ID: 929861260

View in Genome Browser
Species Human (GRCh38)
Location 2:45679790-45679812
Sequence GAGGGAACACAGAAGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1153
Summary {0: 1, 1: 1, 2: 5, 3: 100, 4: 1046}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929861260_929861271 19 Left 929861260 2:45679790-45679812 CCTTCCTTCTTCTGTGTTCCCTC 0: 1
1: 1
2: 5
3: 100
4: 1046
Right 929861271 2:45679832-45679854 TGGTTCAGCTTGGCTCTTCCGGG 0: 1
1: 0
2: 1
3: 12
4: 174
929861260_929861269 9 Left 929861260 2:45679790-45679812 CCTTCCTTCTTCTGTGTTCCCTC 0: 1
1: 1
2: 5
3: 100
4: 1046
Right 929861269 2:45679822-45679844 TAGAGAGGACTGGTTCAGCTTGG 0: 1
1: 0
2: 0
3: 10
4: 160
929861260_929861264 -6 Left 929861260 2:45679790-45679812 CCTTCCTTCTTCTGTGTTCCCTC 0: 1
1: 1
2: 5
3: 100
4: 1046
Right 929861264 2:45679807-45679829 TCCCTCCAGCTAGGGTAGAGAGG 0: 1
1: 0
2: 0
3: 13
4: 163
929861260_929861268 -1 Left 929861260 2:45679790-45679812 CCTTCCTTCTTCTGTGTTCCCTC 0: 1
1: 1
2: 5
3: 100
4: 1046
Right 929861268 2:45679812-45679834 CCAGCTAGGGTAGAGAGGACTGG 0: 1
1: 0
2: 1
3: 18
4: 183
929861260_929861270 18 Left 929861260 2:45679790-45679812 CCTTCCTTCTTCTGTGTTCCCTC 0: 1
1: 1
2: 5
3: 100
4: 1046
Right 929861270 2:45679831-45679853 CTGGTTCAGCTTGGCTCTTCCGG 0: 1
1: 0
2: 0
3: 12
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929861260 Original CRISPR GAGGGAACACAGAAGAAGGA AGG (reversed) Intronic
900522286 1:3111497-3111519 GAGGGAAGACCAGAGAAGGAGGG + Intronic
900658277 1:3770834-3770856 GAGGGAAGACAGAGGATGGAGGG + Intronic
900738650 1:4316871-4316893 TAGAGAACACAGAAAATGGAGGG + Intergenic
900863126 1:5246653-5246675 GAGGGAAGGAAGAAAAAGGAAGG - Intergenic
901175909 1:7298900-7298922 AAGGGAAGAGAGAGGAAGGAAGG - Intronic
901264919 1:7903041-7903063 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264928 1:7903068-7903090 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264937 1:7903095-7903117 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264946 1:7903122-7903144 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264951 1:7903140-7903162 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264960 1:7903167-7903189 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264965 1:7903185-7903207 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264974 1:7903212-7903234 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264983 1:7903239-7903261 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264988 1:7903257-7903279 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264997 1:7903284-7903306 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901265006 1:7903311-7903333 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901265011 1:7903329-7903351 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901386242 1:8911239-8911261 GAGGGAAGACAGGAAATGGAGGG + Intergenic
901578203 1:10218046-10218068 GAAGGAACAGAAACGAAGGAGGG - Intronic
901636082 1:10670814-10670836 GAGGGGTCACAGCTGAAGGATGG - Intronic
902114140 1:14107062-14107084 GAGGGGAGAGAGATGAAGGAAGG - Intergenic
902173173 1:14629540-14629562 GAGGGAGCAAAGAAGAGGCAGGG - Intronic
902689467 1:18101228-18101250 GAGGGGAGGGAGAAGAAGGAGGG - Intergenic
902772864 1:18655910-18655932 GATGAAACACAGATGCAGGAAGG - Intronic
902797657 1:18809902-18809924 AAGGGAAGAAAGAAGAAGGCAGG + Intergenic
902833117 1:19030230-19030252 GAGGGAGGAGAGAAGAAGCAAGG + Intergenic
903393551 1:22982139-22982161 GAGGAGACACTGCAGAAGGAGGG + Intergenic
903574546 1:24330797-24330819 CAGGGCACACAGAGGCAGGAAGG - Intronic
903799465 1:25955736-25955758 GAGGGAAGGAAGAAGGAGGAAGG + Intergenic
904268689 1:29333849-29333871 GAGGCAACACAACAGAAGAAAGG + Intergenic
904295767 1:29518887-29518909 GAAGGAAGAAGGAAGAAGGAAGG - Intergenic
904412477 1:30332820-30332842 GGGGAAACAGAGAAGGAGGAGGG - Intergenic
904437348 1:30507435-30507457 GAGGTTGCACAGAGGAAGGAGGG - Intergenic
904589459 1:31602739-31602761 GAGGGAATAGAAAAGATGGAGGG - Intergenic
904706565 1:32395201-32395223 GAGGGAAAAGAGATGAAGGGGGG - Intergenic
904725068 1:32540506-32540528 GAGGGAACACGTATGAAGCATGG + Intronic
905388579 1:37621586-37621608 GAGGGACCACAGGAGGAGGAGGG + Intronic
905488983 1:38328851-38328873 GAGGAGACAGAGAAGAGGGAAGG - Intergenic
905618617 1:39420567-39420589 CAGGGAACACTGAAAAAGGAAGG - Intronic
906227670 1:44134896-44134918 TAAGTAACACAGAAGAAGAATGG + Exonic
906488944 1:46252627-46252649 TAGGGAACACAGAAGAAGAATGG + Intronic
906860814 1:49357193-49357215 GAGGACACAGAGAAGCAGGAGGG - Intronic
906949654 1:50323805-50323827 GAGGGACCAGAGAGGAAGAACGG - Intergenic
906962937 1:50430453-50430475 GATGGAAACCAGGAGAAGGATGG - Intergenic
907481653 1:54749054-54749076 TAGGGAACACAAGAGGAGGAAGG - Intergenic
907569387 1:55468805-55468827 GGGGGTAGAGAGAAGAAGGAAGG + Intergenic
907726529 1:57025448-57025470 GAGGGAAGAAACAAAAAGGAGGG + Intronic
907981009 1:59480794-59480816 GAGGAAACAGAGAAGTAGGCAGG + Intronic
908027478 1:59968344-59968366 GAGGCAAGACAGAAAAAGCAAGG - Intergenic
908234628 1:62137658-62137680 GGGGGAACACAGAATGAGGGGGG + Intronic
909181057 1:72424619-72424641 GAGGGTAGAAGGAAGAAGGAGGG + Intergenic
909296364 1:73954286-73954308 GACGGGAGACAGAGGAAGGAAGG - Intergenic
909483079 1:76146501-76146523 GAGGGAGAAAAGAAGGAGGAGGG - Intronic
909659064 1:78062372-78062394 CAGAGAACACAGAAGAAGGAAGG - Intronic
909698960 1:78499205-78499227 GAGAGAACAGAGAAGAAAGAGGG - Intronic
909779075 1:79520160-79520182 GAAGAAAAAAAGAAGAAGGAAGG + Intergenic
909953986 1:81754499-81754521 GAGGGAAGAAAGAAAGAGGAAGG - Intronic
909986358 1:82165026-82165048 GAGGGAACATGGAATAAGGAGGG - Intergenic
910051504 1:82979267-82979289 TAGGGAACACAGTAGGAGCAAGG - Intergenic
910190583 1:84590921-84590943 AATGGAAAACAGAAGAAGCAGGG + Intergenic
910523275 1:88148434-88148456 AAAGGAAGAAAGAAGAAGGAAGG + Intergenic
911267757 1:95763063-95763085 GGGGGAGCTCAGAAGAAGAATGG - Intergenic
911281744 1:95938112-95938134 GTGGGCACACAGAACAAAGAAGG - Intergenic
911418498 1:97608024-97608046 GAGCCAACTCAGAAGAAGAAAGG + Intronic
911537303 1:99115864-99115886 GAGGGAACATTTAAAAAGGAAGG - Intergenic
912075296 1:105866901-105866923 GAGGGAATCAGGAAGAAGGAAGG + Intergenic
912155344 1:106911845-106911867 AAGGGAAAAGAGAAGAAGGCAGG - Intergenic
913528634 1:119716522-119716544 GAGAGAACATTGAAGAAGGATGG + Intronic
914873170 1:151492397-151492419 GAAGGAAGACTGAAGCAGGAGGG - Intergenic
914897866 1:151692948-151692970 GATGGGACACAGATGAAGAAGGG + Exonic
914960097 1:152197442-152197464 GAGGAAAGAAAGAAGAAAGAAGG - Intergenic
915005140 1:152628723-152628745 GAGGGAACTCTGAAGAAACAGGG - Intergenic
915100372 1:153495039-153495061 GAGGGCAGGCAGAGGAAGGAGGG - Intergenic
915279178 1:154810603-154810625 TAGGGAAACCAGGAGAAGGAAGG + Intronic
915625876 1:157113819-157113841 CAGGGAAGACAGGAGCAGGAAGG - Intergenic
915744199 1:158143508-158143530 AAGGGAAAACAGAAGAAGAATGG + Intergenic
916398692 1:164421841-164421863 AACGGAACAGAGAAGAAAGAGGG - Intergenic
916911127 1:169347592-169347614 GAGGGAGCACAGGAGAGAGAAGG - Intronic
917148157 1:171914856-171914878 GAGGGAACACACAAGGGTGAGGG + Intronic
917459719 1:175219472-175219494 GAGGGAACACAGGATAAAGTAGG - Intergenic
917460104 1:175222196-175222218 GATGGAAGAGAGGAGAAGGAAGG + Intergenic
917598849 1:176555949-176555971 GAGGGATTACTGAAGAAGAAGGG + Exonic
918079128 1:181192213-181192235 CAGGGAACACAGAAGATGTGAGG - Intergenic
918746024 1:188200852-188200874 TAAGGAACACAGAAGTAGGAAGG - Intergenic
919178221 1:194047272-194047294 GTGGGAAAACAGAAACAGGAGGG + Intergenic
919333050 1:196195429-196195451 GAAAGAAAACAGAAGAAAGAAGG + Intergenic
919347983 1:196410991-196411013 GAGGGAGCAATGAGGAAGGAAGG - Intronic
920004632 1:202823980-202824002 GAAGGAAAGCAGAAGAGGGAAGG + Intronic
920515301 1:206580773-206580795 GAAGGCACACAGGAGAAGGCTGG + Intronic
921200598 1:212801864-212801886 GAGAGAACAAAGATGAAGGAGGG - Intronic
921446070 1:215248843-215248865 GAGGAAACTTAGAAGAAGTAGGG + Intergenic
921626101 1:217379514-217379536 GAGGGCAAACAGAAGCAGGGTGG + Intergenic
922681376 1:227599959-227599981 GAGGGTAGACAGCAAAAGGATGG - Intronic
922722760 1:227906914-227906936 GAGGGAAGAAAGTAGGAGGAGGG - Intergenic
922723195 1:227909566-227909588 GAGGGAGAAGGGAAGAAGGAAGG + Intergenic
923240015 1:232074896-232074918 GATTAAACACAGCAGAAGGAAGG - Intergenic
923268504 1:232334698-232334720 AGGGGAGGACAGAAGAAGGAGGG - Intergenic
923452864 1:234136164-234136186 GAGGGAAGAAGGAAGAAAGAGGG - Intronic
