200756-31200778 CTGTGGGAAGACAATGAAGATGG + Intergenic
1023570331 7:41565310-41565332 CTGTGGGAAACGACAGGAGAGGG - Intergenic
1023743263 7:43300129-43300151 ATGGGGGAATTGAAAGGATAAGG - Intronic
1024362410 7:48482233-48482255 TTGTGGGAACTCAAAAGACAAGG + Intronic
1024527343 7:50360111-50360133 CTGTCAGAATTCCAAGCAGAAGG - Intronic
1025074013 7:55926892-55926914 CTTTGGGAAGCCAAAGCAGATGG + Intronic
1025101257 7:56136947-56136969 CTGAGGGATTTCCCAGGAGATGG - Intergenic
1025959786 7:66209909-66209931 CTTTGGGAAGTCAAGGCAGAGGG - Intronic
1026218055 7:68366993-68367015 CTTTGGGAATTCAGAGGAAAGGG - Intergenic
1027172283 7:75881087-75881109 CTTTGGGAATTCAAGGCAGGAGG + Intronic
1027197470 7:76040496-76040518 CTGCTGGAAGTCAAAGGAGTTGG - Intronic
1030759218 7:113330721-113330743 CTGTGGAAATTGAAAAGAAATGG + Intergenic
1031484449 7:122310754-122310776 CTGCGGGAATGCAGAGGAGAAGG - Intergenic
1031501006 7:122516289-122516311 CTGTGGGAAGTCAAGGCAGGAGG + Intronic
1032005794 7:128301154-128301176 CTGAGTGAATTCACAGGAAAGGG - Exonic
1032133184 7:129248654-129248676 ATGTGGAAATTCAAAGGACTTGG - Intronic
1032934792 7:136716578-136716600 ATGGAGGAATTCAAAGGAAAGGG - Intergenic
1034205299 7:149309374-149309396 CTCTTGGAATACAGAGGAGAGGG - Intergenic
1034940561 7:155227801-155227823 GTGTGGGAATTCCAATGAAAAGG + Intergenic
1035218605 7:157390693-157390715 CTGTGGGAAGGCAGAGGAAAAGG - Intronic
1035966406 8:4196884-4196906 ATGTGGGAATTTAATGAAGATGG - Intronic
1036091423 8:5669750-5669772 GTCAGGGAATGCAAAGGAGAAGG - Intergenic
1036271158 8:7304091-7304113 CTGTGGGAATTCAACAGCCATGG + Intergenic
1036350191 8:8006252-8006274 CTGTGGGAATTCAACAGCCATGG - Intergenic
1036618990 8:10410411-10410433 CTGTGGGAATTATGAGGTGATGG - Intronic
1036667097 8:10753648-10753670 CTTTGGGAGGCCAAAGGAGAAGG - Intronic
1036845461 8:12166684-12166706 CTGTGGGAATTCAACAGCCATGG - Intergenic
1036866827 8:12409005-12409027 CTGTGGGAATTCAACAGCCATGG - Intergenic
1037476546 8:19263364-19263386 CTTTGGGGACTCAAGGGAGAGGG - Intergenic
1038104121 8:24414273-24414295 CAGTGAGAAATCAGAGGAGAGGG + Intergenic
1038426164 8:27465268-27465290 CTGTGGGAATTAGAAGGGGAGGG - Intronic
1038518955 8:28212736-28212758 CTGTGGGAGGTCAAAGCAGGAGG + Intergenic
1038814229 8:30884640-30884662 CTATGGGCATTAAAAGGATAAGG - Intronic
1039055036 8:33529258-33529280 CTCTGGGAGGCCAAAGGAGAAGG - Intergenic
1041616842 8:59917007-59917029 ATATGGGAATTGAAAGAAGATGG + Intergenic
1041953465 8:63531525-63531547 ATGTGGAAATTCAAAAGAAAAGG - Intergenic
1042487344 8:69361181-69361203 ATGAGGGTATTCAAGGGAGAAGG - Intergenic
1044510849 8:93076536-93076558 CTGTGGGATCCCATAGGAGAGGG - Intergenic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1044880283 8:96716486-96716508 CTTTGGGAACTCCAAGGAAAGGG - Intronic
1045684677 8:104700221-104700243 CTGTTTGAATTAAATGGAGATGG - Intronic
1045934976 8:107668946-107668968 CCATGGGAATCAAAAGGAGAGGG - Intergenic
1046001470 8:108425462-108425484 CTTTGGGAAGCCAAAGCAGAGGG - Intronic
1046091256 8:109505131-109505153 CTTTGGGAGGTCAAAGCAGAAGG - Intronic
1046428099 8:114082903-114082925 CTGTTGAAATTTAAAGCAGAAGG + Intergenic