923784469 1:237054208-237054230 GAGGGAAGAAAAAGGAAGGAAGG - Intronic
924005131 1:239600709-239600731 GAGGGAAGAAGGAAGGAGGAAGG - Intronic
924290345 1:242529818-242529840 GAGGGAGAGAAGAAGAAGGAAGG - Intergenic
924539879 1:244970695-244970717 GAGGGGAGAGAGAAGAGGGAGGG - Exonic
1062777281 10:162952-162974 GACTCAACACAGAAGAAGGCAGG - Intronic
1063502719 10:6569658-6569680 GAGGGAACACAGAGGAATTGGGG + Intronic
1063605746 10:7521448-7521470 GAAGGAAGAAAGAAGAAGGAAGG - Intergenic
1063889963 10:10619050-10619072 GTGGCAACAAAGAAGGAGGAAGG + Intergenic
1064513383 10:16119772-16119794 TAAGGAAAACTGAAGAAGGAAGG - Intergenic
1065348038 10:24767723-24767745 AAGAGAAAACAAAAGAAGGAAGG - Intergenic
1065750439 10:28881273-28881295 GAAAGAAGGCAGAAGAAGGAAGG + Exonic
1065881126 10:30038743-30038765 GAGAGAAGAGAGAAGCAGGATGG + Intronic
1065923869 10:30418170-30418192 GAGGGAAGAAAGAGAAAGGAAGG + Intergenic
1066179281 10:32944038-32944060 GAGGGAACAGACAAGAAAGTTGG + Intronic
1066350896 10:34636074-34636096 GAAGGAAGAAGGAAGAAGGAAGG + Intronic
1066515178 10:36151052-36151074 GAGGCAACAAAGAAGCAGGTTGG + Intergenic
1066533729 10:36367526-36367548 GAGGGAAGAAGGAACAAGGAAGG + Intergenic
1066626819 10:37415527-37415549 GAGGGAAAGGAGGAGAAGGAGGG + Intergenic
1066705259 10:38170897-38170919 GAGGGAGAAAAGAAGGAGGAAGG - Intergenic
1066985223 10:42459641-42459663 GAGGGAGTAAAGAAGAAGGAAGG + Intergenic
1067185304 10:44022066-44022088 GAGTAAACAGAGAACAAGGATGG - Intergenic
1067341541 10:45409662-45409684 GAAGGAACAAAGAAGTAGAAAGG - Intronic
1067853479 10:49769881-49769903 GAGGAAAAAGAGAGGAAGGAGGG + Intergenic
1067907065 10:50303509-50303531 AAAGGAAGACAGAAAAAGGAAGG + Intergenic
1068140428 10:52999627-52999649 GAAGGAAAATACAAGAAGGAAGG + Intergenic
1068416963 10:56735304-56735326 AAGGAAAGACAGAAGAAGGCAGG - Intergenic
1068597005 10:58913167-58913189 GAAGGAAGGAAGAAGAAGGAAGG + Intergenic
1068850354 10:61731749-61731771 GAGGGAGGACAGAGGGAGGAAGG + Intronic
1069100964 10:64319741-64319763 GAAGAAAAACAAAAGAAGGAGGG + Intergenic
1069408356 10:68126636-68126658 GACACACCACAGAAGAAGGATGG + Intronic
1069457404 10:68563612-68563634 GGGGGAATCCAGAAAAAGGACGG + Intronic
1069726107 10:70580152-70580174 GATGGGAGACAGAAGGAGGAAGG - Intergenic
1069967777 10:72135699-72135721 GAGGCAGGACAGAAGCAGGAAGG + Intronic
1070129130 10:73644672-73644694 GAGGGAACCAAGAAGAGTGATGG + Intergenic
1071268965 10:83989755-83989777 GAGGGAAGAAAGAGGAAGGAAGG + Intergenic
1071268974 10:83989798-83989820 GAGGGAAGAAGGAGGAAGGAAGG + Intergenic
1071424165 10:85531791-85531813 GAGGGAACTGAGAATAATGAAGG - Intergenic
1071444898 10:85736308-85736330 GAAGGAAGAAAGAGGAAGGAAGG + Intronic
1071679934 10:87694882-87694904 GAGGAAACTCAGAAGGAGTAGGG + Intronic
1071766134 10:88667734-88667756 GAGGGAAGGAAGAAGAAAGAAGG - Intronic
1071854596 10:89610805-89610827 GATTGAACATGGAAGAAGGAAGG - Intronic
1071955312 10:90751312-90751334 GAGGGAAAAGGGAAGAGGGAGGG + Intronic
1072009146 10:91288268-91288290 GAGGGAAAACAGAAGAAGAGAGG - Intergenic
1072292177 10:93974298-93974320 CAGGGAGCTCAGAAGAAGGTGGG + Intergenic
1072792984 10:98332229-98332251 GAGGGTACACACAAGATGCAGGG - Intergenic
1073087390 10:100901794-100901816 GGGGAAAGAAAGAAGAAGGAGGG + Intergenic
1073112602 10:101071578-101071600 AAGAGGACACAGAAGAAGGAAGG - Intergenic
1074129249 10:110558669-110558691 AAGGGAAGAAAAAAGAAGGAAGG + Intergenic
1074186899 10:111105610-111105632 GTGGGAATACAGATGATGGAGGG - Intergenic
1074311653 10:112327799-112327821 GAGGGAAGAGGGAGGAAGGAGGG + Intergenic
1074430040 10:113386689-113386711 GAGAGATCAAAGAAGCAGGAAGG - Intergenic
1074532055 10:114304973-114304995 GAGGGGACGCAGATGCAGGAGGG + Intronic
1074532067 10:114305009-114305031 GAGGGCACACAGATGCAGGAGGG + Intronic
1074532092 10:114305087-114305109 GAGGGGACGCAGATGCAGGAGGG + Intronic
1074532103 10:114305123-114305145 GAGGGGACGCAGATGCAGGAGGG + Intronic
1074532119 10:114305177-114305199 GAGGGGACGCAGATGAAGGAGGG + Intronic
1074532189 10:114305429-114305451 GAGGGGACGCAGATGCAGGAGGG + Intronic
1074532198 10:114305465-114305487 GAGGGGACGCAGATGCAGGAGGG + Intronic
1074532224 10:114305549-114305571 GAGGGGACACAGATGCAGGAGGG + Intronic
1074532324 10:114305906-114305928 GAGGGGACACAGGTGCAGGAGGG + Intronic
1074532351 10:114305995-114306017 GAGGGGACGCAGATGCAGGAGGG + Intronic
1074532355 10:114306013-114306035 GAGGGGACGCAGATGCAGGAGGG + Intronic
1074532358 10:114306031-114306053 GAGGGGACACAGATGCAGAAGGG + Intronic
1074731829 10:116386505-116386527 GAGGGAGGAAGGAAGAAGGAAGG - Intergenic
1074846127 10:117399630-117399652 AAGGGTGCACAGAAGAAAGATGG - Intergenic
1076533393 10:131160343-131160365 CTGGGAGCACAGAGGAAGGATGG - Intronic
1077163244 11:1123085-1123107 GAGGGAAGAGGGAGGAAGGAGGG - Intergenic
1077428395 11:2499017-2499039 GAGGGCACACAGAAGCAGGTGGG - Intronic
1077499021 11:2900775-2900797 GCGGGAACACAGATGAACCAAGG + Intronic
1077802544 11:5555430-5555452 GAAGGGAGAGAGAAGAAGGAAGG + Intronic
1078096788 11:8302440-8302462 GAGGGGAGAGAGAAGAAGAAAGG + Intergenic
1078257901 11:9675719-9675741 CAGGGAATGCAGGAGAAGGAAGG - Intronic
1078435117 11:11318325-11318347 GAGGTCACACAGAAGTAGAATGG + Intronic
1078526773 11:12107436-12107458 GAGAGAAAAAAGAAGAAGGAAGG - Intronic
1078577232 11:12512849-12512871 GAGGGCACAGAGAAGAGGGCTGG - Intronic
1079189386 11:18265137-18265159 GGAGGAAGAGAGAAGAAGGAAGG + Intergenic
1079424033 11:20323425-20323447 GAGGCAAAAAGGAAGAAGGAAGG - Intergenic
1079433681 11:20422860-20422882 CAGGGGACTCAGAAGAAGTAGGG + Intronic
1079848012 11:25494737-25494759 CATCCAACACAGAAGAAGGATGG + Intergenic
1079961674 11:26931930-26931952 TATGGGACATAGAAGAAGGAGGG + Intergenic
1079973292 11:27062252-27062274 TAGGCAACAGAGAAGAAGGAAGG + Intronic
1079991106 11:27248175-27248197 GATGGGAGAGAGAAGAAGGAAGG + Intergenic
1080000771 11:27346457-27346479 GAGGGAAGACAGAGGAAAGAAGG + Intronic
1080048932 11:27838586-27838608 GAGAAAAGAAAGAAGAAGGAAGG - Intergenic
1080050200 11:27851808-27851830 AAGGGAAGAAAGAAAAAGGAAGG - Intergenic
1080305554 11:30831106-30831128 GAGGGAGCTGAGAAGGAGGAGGG + Intronic
1080694983 11:34595649-34595671 GTGTACACACAGAAGAAGGAAGG - Intergenic
1080878935 11:36301322-36301344 GAGGGAACTCTGAGGCAGGACGG + Intronic
1080904295 11:36525037-36525059 AAGGGAAAAAAGAACAAGGAAGG - Intronic
1081338193 11:41894308-41894330 AAGGCACCAAAGAAGAAGGAGGG - Intergenic
1081409130 11:42735022-42735044 GAGGGAGGAGAGAAGGAGGAGGG + Intergenic
1081946835 11:47003357-47003379 GAGGGGACAGAGAGGAAGGAAGG + Intronic
1082628372 11:55511826-55511848 GAGAGAAGAAAGAAGCAGGAAGG - Intergenic
1082638726 11:55628705-55628727 GAGGGACCAGAGAACAAGGCTGG - Intergenic
1082718673 11:56646561-56646583 CAGGGGAGACAGAAGAAGGATGG - Intergenic
1082805642 11:57448005-57448027 GAAGGAAAAGAAAAGAAGGAAGG + Intergenic
1083269691 11:61565596-61565618 GAAGGAAAAAAGAATAAGGAAGG + Intronic
1083445502 11:62705788-62705810 GAGGGAACACAGTGGAGGAAAGG - Intronic
1084190417 11:67496121-67496143 GAGGGCACACACAGGAAGGGAGG - Intronic
1084350289 11:68592984-68593006 GAGGGAACACTGATGACAGAAGG + Intronic
1084406464 11:68976803-68976825 GAGGGAACCCAGAAGGCAGAGGG + Intergenic
1084528902 11:69715184-69715206 GAGGAAAGAAAGAGGAAGGAAGG + Intergenic
1084539589 11:69777468-69777490 GCGGGAACACAGGAGCAGAAAGG - Intergenic
1085069528 11:73530593-73530615 GAGGGAAAAGTGAAAAAGGAAGG - Intronic
1085284424 11:75350724-75350746 AAGGGAACAGAGTAGATGGATGG + Intronic
1085335414 11:75690042-75690064 GAAGGAAGAAGGAAGAAGGAAGG - Intergenic
1085364628 11:75928361-75928383 GATAGAACAGAGGAGAAGGACGG + Intronic
1085567147 11:77524550-77524572 CAGAGAACACAGAAGAGGGCAGG - Intronic
1086203570 11:84232643-84232665 GTGAGGACACAGCAGAAGGATGG + Intronic
1086540281 11:87900742-87900764 GAGGGAAGAAGGAAGATGGAGGG + Intergenic
1086571625 11:88291443-88291465 GAAGGAAGAAGGAAGAAGGAAGG + Intergenic
1086947798 11:92860466-92860488 GAGAGAAGGCAGGAGAAGGAGGG + Intronic
1087669578 11:101089694-101089716 GAGGAAGGAAAGAAGAAGGAAGG + Intronic
1087673159 11:101129112-101129134 GAGGGAAAAGGGAAGGAGGAGGG + Exonic
1087968822 11:104453902-104453924 GTGTGAACACAAAAGAATGAAGG - Intergenic
1088011006 11:105001068-105001090 GAGAGAACACAGGAGTTGGACGG - Intronic
1088191024 11:107228375-107228397 GAGGGAGTACAGGAGAAGCAGGG - Intergenic
1088250425 11:107857208-107857230 GAAGGAACAAAGAAGGAGGGAGG + Intronic
1088258699 11:107925246-107925268 GAGGGAAAAGAGATGAAGGAAGG + Intronic
1088394044 11:109347839-109347861 GAGGGAAAAGTAAAGAAGGAGGG - Intergenic
1088535128 11:110852235-110852257 GAGAGAGCACAGAAGGATGAAGG + Intergenic
1088575182 11:111264750-111264772 GAGGGAAGAGACAGGAAGGAAGG + Intronic
1088642206 11:111883746-111883768 GAGGGAAGAAAAAAAAAGGAAGG - Intronic
1088707361 11:112475885-112475907 GAGGGTAGACAGAAGAAGGTGGG - Intergenic
1088973860 11:114797374-114797396 GAGAGAAAATAGAAGAAGGTGGG - Intergenic
1089137902 11:116264141-116264163 GAGAGAACCCACAGGAAGGATGG + Intergenic
1089140536 11:116280507-116280529 GAGGGAACAGGTAAGAAGGATGG - Intergenic
1089220828 11:116870058-116870080 CAGGGGACAAGGAAGAAGGAGGG + Intronic
1089238707 11:117055519-117055541 GAGGGAACAGAAGAGAAGGTGGG + Intronic
1089343175 11:117773296-117773318 GCTGGAACACAGAAGGAGCAGGG - Intronic
1089445068 11:118545433-118545455 GAGGGAAAAGAGCAGATGGAGGG + Exonic
1089768144 11:120783444-120783466 GAGGAAACAGACAAGAGGGAAGG - Intronic
1090259597 11:125309187-125309209 GAAGGAAGAGAGAGGAAGGAAGG - Intronic
1090626844 11:128615560-128615582 TAGGGACCAGAGAAGCAGGAGGG + Intergenic
1090845132 11:130523871-130523893 GAGGAAACAGGGAAGAATGATGG - Intergenic
1090866027 11:130701504-130701526 GAGGGAACATAGAAAATTGAAGG - Intronic
1090879911 11:130824413-130824435 GAGAGGACACAGAAGAAGAGAGG - Intergenic
1091001976 11:131917487-131917509 GAGGTGACCCAGCAGAAGGAAGG - Intronic
1091305781 11:134535313-134535335 GAGGGACCACCGGAGAAGGAAGG - Intergenic
1091317587 11:134625328-134625350 GAGGGAGCAAAGAAGAGGGGTGG + Intergenic
1091375507 12:22481-22503 GAGAGAACAGGGGAGAAGGAAGG + Intergenic
1091501675 12:1023718-1023740 GAACGAACAAAGAAGGAGGAGGG + Intronic
1092227350 12:6756434-6756456 GAGGGAAAAGACAAGAGGGATGG - Intronic
1092288309 12:7142841-7142863 GTAGGAACACAGGAGCAGGACGG - Intronic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1092461146 12:8687417-8687439 AAGTGACCACAGAAGGAGGATGG - Intronic
1092585731 12:9899377-9899399 GAGAGAACAGAGGAGAAGAAAGG + Intronic
1092629031 12:10358826-10358848 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
1092741063 12:11630091-11630113 GATGGGGCACAGAAGCAGGAAGG - Intergenic
1093755275 12:22845547-22845569 GAGGAAAGAAGGAAGAAGGAAGG - Intergenic
1094039831 12:26111059-26111081 GGGGGAAAACAGGACAAGGAAGG + Intergenic
1094132330 12:27087520-27087542 GAAGGAAGAAAGAAAAAGGAAGG - Intergenic
1094210576 12:27885756-27885778 CTGGGAACAAAGAAGAAGGGTGG - Intergenic
1094234347 12:28146410-28146432 GAAGGAAGAAAGAGGAAGGAAGG + Intronic
1094234503 12:28148224-28148246 GAAGAAACACAGAAGAATGAAGG - Intronic
1095942448 12:47735904-47735926 GTGGGGACACAGGAGAAGCACGG - Intronic
1096275512 12:50204145-50204167 GAGGGAAGAAAGAAGAAGACTGG - Intronic
1096424460 12:51489518-51489540 GAGGAAACAAAGAAGAAAAAGGG - Intronic
1096443750 12:51669480-51669502 GAGGGAGACCAGAAGAAGGTGGG - Intronic
1096734117 12:53639534-53639556 GAGGGAAAGAAGAGGAAGGAAGG - Intronic
1096993294 12:55822190-55822212 GAGGTAAAACAGAAGAAATAAGG + Intronic
1097156366 12:57015132-57015154 GGGAGAAAAGAGAAGAAGGAAGG + Intronic
1098685004 12:73408792-73408814 GAGGGAGAAGAGAAGAAGAAAGG + Intergenic
1098833377 12:75390939-75390961 GAGGGAGGAGAGAAGAGGGAGGG - Intergenic
1099107809 12:78518769-78518791 GAGGGCAAACAGAAGCAGGGTGG + Intergenic
1099185728 12:79513882-79513904 GAGGGAAGGAAGAAGAGGGAAGG - Intergenic
1099239015 12:80116345-80116367 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1099393544 12:82110074-82110096 GAGAGAGGAGAGAAGAAGGAAGG + Intergenic
1099528085 12:83740826-83740848 GAGGGCAAACAGAAGAGGGTGGG + Intergenic
1099835160 12:87901213-87901235 GAGGAAACACAAAAGAAAAATGG + Intergenic
1100015831 12:90009904-90009926 GAAGGAACACAGAAGAGGCGAGG + Intergenic
1100123545 12:91396117-91396139 GAGAGAAGAATGAAGAAGGAAGG - Intergenic
1100742873 12:97614679-97614701 GAAGGAAGAAAGAAGAAGGAAGG - Intergenic
1101184388 12:102258969-102258991 AATGGAACACAGCAGAAGTAGGG - Intergenic
1101244282 12:102870729-102870751 GATGGAACACAGAAGACAAAAGG + Intronic
1101255563 12:102973651-102973673 GAAGGAAGAGAGAGGAAGGAGGG - Intergenic
1101748880 12:107566212-107566234 AAAGGAACACAGAGAAAGGAAGG - Intronic
1101828178 12:108236953-108236975 GAGGGGAGACAGAAGAGGGAAGG + Intronic
1103171700 12:118825889-118825911 AAGGAAAGAGAGAAGAAGGAAGG + Intergenic
1103366969 12:120390572-120390594 GAGGGAAGAGGGAAGAAGGAGGG + Intergenic
1103911772 12:124355921-124355943 GAGGGCACACAGCACAGGGAGGG - Intronic
1104121622 12:125805408-125805430 GTGATAACACAGAAGAGGGATGG + Intergenic
1105679962 13:22715975-22715997 GAAGGAAGAGAGAGGAAGGAAGG - Intergenic
1105887713 13:24656452-24656474 GAGGGGAGAGAGAGGAAGGAGGG - Intergenic
1106042063 13:26103094-26103116 GAGGGCAAGCAGAAGCAGGATGG + Intergenic
1106650781 13:31688057-31688079 GAGTGAGCACAGCAGATGGAGGG + Intergenic
1107072576 13:36286871-36286893 GAGGAAAGAGAAAAGAAGGAAGG - Intronic
1107126453 13:36851477-36851499 GCCAAAACACAGAAGAAGGATGG - Intronic
1107229569 13:38091831-38091853 AAGGGAAAACAGAGGAAGAAGGG + Intergenic
1107711347 13:43153300-43153322 GAGGGCACACAGAGATAGGAAGG - Intergenic
1108039463 13:46325762-46325784 CAAGAAACACAGTAGAAGGAAGG + Intergenic
1108481631 13:50878135-50878157 GAAGGAGCACAGAAGAGGAAGGG - Intergenic
1108552085 13:51556692-51556714 GTGGGAACCCCGAAGAGGGAGGG + Intergenic
1109295725 13:60528121-60528143 AAGGGACCACAGAAAAATGATGG - Intronic
1110168552 13:72472869-72472891 GAGGGAAGGAAGAGGAAGGAAGG + Intergenic
1112013391 13:95310931-95310953 GAAGTAAGACAGAAGAGGGAAGG - Intergenic
1112264804 13:97913590-97913612 GAGAGGACACAGGAGAAAGATGG - Intergenic
1112282166 13:98072743-98072765 GGAGGAACACTGCAGAAGGAAGG + Intergenic
1112343172 13:98568945-98568967 GAAAGAACACAGAAAATGGAAGG + Intronic
1112563922 13:100536315-100536337 AAGAGAACAGAGAGGAAGGAGGG - Intronic
1112940302 13:104854032-104854054 AAAGAAACACAGAAGAGGGAAGG + Intergenic
1113267389 13:108634482-108634504 GAGGGAAGAGAGAACAAGGGGGG - Intronic
1113680689 13:112242238-112242260 GAGGGAAGGAGGAAGAAGGAGGG + Intergenic
1114243180 14:20888149-20888171 GAGGACCCACACAAGAAGGAAGG + Intergenic
1114360407 14:21965942-21965964 GTGGTAACAAAGAAGATGGAAGG + Intergenic
1114367701 14:22047710-22047732 GAGGAAAGACAGAAGAAAGGAGG - Intergenic
1114590455 14:23860004-23860026 GAGGGAGCCCAGAAAATGGAGGG - Intergenic
1114787263 14:25615305-25615327 GAGGAAAAAAGGAAGAAGGAAGG - Intergenic
1114970878 14:28026974-28026996 GAAGGAAAACAGAAGAGAGAAGG + Intergenic
1115339001 14:32272570-32272592 GAGGGCACACAGAAACAGGGTGG + Intergenic
1115620119 14:35132841-35132863 GAAGGAAGAAGGAAGAAGGAAGG + Intronic
1116265808 14:42688098-42688120 GAGGGCTCAGAGAAGAAGGTAGG - Intergenic
1116381459 14:44274155-44274177 GAGGGAACACAAGAGAAGGTAGG + Intergenic
1116659614 14:47692222-47692244 GAGGGAGAACACAAGAAAGAGGG - Intergenic
1116805406 14:49489552-49489574 GAGGGAAGAAAGAGAAAGGAAGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1116984899 14:51208011-51208033 GAGGGAAAGGAGAAGAAGGGAGG - Intergenic
1117243169 14:53856047-53856069 AAGGAAAGAAAGAAGAAGGAAGG + Intergenic
1117481375 14:56148666-56148688 CAGAGAACACAGAAGAAAGGAGG - Intronic
1117794408 14:59377309-59377331 GAGGGAAGAAATAATAAGGAGGG + Intergenic
1117803630 14:59468348-59468370 GCAGGAACACAGAAAAAAGAAGG - Intronic
1118465095 14:66023653-66023675 GATGGAGGAGAGAAGAAGGAAGG - Intergenic
1118594215 14:67423493-67423515 GAGGGACCACAGGTGAGGGAGGG + Intergenic
1118652514 14:67912626-67912648 GTGAGAACACAGAGGAAGAAGGG + Intronic
1118820524 14:69342451-69342473 GAGGGAAGGTGGAAGAAGGAAGG + Intronic
1119902871 14:78276224-78276246 GAGGGAAAACAAAAGAAATAAGG + Intronic
1119959078 14:78834300-78834322 GTGGGCACAAAGAAGAAAGATGG + Intronic
1120162344 14:81159525-81159547 GTGGGAATACAGAAAAAGTATGG + Intergenic
1120648554 14:87102685-87102707 GAGGGAAAAAAGAAAAGGGAGGG - Intergenic
1120794161 14:88613648-88613670 AAGGGACCACAAAAAAAGGAAGG + Exonic
1120798712 14:88665712-88665734 GGGGGAAGAGAGAAGAGGGAAGG + Intronic
1120871383 14:89340082-89340104 GAGAGGAAAGAGAAGAAGGAAGG + Intronic
1121091783 14:91187986-91188008 CAGGGAAAACATAAGAGGGAAGG - Intronic
1121216527 14:92252815-92252837 GAGAGAAAACAGAAGAAGGAGGG + Intergenic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1121933768 14:97997534-97997556 GAGGAAACACAGCAGGAGAAAGG - Intergenic
1121991969 14:98567052-98567074 GAGGGATGAGAGAAGAAAGAAGG - Intergenic
1122171579 14:99880394-99880416 GTGGGAATACAGAGGAAGAAAGG - Intronic