1046625648 8:116574053-116574075 CTTTGGGAGGTCAAAGCAGATGG + Intergenic
1047279546 8:123433216-123433238 CTGAGGGACTGCAAAGGAAAAGG - Intronic
1049545803 8:143229961-143229983 CTGTGGGAACTCGCTGGAGAAGG + Intergenic
1050484149 9:6115856-6115878 CTCTGGGAACTCAGAGGAAAGGG - Intergenic
1051184040 9:14439962-14439984 GGGTGGGAATTGGAAGGAGAGGG + Intergenic
1052100187 9:24436634-24436656 CTTTGGGAGGCCAAAGGAGAAGG - Intergenic
1054800649 9:69345104-69345126 CAGTGGGCATGCAAAGTAGATGG + Intronic
1054857044 9:69911890-69911912 CTCTGAGAATTTAAAGTAGAGGG - Intergenic
1055263899 9:74473683-74473705 CAGTCCGAATTCAAAGGATAGGG + Intergenic
1055311172 9:74982279-74982301 CTGTGGCAATTTAAATTAGATGG - Exonic
1056104561 9:83334061-83334083 CTGTTTGAATTGATAGGAGATGG - Intronic
1057133925 9:92673245-92673267 CAGTGGGAATGCAGAGGAGAGGG + Intergenic
1058074120 9:100633504-100633526 CTTTGGGAAGCCAAAGTAGAAGG - Intergenic
1059554281 9:115263223-115263245 CTGTGGGAACACAAAGGAGGGGG + Intronic
1060185796 9:121563342-121563364 GGGTGGAAATTCAAAGGAGCAGG + Intergenic
1060663833 9:125421182-125421204 CTTTGGGAAGTCAAAGTAGGTGG - Intergenic
1060875664 9:127081879-127081901 CTGTGGGAATGCCACGCAGATGG + Intronic
1061099896 9:128484629-128484651 TTGTGGGAAGGCAAAGCAGAGGG - Intronic
1061115210 9:128606126-128606148 CTTTGGGAAGTCAAAGCAGGTGG + Intronic
1062433721 9:136536882-136536904 CTGTAAGAATGCAAAGTAGAGGG - Intronic
1062687792 9:137824489-137824511 CTATGGAAATGCAAAGGACATGG - Intronic
1203709770 Un_KI270742v1:87160-87182 CTGTGGGAGTCCAAGGGAGGTGG - Intergenic
1203541297 Un_KI270743v1:90383-90405 CTGTGGGAGTCCAAGGGAGGTGG + Intergenic
1186507764 X:10107487-10107509 CTGTGGGAAGTGACAGGACATGG + Intronic
1186748845 X:12600274-12600296 CTGACGGACATCAAAGGAGATGG - Intronic
1187248895 X:17579481-17579503 CTTTGGGGATAAAAAGGAGAGGG - Intronic
1187754560 X:22508195-22508217 CTGTTGGAAGTGACAGGAGAGGG - Intergenic
1188002442 X:24995103-24995125 CTCTGGGAAGGGAAAGGAGAGGG + Intronic
1188403164 X:29772779-29772801 CTGTTGGAAATGAAAGTAGAAGG - Intronic
1188435199 X:30150927-30150949 CTGTGGAGATTCTAAGGAGAAGG - Intergenic
1191631078 X:63322825-63322847 CTATGGTAAGTCAAGGGAGATGG - Intergenic
1192259056 X:69493085-69493107 ATGTGGGAAGTCATAGGAGAAGG - Intergenic
1194120684 X:89960310-89960332 CTGGGTCAACTCAAAGGAGAGGG + Intergenic
1194431115 X:93807197-93807219 CTGTGGGAACTCCATGCAGACGG - Intergenic
1195105166 X:101596523-101596545 AAGTGGGCATTCATAGGAGAAGG + Intergenic
1196021382 X:110994664-110994686 TTCTGGGAATTCAGAGCAGATGG - Intronic
1196336475 X:114542240-114542262 CTTTGGGGACTCAAGGGAGAAGG - Intergenic
1197110042 X:122762028-122762050 CTTTGGGAACTCAGAGGAAAGGG + Intergenic
1197224834 X:123946312-123946334 CTTTGGGAGGTCAAAGCAGATGG + Intergenic
1197556347 X:127959690-127959712 CTTTGGGAATTCAGGGGATAAGG - Intergenic
1197607755 X:128605383-128605405 TAGTGGGAATTGAAAGGAGAAGG - Intergenic
1197627305 X:128816530-128816552 CAGTGGGAATAAAAAGGACAAGG + Intergenic
1197666925 X:129234136-129234158 CTCTGGGAATGCAAGGGAGTGGG + Intergenic
1199610224 X:149606513-149606535 CTGTGGGAGTTGAGAAGAGAGGG - Intronic
1200473548 Y:3617814-3617836 CTGGGTCAACTCAAAGGAGAGGG + Intergenic