1122276693 14:100594379-100594401 GCTGGAACACAGAAGAATGGCGG - Intergenic
1122409105 14:101517039-101517061 AAGGGGAAACAGAAGAAGGGAGG + Intergenic
1122679093 14:103443024-103443046 GAGAAAACACAGAAAAATGAGGG + Intronic
1122868400 14:104621368-104621390 GAAGGAAAAGAGAGGAAGGAAGG + Intergenic
1122895651 14:104755517-104755539 GAGGGCACACAGGAGGACGATGG + Intronic
1122917935 14:104867354-104867376 CAGGGAACACAGAGGCAGGGCGG - Intronic
1123161542 14:106282949-106282971 GAGGGGGCACAGAAGAGGGGAGG - Intergenic
1124059295 15:26274481-26274503 GAAAGAACACAAATGAAGGAAGG - Intergenic
1124168690 15:27352996-27353018 GAAGGAACACAGAAGTCGGGAGG - Intronic
1124577001 15:30918610-30918632 GAGGGAAGCCAGCAGCAGGACGG + Intronic
1124720039 15:32104016-32104038 GAGGCAACACTGAAGCAGGAAGG - Intronic
1125323923 15:38516696-38516718 GAAGGAACACACAAGCAGAATGG - Intronic
1125517710 15:40332001-40332023 GAGGGCACACAGGAGGAGGGAGG - Intronic
1126097152 15:45097825-45097847 GAGGGATGAGAGAGGAAGGAGGG - Intronic
1126145017 15:45465955-45465977 GAGGAACCACAGGAGAAAGACGG - Intergenic
1126171262 15:45697044-45697066 GAAGAAACAAAGAGGAAGGAAGG - Intergenic
1126222108 15:46226009-46226031 GAGGAAACAGAGGAAAAGGATGG + Intergenic
1126279588 15:46929245-46929267 GAGGGAGGAAGGAAGAAGGAAGG - Intergenic
1126802137 15:52308662-52308684 GAGGAAGTACAGGAGAAGGAGGG + Exonic
1127276007 15:57444753-57444775 GTGGGAACACAGAGCCAGGATGG + Intronic
1127280436 15:57486239-57486261 GACCTAACACAGAAGAAGCAGGG - Intronic
1127500877 15:59553269-59553291 GAGGGAACGGGGAAGAAGAAAGG - Intergenic
1127543919 15:59971761-59971783 GAGATAACAGAGAAGATGGAGGG + Intergenic
1127803171 15:62494923-62494945 CCGGGAACAGAGAAAAAGGAGGG - Intronic
1128396198 15:67228979-67229001 GAGGGGAGACAGTAGGAGGAGGG + Intronic
1129060322 15:72855910-72855932 GGGGGAACACTGAAGCAGGGAGG + Intergenic
1129872818 15:78951949-78951971 GAGGGAACAAAGAAATAGAAAGG + Intergenic
1129876450 15:78978789-78978811 CAGGGCACACAGAGGAGGGAGGG - Intronic
1129879680 15:78998515-78998537 GAGGGAACAAAGGACATGGAAGG - Intronic
1130096603 15:80860860-80860882 GAGGGAACACAGAAAGAGAAGGG - Intronic
1130397149 15:83512659-83512681 GAAGGAAGAGAGAAGGAGGAGGG - Intronic
1130503957 15:84519459-84519481 GAGGGAATAAAGAAAAAGAAAGG + Intergenic
1130768218 15:86895049-86895071 GAGGGAAGATAAAAGAAAGAAGG - Intronic
1130894574 15:88160171-88160193 TGGGGAACCCAGAGGAAGGAGGG + Intronic
1131038219 15:89239649-89239671 AAGGGAACACAGAAGCATCAGGG - Intergenic
1131780048 15:95846208-95846230 AAGGGAACAGAGGAGAAGGGAGG + Intergenic
1131846582 15:96495345-96495367 TAGGGCACAGAGAAGGAGGAGGG + Intergenic
1131852109 15:96554560-96554582 GAGGGAAGAAGAAAGAAGGAAGG - Intergenic
1132050554 15:98604590-98604612 GAGAGAAGGCAGCAGAAGGAGGG + Intergenic
1132592197 16:730962-730984 GAGGTGACACTGGAGAAGGAGGG - Exonic
1132936110 16:2482201-2482223 GAGGGAACAGAGAAGAAAACAGG - Intronic
1132945660 16:2530348-2530370 AAGGGGACACAGAAGATGGCAGG - Exonic
1133098662 16:3465650-3465672 GGGGTCACACAGAAGAAGGCAGG - Intronic
1133224226 16:4332971-4332993 AAGGGAACACTGAGGCAGGAAGG + Intronic
1133447411 16:5874000-5874022 GAAGGAACACAGAAGAACCAGGG + Intergenic
1133839831 16:9397641-9397663 GAGGGAATAGAGAAACAGGAAGG - Intergenic
1134075734 16:11290207-11290229 AAAGGAACACAGAAAAAGTAGGG + Intronic
1134459085 16:14416131-14416153 GAGGGAAGGAGGAAGAAGGAAGG + Intergenic
1134596298 16:15498681-15498703 GAGGAAAGAAAGAAAAAGGAAGG + Intronic
1135016369 16:18927381-18927403 GAGGGAAGAAAAAGGAAGGAAGG + Intergenic
1135200192 16:20430644-20430666 TAGGGAACAAAGAAGAAGGGAGG + Intronic
1135218498 16:20592965-20592987 TAGGGAACAAAGAAGAAGGGAGG - Intergenic
1135269439 16:21056362-21056384 GAGGGAGGAAAAAAGAAGGAAGG - Intronic
1135321993 16:21503207-21503229 GAGGGAAGAAAAAGGAAGGAAGG + Intergenic
1135728185 16:24873192-24873214 AAGGGAAAGGAGAAGAAGGAAGG + Intronic
1135967223 16:27046125-27046147 GAGGGAGCACAGGTTAAGGAAGG - Intergenic
1135976009 16:27109406-27109428 GAGGGAAAAGGGAAGAAGGCAGG + Intergenic
1135985769 16:27182848-27182870 GAGGGAAGGCAAGAGAAGGAGGG + Intergenic
1136333464 16:29596319-29596341 GAGGGAAGAAAAAGGAAGGAAGG + Intergenic
1136539116 16:30918804-30918826 GAAGGAAGAAAGAAGAAGGAAGG - Intergenic
1137362328 16:47829999-47830021 AGGAGAACACTGAAGAAGGATGG + Intergenic
1137421092 16:48334697-48334719 GAGGGCAAACAGCTGAAGGATGG - Intronic
1137800986 16:51262031-51262053 GAGGGAACAAGAATGAAGGAAGG - Intergenic
1138210292 16:55157570-55157592 GAAGGAAGAAAGAAGAAGGAAGG + Intergenic
1138210295 16:55157588-55157610 GAAGGAAAAAGGAAGAAGGAAGG + Intergenic
1138215504 16:55201550-55201572 GAGGGAGGAAGGAAGAAGGAAGG - Intergenic
1138250231 16:55496649-55496671 GAGGGAAAACACAATATGGATGG + Intronic
1138533887 16:57649559-57649581 GAGGGAACACAGAAAAAAGGGGG - Intronic
1138644214 16:58411550-58411572 GAGGGAAAGAAGAAAAAGGAAGG + Intergenic
1139630906 16:68231440-68231462 GGGGGAACACATAAATAGGAAGG - Intronic
1139760378 16:69180186-69180208 GAGGGAAGAGAGAGGAAGGGAGG - Intronic
1140045414 16:71437421-71437443 GAAGAAACAAAGAGGAAGGAAGG + Intergenic
1140212244 16:72979445-72979467 GATGGATCACAGAAGAACCAGGG + Intronic
1140257516 16:73349758-73349780 GAGGGAAAAAAGAGGGAGGAAGG - Intergenic
1140257522 16:73349785-73349807 GAGGGAAGAGGGAACAAGGAAGG - Intergenic
1140504557 16:75463569-75463591 GAGGGACCAGAGCAGAGGGAAGG - Intronic
1140512102 16:75516352-75516374 GAGGGACCAGAGCAGAGGGAAGG - Intergenic
1140857478 16:78990691-78990713 GAGGAAAGAAGGAAGAAGGAAGG + Intronic
1140964404 16:79950885-79950907 GAGGTAAAAGAGAAGAATGAGGG + Intergenic
1140967696 16:79983111-79983133 GAGGGAAGAGAGAGGGAGGAAGG - Intergenic
1141013648 16:80427039-80427061 GAGGGAACAGAGATGATAGAAGG - Intergenic
1141039473 16:80660558-80660580 GAGGGAACAGAGAACAAGAATGG + Intronic
1141120581 16:81352242-81352264 GAGGGAAGAGAGAATAAGGGTGG - Intronic
1141159216 16:81617916-81617938 CAGTGGACACAGAAGAGGGAGGG + Intronic
1141685339 16:85566824-85566846 CAGGGAACATAAAAGAAGGGAGG + Intergenic
1141734630 16:85844117-85844139 GAAGGAAGACGGAGGAAGGAAGG - Intergenic
1141884138 16:86880238-86880260 GAGGAAAAAGAGAAGAAGGGAGG + Intergenic
1143021316 17:3918299-3918321 GAGGGAGGAAAGAAGAAGGAGGG + Intergenic
1143421000 17:6792285-6792307 GAGGGAATGTAGGAGAAGGAGGG - Intronic
1143646207 17:8231955-8231977 GGGGGCACCCAGAGGAAGGAGGG - Exonic
1143748008 17:9007669-9007691 GAAGGAAGAAAGGAGAAGGAGGG - Intergenic
1143880988 17:10030119-10030141 GAAGGAACACAACAGAGGGAAGG + Intronic
1143974752 17:10821600-10821622 AGGGGAGGACAGAAGAAGGAGGG - Intergenic
1144053170 17:11515299-11515321 GAAGGAAGAAAGAAAAAGGAAGG + Intronic
1144580554 17:16456633-16456655 GAGGGAACACAGAGGGAGGCAGG + Intronic
1144665348 17:17098587-17098609 GAGGGAATCCAGGAGAAAGAAGG + Intronic
1145284867 17:21497929-21497951 GAGGGAGAACTGAAGAAGGGTGG + Intergenic
1146000942 17:29129958-29129980 GAGGAAAGCCAGAAGAGGGAGGG - Intronic
1146112174 17:30099927-30099949 GAGTGAATACAGAAAAAAGAGGG - Intronic
1146442754 17:32911330-32911352 GAGAGAACACAGAAAGAGGTGGG + Intergenic
1146604920 17:34249923-34249945 GAAGCAAGACACAAGAAGGAAGG - Intergenic
1146682409 17:34817599-34817621 GAGGGAACAAAGAGGAATGGAGG + Intergenic
1146745350 17:35323883-35323905 CAGGTCACACAGATGAAGGATGG + Intergenic
1146747676 17:35346483-35346505 GAGGGAAATCGGAAGAGGGAAGG - Intergenic
1146763252 17:35496487-35496509 GGGGGAAGTCGGAAGAAGGAAGG - Intronic
1146804973 17:35857820-35857842 AAGGGAACATAGAGGAAGGTAGG + Intronic
1146951865 17:36912556-36912578 AAGGCCACACAGATGAAGGAGGG - Intergenic
1147161303 17:38570967-38570989 GAGGGAGGACAGAGGATGGAGGG - Intronic
1147559873 17:41502155-41502177 GAGGGAACAGAGACCATGGAGGG - Intronic
1147862806 17:43533434-43533456 CAGGGATTACAGGAGAAGGAAGG + Intronic
1148363388 17:47032854-47032876 GAGGAACAACAGAAGAAGCAAGG - Intronic
1148458614 17:47824627-47824649 GAGGGAAGAGTGAAGAAGTAGGG - Intronic
1148588221 17:48796195-48796217 GAGGGCACAGAGAGGAAGCAGGG - Intronic
1148768411 17:50052885-50052907 TAGGGCACAGAGAAGAGGGAAGG + Intergenic
1148789050 17:50162964-50162986 GAGAGAAGGAAGAAGAAGGAGGG + Intergenic
1148789058 17:50162994-50163016 GAGAGAAGGAAGAAGAAGGAGGG + Intergenic
1149107114 17:52982680-52982702 GAGGGAAGAAGGAAGAAGGAAGG - Intergenic
1149268545 17:54953394-54953416 CAGGTTACACAGAAGAAGGGGGG - Intronic
1149397422 17:56259120-56259142 GAGGGAACAAAGATGCAGAAAGG + Intronic
1149416915 17:56469245-56469267 GAGGGGAGAGAGAAGAAGTAGGG - Intronic
1149471093 17:56915650-56915672 GGAGGAAGACAGAAGAATGAGGG + Intergenic
1150645689 17:66976317-66976339 GAGGAAAGACAGAGGGAGGAGGG - Intronic
1150827095 17:68486584-68486606 GAAGGAAAGCAGAAGAAGGAAGG - Intergenic
1150947605 17:69765380-69765402 AGGGGAGCACAGAGGAAGGAGGG - Intergenic
1150976909 17:70097781-70097803 GAAGGAGCAGAGTAGAAGGATGG - Intronic
1151052641 17:70995863-70995885 GAGGGAAGATGGAAGAAGGAAGG - Intergenic
1151377928 17:73704136-73704158 GAAGGAAGAGAGAGGAAGGATGG - Intergenic
1151382372 17:73734742-73734764 GTGGGAACAGAGCAGAGGGAGGG - Intergenic
1151418320 17:73981246-73981268 TAAGAAACACAGAAGGAGGAAGG + Intergenic
1151466570 17:74289561-74289583 GAGGGAAGAGAGCAGAAGGCTGG - Intronic
1151572672 17:74935129-74935151 GAGGGAAGACAGCAGAGAGATGG + Intergenic
1151772790 17:76176372-76176394 GAGATAACAGAGAAGATGGAGGG + Intronic
1151867826 17:76816069-76816091 GAAGGAAGACAGAAAAAGAAAGG + Intergenic
1151996278 17:77611356-77611378 TTGGGACCACAGAAAAAGGATGG - Intergenic
1152022468 17:77787737-77787759 AAGGGCACACAGAAGAGAGAGGG + Intergenic
1152187077 17:78864266-78864288 GAGGGAGGGAAGAAGAAGGAAGG - Intronic
1152417190 17:80170372-80170394 GATGAAAGACAGCAGAAGGAAGG + Intronic
1152573408 17:81130212-81130234 CTGGGAACACAGAGGCAGGAGGG - Intronic
1152913082 17:83016625-83016647 GAGGAGGGACAGAAGAAGGAGGG + Intronic
1153299161 18:3577599-3577621 GAGGAGACAGAAAAGAAGGAGGG + Intronic
1153315485 18:3717342-3717364 GAGGGAACAGGAAAGAAGGGTGG + Intronic
1153568203 18:6441863-6441885 AAGGAAAGAAAGAAGAAGGAAGG - Intergenic
1153711866 18:7808294-7808316 GAGGGCACAGAGGAGAAGCAGGG + Intronic
1153728188 18:7979769-7979791 GAGCGGACACAGGAGAAGGCTGG + Intronic
1154081012 18:11256876-11256898 GAGGGAACAAATCAGAAGGAAGG + Intergenic
1154092404 18:11378098-11378120 GAGGGCAAAGAGGAGAAGGAGGG + Intergenic
1154951208 18:21211662-21211684 GAGGAAAGAAAGAGGAAGGAAGG + Intergenic
1155064612 18:22257663-22257685 GAGGACCCAGAGAAGAAGGATGG + Intergenic
1155396285 18:25390087-25390109 GAGGAAACATAGAAAAAGAATGG + Intergenic
1155692588 18:28644084-28644106 AAAGGAAGAAAGAAGAAGGAAGG + Intergenic
1155857432 18:30850569-30850591 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1156198737 18:34806366-34806388 GAGGGGACATAGAGGAATGAGGG - Intronic
1156354843 18:36332061-36332083 AAGGGAACACTGCAGGAGGAAGG - Intronic
1156738363 18:40292276-40292298 GAGGGAACAAAAAAAAAGGTGGG - Intergenic
1156787313 18:40931362-40931384 GAGGTAAGGCAGAAGAAGGGAGG - Intergenic
1156825414 18:41424972-41424994 GAGGAATCACAAAAGAAGCATGG - Intergenic
1156908683 18:42385064-42385086 GAGGGAAGAAAGAGGAAGGAAGG - Intergenic
1157005406 18:43577443-43577465 GAGGGAAAGAAGGAGAAGGAGGG - Intergenic
1157319749 18:46624812-46624834 GAGAAAAGACAGAAGAAGAAAGG - Intronic
1157422303 18:47557303-47557325 CAGGGAACACAGGATAAGGTGGG - Intergenic
1157436232 18:47671802-47671824 GAGGGCACTCAGAATGAGGATGG + Intergenic
1157557946 18:48625091-48625113 GAGGGAACAGTGAACAGGGAAGG - Intronic
1157690481 18:49677962-49677984 GAATGAAAACAGAAGCAGGAAGG - Intergenic
1158153873 18:54403558-54403580 AATGGAAAACAGAAAAAGGAAGG - Intergenic
1158346624 18:56522829-56522851 AAGGGAGGACAGAAGAAGGAAGG - Intergenic
1158367696 18:56757172-56757194 ATGGGAAAACAGAAGTAGGAAGG + Exonic
1158519757 18:58162140-58162162 GAGGGAACAGGGCAGAAGGAGGG - Intronic
1159245688 18:65801648-65801670 GCGATAACACAGAACAAGGAGGG - Intronic
1159477106 18:68935819-68935841 GAGGGAAGGGAGAAGAGGGAAGG + Intronic
1159754742 18:72350530-72350552 GAGGGGAGAAAGAAAAAGGATGG + Intergenic
1159847825 18:73486976-73486998 GAAGGAAGAAAAAAGAAGGAAGG - Intergenic
1160064817 18:75564837-75564859 AAGAGAACACAGAAGAAACAAGG - Intergenic
1160331623 18:77998081-77998103 GAGGCGACACAGAAGGAAGAAGG + Intergenic
1160667711 19:340852-340874 GAGGGCAAACAGAAGACAGAGGG + Intronic
1160854393 19:1209855-1209877 GAGGGAACACGGAGGCAGGGAGG + Intronic
1160899200 19:1418705-1418727 GAGAGAACACGGCCGAAGGAAGG + Exonic
1161377518 19:3947525-3947547 GAGAGAAAAGAGAGGAAGGAAGG - Intergenic
1161405493 19:4089171-4089193 GAGGAAACAAAGCAGAAGGTGGG - Intergenic
1161610932 19:5242228-5242250 GAGTTAACAGAGAAGAGGGAAGG + Intronic
1161631072 19:5355839-5355861 GAGGAAAGAAAGAGGAAGGATGG - Intergenic
1161756619 19:6138587-6138609 GAGGGAAGAGAGAGGGAGGAAGG + Intronic
1161899874 19:7110403-7110425 GAGGGAAAAGAGATGAAGGCAGG - Intergenic
1161918769 19:7250552-7250574 GAGGAAATAAAGAAAAAGGAAGG + Intronic
1162075973 19:8187629-8187651 GAAGGAAGACAGAGAAAGGAAGG + Intronic
1162153459 19:8661127-8661149 AAGGGAAAAAGGAAGAAGGAAGG - Intergenic
1162228249 19:9242844-9242866 GAGGGAAGAAAGAAGAGGAAAGG - Intergenic
1162467138 19:10849075-10849097 GAGGGAGGGCAGGAGAAGGAAGG - Intronic
1163189771 19:15669246-15669268 CAGGGACAAAAGAAGAAGGAAGG + Intergenic
1163548541 19:17952680-17952702 GAGGGGACAGAGAGGGAGGAGGG - Intronic
1163728659 19:18937339-18937361 GAGGGAAAAAAAAAGAAGAAAGG + Intronic
1164667546 19:30051523-30051545 GAGGAAACAGAAAAGGAGGAGGG - Intergenic
1164855453 19:31517372-31517394 GTGGGAAGAAGGAAGAAGGAGGG + Intergenic
1164932940 19:32189140-32189162 GAAGGAAGAAGGAAGAAGGAAGG + Intergenic
1164975640 19:32570989-32571011 GAGGAAACAAGGAAGGAGGAAGG - Intergenic
1165798977 19:38536201-38536223 GGGGGACCACAGCAGAGGGAGGG - Intronic
1165844277 19:38808296-38808318 GAGAGAACAGAGAAAGAGGAAGG + Intronic
1166690954 19:44821006-44821028 GAGGGAAGAGGGAAGAGGGAAGG - Exonic
1166935490 19:46329995-46330017 GAGTGAAGAGAGAGGAAGGAAGG + Intronic
1166935495 19:46330018-46330040 GAGGAAGGAAAGAAGAAGGAAGG + Intronic
1167123390 19:47532468-47532490 GAAGGAAAACAGAGGAAGGGAGG - Intronic
1167195093 19:48023081-48023103 GAAGGAAGAAAGATGAAGGAAGG + Intronic
1167223666 19:48221032-48221054 GAGGGAAAAAAGAAAGAGGAAGG + Intronic
1168087660 19:54060265-54060287 AACAGAACACAGAAGAGGGAGGG - Intronic
1168491660 19:56815958-56815980 GAGGGAACACCTCTGAAGGAAGG - Exonic
924961494 2:38708-38730 GAGAGAACACTCAAGAAGAAAGG + Intergenic
925366331 2:3314636-3314658 GAGGGGACACAAGAGAGGGACGG - Intronic
925846146 2:8035294-8035316 GAAGGAAAAAAGGAGAAGGAGGG + Intergenic
925911181 2:8574572-8574594 TCAGGGACACAGAAGAAGGAGGG + Intergenic
926622983 2:15063988-15064010 GCTGGGACACAGAAGAAAGAGGG + Intergenic
926757549 2:16248554-16248576 CAGGGAACCCAAAAGCAGGAAGG + Intergenic
926935388 2:18082618-18082640 CAGGGAACAAGGAACAAGGAAGG - Intronic
926957831 2:18320966-18320988 GAGAGAACACAAAAGAAGCATGG - Intronic
927275346 2:21257771-21257793 AAGGGAGGACAGAAAAAGGAAGG - Intergenic
927514759 2:23665709-23665731 GAGGGCAGACAGAAGAGAGAGGG + Intronic
927553530 2:24017776-24017798 GAAGGAACCCAGAAGGAGGCAGG - Intronic
928070348 2:28208895-28208917 CAAGGAACAAAGAAGAAAGACGG - Intronic
928169824 2:28996074-28996096 GTGGGAACACAGGAGAGGGAGGG + Intronic
928249290 2:29660615-29660637 GAGGGAAACCAGGAGAAGGTGGG + Intronic
928254152 2:29707430-29707452 CAGGGAAAACAGAACAAGGGAGG + Intronic
928692638 2:33816737-33816759 GAGGGAAAAAAAAGGAAGGAAGG - Intergenic
929120581 2:38480857-38480879 AAGGCACCACAGAAGAAGGGTGG + Intergenic
929456746 2:42071587-42071609 GAATGAACAGAGAAGAAGAAAGG - Intergenic
929861260 2:45679790-45679812 GAGGGAACACAGAAGAAGGAAGG - Intronic
930023320 2:47014493-47014515 GCAGGAACCCAGCAGAAGGATGG - Intronic
930175437 2:48296634-48296656 GAGGGACCAGAGAAGAGGTATGG + Intergenic
930480011 2:51936196-51936218 GAAGGAACACTAAGGAAGGAAGG + Intergenic
930519342 2:52444407-52444429 GTGGGAACACTGAGGCAGGAGGG - Intergenic
930860422 2:56065844-56065866 GAGGGAAAACAGAAGCAGAGTGG - Intergenic
930975001 2:57446791-57446813 GAGGGAAAGCAGAGGAAAGAGGG + Intergenic
930982835 2:57548117-57548139 AAGGGAAAAAAGAGGAAGGAAGG + Intergenic
930990698 2:57650609-57650631 GATGGACCACTGAAGCAGGAGGG + Intergenic
931105877 2:59055054-59055076 GAAGGAAGAAGGAAGAAGGAAGG - Intergenic
931679002 2:64727524-64727546 GAGGGAATACTGGAGCAGGATGG + Intronic
931812900 2:65872382-65872404 AAGGGGACAAAGAGGAAGGAGGG + Intergenic
932486804 2:72089131-72089153 AAGGGAACAAGGAAGAAGAAAGG + Intergenic
933114599 2:78452422-78452444 GAGGAACCACAGTAGAGGGAAGG - Intergenic
935337372 2:102029192-102029214 GAGGGGACAGAGAGGAAGGAAGG - Intergenic
935338900 2:102042331-102042353 GAAGGAAAAAGGAAGAAGGAAGG + Intergenic
935389174 2:102532433-102532455 GAGCCTACACAGAGGAAGGAAGG + Exonic
935403475 2:102684255-102684277 GAGGAAACACAGCAGCAGGAAGG - Exonic
935921042 2:108015436-108015458 AAGAGAATACAGTAGAAGGATGG + Intergenic
936026259 2:109033322-109033344 GAGGGCACACTCAAAAAGGAGGG - Intergenic
936263604 2:110982430-110982452 AAGGGATGACAGAAGAAGAAGGG - Intronic
936499860 2:113058684-113058706 CAGGAAAGACAGAGGAAGGAAGG + Intronic
937108340 2:119340269-119340291 GTGGAAACAGAGAAGCAGGACGG + Exonic
937242220 2:120469567-120469589 GAAGGAAAAGGGAAGAAGGAAGG + Intergenic
937356668 2:121202178-121202200 GAGGAAGCAGAGGAGAAGGAAGG - Intergenic
937489406 2:122350113-122350135 AATGGAAAACAGAAGAAGGCAGG - Intergenic
937721465 2:125101757-125101779 GAGGTTACAGAGAAGAAGGATGG - Intergenic
938043435 2:128095444-128095466 GAGGAAAGAAAGAAGAAAGAAGG - Intronic
938081187 2:128371034-128371056 GAGGGACCAGAGAAGGAGGACGG - Intergenic
938261148 2:129895891-129895913 CAGGGCACACAGAGGAAGGAAGG + Intergenic
939015117 2:136893682-136893704 TAAGGTACACAGAAGAAGGTGGG - Intronic
939094246 2:137815405-137815427 TAGGGAACACAGAAAAATTAAGG - Intergenic
939141787 2:138362624-138362646 AACGGTAGACAGAAGAAGGAGGG + Intergenic
939329988 2:140745622-140745644 GATGGAACACAAAAACAGGAGGG - Intronic
939637102 2:144595412-144595434 GAGGAAACAGAGATGAAGGAAGG - Intergenic
939865816 2:147471300-147471322 AAGGGAACACACAGGAAGCAAGG + Intergenic
940272526 2:151907168-151907190 TAGGGAAAACAGAACAAGCAAGG + Intronic
940492799 2:154386287-154386309 GTGGGAAAACAGAATAAGGGAGG + Intronic
940660857 2:156543585-156543607 CTGGAAACACAGAAGAGGGAAGG + Intronic
940867302 2:158830023-158830045 AGGGAAACACAGCAGAAGGAGGG + Intronic
940876765 2:158905705-158905727 GAAGGAAAACAGAAACAGGAAGG + Intergenic
941404026 2:165066689-165066711 TAGAGAAAACAGAAAAAGGAAGG + Intergenic
941724457 2:168845967-168845989 GAGAGAACTCAGAGGAAGGTGGG - Intronic
942409898 2:175697975-175697997 GAAGGAAGATGGAAGAAGGAAGG + Intergenic
942458951 2:176156640-176156662 GAGGGGGCGCGGAAGAAGGAGGG - Intronic
942543023 2:177034460-177034482 GAGGGAAGAGAGAAGACGGAAGG + Intergenic
943506404 2:188765435-188765457 GAAGGAAGACACAGGAAGGAAGG - Intronic
943668451 2:190635071-190635093 AAGGGATCACAGAACAAGAAAGG - Intergenic
943699075 2:190970626-190970648 GAAGGAACAGAGTAGCAGGAGGG + Exonic
943794321 2:191972535-191972557 AAGGGGACACAGAGGAAGCAGGG + Intronic
943807370 2:192138688-192138710 GATTGAAGACAGAACAAGGAAGG + Intronic
944374533 2:199026576-199026598 CCCTGAACACAGAAGAAGGAGGG - Intergenic
944483639 2:200181344-200181366 GAGGGAAAATAGAAGCAGGCAGG - Intergenic
945014715 2:205503025-205503047 GAGGGAAGAGAGAAGAGAGAGGG - Intronic
945482287 2:210357986-210358008 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
945965751 2:216184881-216184903 CAGGGCATACAGAAGAAGGGAGG - Intronic
945991683 2:216400838-216400860 CAGGGAATACAGAATCAGGAAGG - Intergenic
946204335 2:218092623-218092645 GAGTCACCACTGAAGAAGGACGG - Intergenic
946357270 2:219195787-219195809 GAGGGAAAACAAAAGAAGCCAGG + Intronic
946566762 2:220974126-220974148 GAAAGAAAACAAAAGAAGGAGGG + Intergenic
946858316 2:223975676-223975698 GAGGGAAAAAACAAGCAGGATGG - Exonic
946907578 2:224431187-224431209 GAGAAAATGCAGAAGAAGGAAGG + Intergenic
947219354 2:227777930-227777952 GAGGGAAGAGAAAAGAAGGAAGG - Intergenic
947248341 2:228074976-228074998 GAGGAAAAAGAGAAGGAGGAAGG + Intronic
947319369 2:228898873-228898895 GAGGCAACACAGAGGAAAGAAGG - Intronic
947473752 2:230422714-230422736 GAAGGAACACAGATGAATGCAGG + Intronic
947511014 2:230754403-230754425 GAGGGAAAGGGGAAGAAGGAGGG - Intronic
947511027 2:230754439-230754461 GAGGGAAAGGGGAAGAAGGAGGG - Intronic
947575325 2:231269279-231269301 GAGAGAACACAGAAAACAGAGGG - Intronic
947603327 2:231467989-231468011 GAAGGAAGACAGAAGGAGGCTGG - Intronic
947734293 2:232446734-232446756 CAGGGGACACAGAAGAGGGCAGG - Intergenic
948147439 2:235718477-235718499 GATGGTACACAGAACAAGGAGGG - Intronic
948738647 2:240027454-240027476 GAGGGAAAACGGAAAAAGGGGGG - Intergenic
948784637 2:240346043-240346065 GAGGGTCGATAGAAGAAGGAAGG - Intergenic
948790527 2:240374339-240374361 AAGGGACCAGAGAAGGAGGATGG + Intergenic
1169061392 20:2663116-2663138 GAAGAAACAAAGAGGAAGGAAGG + Intronic
1169254545 20:4086787-4086809 GATGGAACACAAGAGAGGGAAGG - Intergenic
1169260497 20:4134829-4134851 GAGGGAGAACTGAAGGAGGAGGG + Intronic
1169984189 20:11423418-11423440 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1170322004 20:15110474-15110496 GATGAAAGACAGAAGCAGGAAGG + Intronic
1170442460 20:16392450-16392472 GAGGGAACAGAGAACAGAGAAGG + Intronic
1171151960 20:22835133-22835155 GAGGAAGGAAAGAAGAAGGAAGG - Intergenic
1171370926 20:24661497-24661519 GAGGGAAGAGGGAGGAAGGAGGG + Intronic
1171376965 20:24700299-24700321 GGGGGAACAAACAGGAAGGAGGG - Intergenic
1172060129 20:32181758-32181780 GATGGAACTAACAAGAAGGATGG + Intergenic
1172393097 20:34579756-34579778 GGAGGCACAAAGAAGAAGGATGG - Intronic
1172406588 20:34694330-34694352 GAGGAAACACACAATAATGATGG + Intergenic
1172833300 20:37855333-37855355 GTGGGAACCCAGAAGAAGGCTGG - Intronic
1172974507 20:38895952-38895974 GAGGGAAGAAAGAAGAAAGGAGG - Intronic
1173428670 20:42966387-42966409 GAGGGAACACAGAGGAAAGAGGG - Intronic
1173454384 20:43190967-43190989 GTGCTGACACAGAAGAAGGAGGG - Intergenic
1174018914 20:47513229-47513251 GGGGGAACCCAGAAGTAGAATGG - Intronic
1174102359 20:48137407-48137429 CTGGGACCACAGAGGAAGGAGGG - Intergenic
1174166093 20:48584539-48584561 AAGGGGACGTAGAAGAAGGAAGG - Intergenic
1174359330 20:50018036-50018058 GAAGGAAGAGAGAGGAAGGAAGG - Intergenic
1174447567 20:50601079-50601101 GAGGGAACACAGAGCAGGAAGGG + Intronic
1174809841 20:53636287-53636309 GAGAGAGGAAAGAAGAAGGAAGG + Intergenic
1175281480 20:57806866-57806888 GAGGGACCACAGCAGAGGGGAGG - Intergenic
1175293657 20:57894595-57894617 GAGGGAACAAGAAAGGAGGAAGG + Intergenic
1175293716 20:57894798-57894820 GAAGGAGGAAAGAAGAAGGAGGG + Intergenic
1175531123 20:59674754-59674776 GAGGGGGAACAGGAGAAGGAGGG - Intronic
1175778872 20:61669564-61669586 GAAGGAAAACTGAAGAAGGGTGG + Intronic
1176221420 20:63970845-63970867 GAGGGAAGAGAAGAGAAGGAAGG - Intronic
1176891697 21:14327002-14327024 GAGGGCACGCAGAAGCAGGGTGG + Intergenic
1176901065 21:14442824-14442846 AATGGAAAACATAAGAAGGAAGG + Intergenic
1177298010 21:19202269-19202291 AATGGAACAGAGAAGAAGGTAGG + Intergenic
1177308485 21:19353339-19353361 GAAGCAAGACAGAAAAAGGAAGG + Intergenic
1177700532 21:24633726-24633748 TAGGGCACATGGAAGAAGGAGGG + Intergenic
1177803751 21:25854021-25854043 GAAGGAAGACAGAAGCAGCAGGG + Intergenic
1178450344 21:32692642-32692664 GAAAGCACACAGGAGAAGGAAGG + Intronic
1178505271 21:33157458-33157480 GAGAGAAGAGAGAGGAAGGAAGG - Intergenic
1178851935 21:36219856-36219878 GAGAGAACAGAGAAAATGGAGGG + Intronic
1178882944 21:36463024-36463046 GGGGGAGCACAGAGAAAGGAAGG + Intronic
1178919351 21:36728503-36728525 GAGTGAACAGAAAAGAAGGCTGG + Intronic
1179311080 21:40196649-40196671 GAGGGGAAAGTGAAGAAGGAAGG - Intronic
1179769836 21:43606309-43606331 GTAGGAACAGAGAAGAAGGATGG + Intronic
1179782468 21:43710617-43710639 GAGAGAAAACAAAGGAAGGAAGG + Intergenic
1180172055 21:46064760-46064782 GAGGGAGGAGGGAAGAAGGAAGG + Intergenic
1180729280 22:17969535-17969557 CAGGGAAGAAGGAAGAAGGAAGG - Intronic
1181710345 22:24681291-24681313 GAAGGAACACAGCACAAGAAAGG - Intergenic
1181885291 22:26017181-26017203 GAAGGAAGAAAGAAAAAGGAAGG - Intronic
1182033165 22:27176067-27176089 AAGGGAAAAAAGCAGAAGGAAGG + Intergenic
1182043655 22:27257952-27257974 GAATGAAGACAGGAGAAGGAGGG - Intergenic
1182647320 22:31820821-31820843 CAGGGAACCCTGATGAAGGAGGG - Intronic
1182825697 22:33262847-33262869 GAGGGAAGAAAGAAAAAGAAAGG - Intronic
1182869346 22:33632589-33632611 GAGGCAACACAGAGGCAGGAAGG - Intronic
1183085378 22:35483693-35483715 GAGGGAAGAAAGAGGGAGGAAGG + Intergenic
1183210065 22:36445632-36445654 GAGGGAGGAAAGAGGAAGGAAGG + Intergenic
1183404842 22:37625295-37625317 GAGGACAGGCAGAAGAAGGAAGG + Intronic
1183410156 22:37650286-37650308 GAGGGAGCAGGGCAGAAGGAGGG - Intronic
1183487393 22:38096932-38096954 GAGGGAAGAGGGAAGAAGGGAGG + Intronic
1184120548 22:42447002-42447024 GAGGAGACACAGAGGAAAGAGGG + Intergenic
1184138245 22:42562028-42562050 GAGGGAACAGGCAAGAGGGAGGG + Intronic
1184946979 22:47810780-47810802 GAGGGAAAAGGGAAGCAGGAGGG - Intergenic
1185006820 22:48282870-48282892 GAGGGAAAAAAGAAGGAGGGAGG + Intergenic
949131686 3:509940-509962 AAGGGAAAACAGAAAAAGCAGGG - Intergenic
950956879 3:17063285-17063307 GAGGGAATGAAGAAGAAGAAAGG - Intronic
951035161 3:17925046-17925068 AAGGAAAGAAAGAAGAAGGAAGG + Intronic
951412265 3:22379493-22379515 GAGGGGAGAGGGAAGAAGGAAGG + Intergenic
951873483 3:27393844-27393866 GATGGAAGACAGAATGAGGATGG + Intronic
952084281 3:29798361-29798383 GAGGGAATGGAGAGGAAGGAGGG + Intronic
952132002 3:30374684-30374706 GAGGGAACACAGGAGTGGCAGGG + Intergenic
952766543 3:36959104-36959126 GAAGGAATACACATGAAGGAGGG - Intergenic
952937787 3:38413648-38413670 GAGGGAGGAGAGATGAAGGAGGG - Exonic
953102438 3:39842755-39842777 GAGGGCAGACAGAAGCAGGGGGG - Intronic
953119168 3:40023058-40023080 GGGGGAATATAGAACAAGGAAGG + Intronic
953135585 3:40178978-40179000 TAGGGTACACAGAAGACGCAGGG - Intronic
954390553 3:50266053-50266075 GAGTGAACACAGGTGGAGGAAGG + Intergenic
954461620 3:50630091-50630113 GAGGGAACTCACAAGAAAGGAGG - Intronic
954937396 3:54339155-54339177 GAGGGAACTCAGCAGAAGAGGGG - Intronic
955004308 3:54954801-54954823 GAGGGAACAGAGAAGAGCCAGGG + Intronic
955244807 3:57214890-57214912 AAGGGAATATAGATGAAGGAGGG + Intronic
955307476 3:57848678-57848700 GGAGGAAGAAAGAAGAAGGAAGG - Intronic
955483576 3:59413679-59413701 GAGGGAAAAGAAAAGAAGGGAGG - Intergenic
955613305 3:60780234-60780256 GAGAGAACAGAGGAGAAGAAAGG - Intronic
956403845 3:68907569-68907591 GAGGGAACACAGATGCAGACTGG - Intronic
956734617 3:72228613-72228635 TAGAGAACAGGGAAGAAGGAAGG + Intergenic
956932781 3:74064402-74064424 GAGGGGAGACAGAGAAAGGAGGG + Intergenic
956972051 3:74537640-74537662 TAGGGAAGGCAGAGGAAGGATGG + Intergenic
957146591 3:76432834-76432856 GAGAGAAAAAAGAGGAAGGAAGG + Intronic
957535558 3:81498240-81498262 GTGGGAAAACAGTAGAAAGATGG + Intronic
957612289 3:82483743-82483765 GAGAGAACAGAGAAAAAGGTAGG + Intergenic
958761060 3:98309125-98309147 GAGTGATCAAAGAAGCAGGAGGG - Intergenic
958868749 3:99532416-99532438 GAAGGAGCACGGAAGAAGGGAGG - Intergenic
959057174 3:101578909-101578931 GCGGTAAGACAGAAGAAGGCTGG - Intronic
959256833 3:104025797-104025819 GGGGGAAAGAAGAAGAAGGAAGG + Intergenic
960822865 3:121752891-121752913 GGGGGGAAAAAGAAGAAGGAAGG + Intergenic
960869040 3:122230831-122230853 GAGGGGACAGAGAAGTAGAAGGG - Intronic
960948642 3:122984126-122984148 GAAGGAGAAGAGAAGAAGGAAGG - Intronic
961347723 3:126274882-126274904 GAGGGAAGAAAGAGGGAGGAAGG - Intergenic
961943371 3:130659879-130659901 GAGGGAAGACAGAAAGAAGAGGG - Intronic
962432616 3:135333858-135333880 GAGAGAACAGAGAAAATGGAAGG - Intergenic
963667222 3:148203490-148203512 GAGGGAACACATCTGTAGGAAGG + Intergenic
963949178 3:151179702-151179724 AAAGGAACACAGGAAAAGGAAGG - Intronic
964444769 3:156747522-156747544 GAGGGGTCACAGCAGAGGGACGG - Intergenic
964554709 3:157923949-157923971 GAGGGTAGACAGTAGAAGGAGGG - Intergenic
964673688 3:159254734-159254756 GAGGTAACACTGATAAAGGAAGG - Intronic
964779299 3:160317688-160317710 AAGGAAACACAGAAGATAGAGGG + Intronic
965117368 3:164508486-164508508 GAGAGAAAACAGAAGAAAGAAGG - Intergenic
965602377 3:170467984-170468006 GAGAGCACACAGAAGAAAGCAGG - Intronic
965611359 3:170547131-170547153 GAGGAAAAGGAGAAGAAGGAAGG - Intronic
965798936 3:172471247-172471269 CAGGGATCACAGATGAAGGACGG + Intergenic
965910788 3:173772788-173772810 CAGTGAATACAGAAAAAGGATGG - Intronic
966210918 3:177452482-177452504 GAGAGAAAAAAGAGGAAGGAAGG - Intergenic
966285494 3:178290258-178290280 GAGGGAAAAAATAAAAAGGATGG + Intergenic
966774731 3:183533839-183533861 GAGGGAAAAGAGAAGAGGGGAGG - Intronic
967643204 3:191893459-191893481 GGAGGAAAAGAGAAGAAGGATGG - Intergenic
967656864 3:192060890-192060912 GAGGAAATACAGGAGAAGGAAGG + Intergenic
967826573 3:193882079-193882101 CCGGGAACAAAGGAGAAGGATGG - Intergenic
967827820 3:193892886-193892908 GAGGGAACCCAGTAGAAAAATGG - Intergenic
968282445 3:197487273-197487295 GAGGGTACAGGGAAGCAGGAGGG + Intergenic
968789162 4:2647571-2647593 GGTGGAAGACAGAAGAGGGAGGG + Intronic
969165882 4:5312014-5312036 GAGAGAAGAATGAAGAAGGATGG - Intronic
969481278 4:7448394-7448416 GAGGGAATGAAGAGGAAGGAAGG - Intronic
969820473 4:9716369-9716391 GAGGGAACAAAGATGAGGGAGGG - Intergenic
970027445 4:11638685-11638707 GAGGGCACATAGAAGAAGTGTGG - Intergenic
970320191 4:14867855-14867877 GAGGGAGCACAGTAGGAGGGAGG - Intergenic
970548373 4:17153513-17153535 GAGAGAACACAGGAAAAGGCAGG + Intergenic
970607313 4:17692716-17692738 GAGGGAGGACAGGGGAAGGAAGG + Intronic
970724227 4:19025025-19025047 GAGGGAACCCAGAAGTAGACTGG + Intergenic
970801010 4:19973742-19973764 GAGGGATGAGAGATGAAGGAAGG + Intergenic
970815377 4:20150094-20150116 GTGGGGACACAAAAGGAGGAAGG - Intergenic
970897878 4:21124508-21124530 GAGGGCAGACAGAGCAAGGAAGG - Intronic
971336448 4:25727906-25727928 GAGGGCCCACAGAATCAGGAAGG - Intergenic
971420251 4:26467893-26467915 GAGGGGAAGAAGAAGAAGGAGGG + Intergenic
971834457 4:31744702-31744724 GAGGAAACAAGGAAGAAGGGAGG + Intergenic
971961031 4:33487300-33487322 GAGGGAAAAGAGAAGAATGAGGG + Intergenic
973031135 4:45341666-45341688 GAGTTAGCACTGAAGAAGGAAGG + Intergenic
973173512 4:47174995-47175017 GAAGGAAGAGAGAGGAAGGAAGG - Intronic
973331046 4:48910394-48910416 GAGGGGAGAGAGAGGAAGGAAGG - Intergenic
973531301 4:51839173-51839195 GAAGGAAGAAAGGAGAAGGAAGG + Intergenic
973697723 4:53507216-53507238 GAGGGGTCACAGAAGGTGGAAGG + Intronic
973929818 4:55780910-55780932 GAGGGAAGAGAGAGGAAAGAAGG + Intergenic
974522172 4:62995975-62995997 GAGGGAGGAAGGAAGAAGGAAGG + Intergenic
974531526 4:63114537-63114559 GAGGGAGGAGAGGAGAAGGAGGG - Intergenic
974811379 4:66950477-66950499 GAGTGAACACAAAAGAAAGGTGG + Intergenic
974963822 4:68735969-68735991 GAGAGAACAGAGGAGAAGAAAGG + Intergenic
974994780 4:69141373-69141395 GAGGGAGAAAAGAAGAGGGAAGG - Intronic
975379713 4:73685014-73685036 GAGAGGACACAGAAGCAGGAAGG + Intergenic
975489593 4:74974136-74974158 GAGCACACACAGAGGAAGGAGGG - Intronic
975967592 4:79993352-79993374 GAGAGAATAAAGAAGGAGGAAGG + Intronic
976022837 4:80651339-80651361 GAAGAAAGAAAGAAGAAGGAAGG - Intronic
976143244 4:82015173-82015195 GAAAGAAGACAGAAGAAGAAAGG + Intronic
976693672 4:87895318-87895340 GAGGGAACTTAGACGATGGATGG + Intergenic
977178274 4:93840921-93840943 CAGGGAACACAGCAGAGGCAGGG + Intergenic
977263158 4:94822539-94822561 GAGGAAATACAGGAGATGGATGG + Intronic
977328772 4:95610184-95610206 GAGGAAAGACAGTAGAAAGAAGG + Intergenic
978264736 4:106810242-106810264 GAGAGAAGAAAGAAGAAAGAAGG - Intergenic
978662234 4:111140722-111140744 TAGAGAACACAAAAGAAAGATGG + Intergenic
978999867 4:115203143-115203165 GAGGGCAAAGAGAAGAGGGAAGG - Intergenic
979073207 4:116238619-116238641 GGAGAAACAGAGAAGAAGGATGG - Intergenic
979108601 4:116720299-116720321 AAGGGAGCAGAGAAGAAAGAAGG - Intergenic
979421310 4:120508953-120508975 GAGGGAAAGCAGAAGCAGGGTGG + Intergenic
979663246 4:123282806-123282828 GGGGGAGAAAAGAAGAAGGAAGG + Intronic
980875640 4:138659410-138659432 GAGGGAGAAGAGAAGCAGGAGGG + Intergenic
980888954 4:138793640-138793662 GAGGGAGGAAAGAAGAAGGAAGG + Intergenic
980967714 4:139539179-139539201 AAGGGAACACAGTGGAAGGAAGG - Intronic
981235678 4:142412669-142412691 CAGAGAATACAGAAGAAAGATGG - Intronic
981330986 4:143510083-143510105 GAGGAACCAAAGAAGGAGGAGGG - Intergenic
981663557 4:147195643-147195665 TAGGTGACACAGAAGAGGGAGGG + Intergenic
981736037 4:147951293-147951315 GAGGTAACAAAGAAGAAAAATGG - Intronic
982884903 4:160766363-160766385 AAGGGAGGAAAGAAGAAGGAAGG + Intergenic
983091997 4:163514962-163514984 TAGGGAACCCAGGAGATGGAGGG + Intronic
983461078 4:168026749-168026771 GAGGAAGCACAGGAGAAGGACGG - Intergenic
983891960 4:173038695-173038717 GAAGGAAGAAAGAATAAGGAAGG - Intronic
984496018 4:180497951-180497973 GAGGAAAGTCAGAAAAAGGATGG - Intergenic
984612350 4:181855929-181855951 GAGGGAAGGAAGAAGAAAGAAGG + Intergenic
984703495 4:182833193-182833215 GAGGGGAGAGAGAAGGAGGAGGG - Intergenic
984818922 4:183862762-183862784 AAGGAAACTCAGAAGAGGGAGGG + Intronic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
985366628 4:189237725-189237747 GAGGGGACACAGAAAACAGAGGG - Intergenic
985652281 5:1112560-1112582 GAGGGGGCGCAGAAGGAGGAGGG - Intergenic
985823470 5:2176658-2176680 CAAGGAACAAAGAAGAAAGATGG - Intergenic
986294213 5:6423864-6423886 GAGGAAAAACACAGGAAGGAAGG + Intergenic
986294397 5:6424930-6424952 GAAGGAAGAAAGGAGAAGGAAGG - Intergenic
986297370 5:6449975-6449997 GAGGCAGCCCAGAAGAAGGCAGG - Intronic
986830675 5:11573823-11573845 GATGGAACACTGCAGAATGAAGG - Intronic
986968346 5:13302455-13302477 CAAGGAACAAAGAAGAAGTACGG + Intergenic
987017667 5:13836863-13836885 GACACAAGACAGAAGAAGGAGGG + Intronic
987141727 5:14953375-14953397 GAGGGGACTCAGGAGAAAGAGGG + Intergenic
987377697 5:17251786-17251808 GAGGGAGCAGAGGAGAAAGAAGG + Intronic
987793077 5:22593408-22593430 CAGGGAAAACAGGAGAAAGAAGG - Intronic
987828986 5:23071761-23071783 GAGGGAACACAGGAGTACAAGGG + Intergenic
988619429 5:32807695-32807717 GAGGTTACAGAGAAAAAGGAAGG - Intergenic
988773064 5:34450957-34450979 GAAGGAAGGAAGAAGAAGGAAGG - Intergenic
989196271 5:38719641-38719663 GAGGGAAGAGAAAGGAAGGAAGG - Intergenic
989331360 5:40262803-40262825 GAGGGAAAGAAGAGGAAGGAAGG + Intergenic
989825260 5:45847646-45847668 GAGGGAGAACAGAAGCAGGGTGG + Intergenic
990626265 5:57614949-57614971 GAGAGAACAGAGCAGATGGATGG + Intergenic
990702949 5:58495288-58495310 GAGGGAGGACAGTGGAAGGAGGG + Exonic
991410745 5:66343151-66343173 GTGGGCACACAAAATAAGGAGGG - Intergenic
991515245 5:67427969-67427991 GAGAGAAGAGAGAGGAAGGAAGG - Intergenic
992264829 5:75008284-75008306 GAGGGAAGAAGGATGAAGGAAGG - Intergenic
993863430 5:93163550-93163572 AAATGAACACAAAAGAAGGAGGG + Intergenic
994057456 5:95434348-95434370 CATGGAAAACACAAGAAGGAAGG - Intronic
994181257 5:96768869-96768891 GAGGTAACAGAGAGCAAGGAGGG - Intronic
994307645 5:98226380-98226402 TAGGAAAGAAAGAAGAAGGAAGG + Intergenic
994311923 5:98282953-98282975 TAGGAAACACAGAAGGAAGAAGG - Intergenic
994913435 5:105943278-105943300 GAGGGAGCACAGGAGAAGACGGG + Intergenic
995004502 5:107174576-107174598 GAGGGAAAGCAGAGGAAGTAGGG - Intergenic
995417312 5:111925443-111925465 GAGGAAGCACAGGAGAAGGATGG - Intronic
995631322 5:114135973-114135995 GAAGGAACAGAGAAAATGGAGGG + Intergenic
995639170 5:114233835-114233857 TAGGGAACAGAGAAGAAAAATGG - Intergenic
995950925 5:117713093-117713115 GAGGGAGCAAAGTAGAAGGAGGG - Intergenic
996772398 5:127098921-127098943 GAGGGAACAGAGAGGAAGCCTGG + Intergenic
996778391 5:127157926-127157948 AATGGAAAACAGAAAAAGGAAGG - Intergenic
996904167 5:128578489-128578511 GAGGGGAAACAAAAGAAAGAAGG - Intronic
997395587 5:133557416-133557438 TAAGGGACACAGAAGCAGGAAGG - Intronic
997865650 5:137460427-137460449 TAGGGAACACAGAAGAGCCAAGG + Intronic
998333151 5:141347004-141347026 GAGGAAAGAGAGAGGAAGGAAGG - Intronic
998407579 5:141882816-141882838 GAGGGGAGACAGGAGCAGGAAGG + Intergenic
998418263 5:141960820-141960842 AAGGGAACAGAGAAGAGGGAGGG + Intronic
998495822 5:142588469-142588491 GAGAGAAGAGAGAAGAGGGAGGG - Intergenic
998798090 5:145840123-145840145 AAGGGAAGTCAGAAGAAGGTCGG - Intergenic
998894346 5:146782807-146782829 GAGAGGAAACAGAAGAAAGAAGG + Intronic
998955046 5:147430190-147430212 GAGGGAAGAAAAAAGAAGGATGG + Intronic
999271777 5:150300938-150300960 GAAGGAGAACAGAAGAAAGAAGG - Intronic
999739495 5:154539305-154539327 GAGGGAGGAGAGAGGAAGGAAGG - Intergenic
999749824 5:154619434-154619456 GACGAAACAATGAAGAAGGAGGG + Intergenic
1001084439 5:168690557-168690579 GAGGGGACAGGGAAGAATGAAGG - Intronic
1001108390 5:168875212-168875234 GAGGGAAGAGAGAAGAAGGAAGG + Intronic
1001109222 5:168881971-168881993 GAGGGAACAGAGAAGCAGAGAGG - Intronic
1001184448 5:169555159-169555181 AAGGGAAGACTGAATAAGGAGGG - Intergenic
1001310679 5:170608055-170608077 GAGTGAGGACAGAAGAAGGTAGG + Intronic
1001731826 5:173965936-173965958 TAGGAAACAAAGAAAAAGGAGGG + Intergenic
1002080890 5:176736735-176736757 CAGGGAGGACAGGAGAAGGAAGG - Intergenic
1002286128 5:178163946-178163968 GAGAGGACAGAAAAGAAGGAAGG + Intergenic
1002434990 5:179225740-179225762 GGGGGAAGCCAGAAGGAGGATGG - Intronic
1002937680 6:1687553-1687575 CCTGGAACACAGGAGAAGGACGG - Intronic
1003004267 6:2366418-2366440 AAGGGAAGAAAGAGGAAGGAAGG + Intergenic
1003306392 6:4933094-4933116 GAGGCAGCAGAGAAGCAGGAAGG - Intronic
1003515416 6:6814074-6814096 GAAGGAAGAAAAAAGAAGGAAGG - Intergenic
1003637519 6:7846510-7846532 GGGGAAACACAGAAGGAGGAAGG + Intronic
1003712155 6:8603917-8603939 GAGGGAGGAAAGAGGAAGGAAGG - Intergenic
1004042450 6:11993889-11993911 GGGAGAAAACAGAAGCAGGAGGG + Intergenic
1004295222 6:14403981-14404003 GAGTGAGCACAGAATGAGGAAGG - Intergenic
1004751372 6:18565772-18565794 GAGGGAGGGAAGAAGAAGGAGGG - Intergenic
1004859977 6:19793906-19793928 GAGGGAGGACAGAAGAAGGCAGG + Intergenic
1004945601 6:20609326-20609348 GAGGGAAAAGAGAGGGAGGAGGG - Intronic
1004991022 6:21138898-21138920 AAGGGCACACAGAAGGAGAAAGG - Intronic
1005027568 6:21478111-21478133 GAGGGGAGGCTGAAGAAGGATGG - Intergenic
1005400349 6:25425916-25425938 TATGGAAGACAGTAGAAGGACGG + Intronic
1005424909 6:25692568-25692590 GGGGGAGCAAAGAAGAAGGGAGG - Intronic
1005778437 6:29162307-29162329 GAGGGCAAGCAGAAGAAGGGTGG - Intergenic
1005850081 6:29814511-29814533 GTGGGAACCCAGAAAAAGCACGG + Intergenic
1006301754 6:33197323-33197345 ATGGAGACACAGAAGAAGGAAGG + Intronic
1006336042 6:33420892-33420914 GAGGGAAGAGAGAAGAGAGAGGG + Intronic
1006679808 6:35788677-35788699 GAGGGACAAGAAAAGAAGGAAGG + Intronic
1006789054 6:36686710-36686732 GAAGGGACACACAAGAAGAAGGG + Exonic
1007012984 6:38435579-38435601 GAGGGAAAAGAAAAGAAAGAAGG - Intronic
1007724204 6:43904849-43904871 GAGGGGACACAGGAGTGGGAGGG + Intergenic
1007741009 6:44009535-44009557 GAGGGAAGGAAGAAAAAGGAAGG + Intergenic
1007899831 6:45400239-45400261 GAGGGGAGACAGAGGGAGGAAGG + Intronic
1007982804 6:46176333-46176355 AAGTGAAAACAGAAAAAGGAAGG + Intergenic
1008041652 6:46807720-46807742 AGAGGAAAACAGAAGAAGGAGGG + Intronic
1008056516 6:46951310-46951332 GAGGGAGAAGAGAAGAAGGCTGG + Intronic
1008060072 6:46987752-46987774 GGGGGAAGACAGATGAAGAAAGG - Intergenic
1008286178 6:49654029-49654051 GAAGGAAGAAGGAAGAAGGAAGG - Intergenic
1009332713 6:62443863-62443885 AATGGAAAACAGAAGAAAGAAGG - Intergenic
1009718335 6:67428676-67428698 GAGGGCGAACAGAAGCAGGATGG - Intergenic
1010117595 6:72333003-72333025 GAGGGGACAAGGAAGGAGGAGGG + Intronic
1010290708 6:74133312-74133334 GAGGGCACACAGTAGGAGGTGGG + Intergenic
1010465311 6:76161243-76161265 ATGGGAACCAAGAAGAAGGATGG - Intergenic
1010467327 6:76183963-76183985 GAGGGAAGACAGTGGGAGGAGGG - Intergenic
1010977523 6:82332543-82332565 GAGGGGATAGAGAAGAAGAAGGG - Intergenic
1011020784 6:82809787-82809809 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
1011118251 6:83920479-83920501 AATGGAACACAGAGGATGGATGG + Intronic
1011733260 6:90287964-90287986 AAGTGAGCACAGAAGGAGGATGG + Intronic
1011812083 6:91144402-91144424 AGGGAAGCACAGAAGAAGGAAGG - Intergenic
1012047623 6:94298556-94298578 GAAGGAAGGAAGAAGAAGGAAGG + Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012564072 6:100623620-100623642 GTGGGAACACTGAAGAGGGTTGG + Intronic
1012635224 6:101529772-101529794 ATGGGAATTCAGAAGAAGGATGG + Intronic
1012646189 6:101684983-101685005 GAGAAGACACAGAAGCAGGAAGG - Intronic
1013093796 6:106925519-106925541 GAAGGAAGAAAGAAAAAGGAAGG + Intergenic
1013307030 6:108858754-108858776 GAGGGAACAATGAAGAACAAGGG - Intronic
1014504939 6:122243190-122243212 AAAGGCACACTGAAGAAGGAAGG + Intergenic
1014717434 6:124882730-124882752 GAGAGAAAAAAGAAAAAGGAAGG + Intergenic
1015017525 6:128432008-128432030 GAGGGAAGAGAAAGGAAGGAAGG + Intronic
1015163960 6:130182612-130182634 GAGGGAAGAAAGAAGGAGGGAGG + Intronic
1015238932 6:131002344-131002366 GAGGGGAGAGAGAAGAAAGAAGG + Intronic
1016544138 6:145201700-145201722 GAAAGAAGAAAGAAGAAGGAAGG - Intergenic
1017124474 6:151052460-151052482 CAAGGGATACAGAAGAAGGATGG + Intronic
1017265562 6:152441599-152441621 AAGGAAGCACAGAAGAAGGTAGG + Intronic
1017502415 6:155037850-155037872 CAGTGGACACAGAAGAAGTAAGG - Intronic
1017645443 6:156535680-156535702 GAGGGAAGACAGAAGAGAGAAGG + Intergenic
1017741277 6:157408995-157409017 GATGGAAAAGAAAAGAAGGAGGG + Intronic
1018040763 6:159919777-159919799 GAGGGAAGACATAAGAAGATGGG + Intergenic
1018204291 6:161422698-161422720 GAGGAAAAAAGGAAGAAGGAAGG + Intronic
1018218448 6:161553403-161553425 GAGGGACCAAAAAAGGAGGAAGG - Intronic
1018377122 6:163223511-163223533 ATGGGAAAGCAGAAGAAGGATGG + Intronic
1018471228 6:164100375-164100397 CTGGGACCACAGGAGAAGGAAGG - Intergenic
1018581898 6:165315142-165315164 GAGAGAACAGAGAGGCAGGAGGG - Intergenic
1018699387 6:166414725-166414747 GTGGGAACACTAAGGAAGGAGGG - Intronic
1019166331 6:170100057-170100079 GAGGAAGGAAAGAAGAAGGAGGG + Intergenic
1019549245 7:1594006-1594028 GAGGGAAAGAAGAAGGAGGAGGG - Intergenic
1019629858 7:2043282-2043304 GGGGAACCACAGGAGAAGGAGGG - Intronic
1019667953 7:2261722-2261744 AAGGGAACACAGAAGCACGGGGG + Intronic
1019730654 7:2627628-2627650 GAGGGAGGACAGAAGGAGGGAGG + Intergenic
1019815232 7:3195080-3195102 GCAGGAACACAGGAGAAGCAGGG + Intergenic
1020228065 7:6295833-6295855 GAGGGAAGACCGAGGAAAGATGG + Intergenic
1020254968 7:6497853-6497875 GGGGGAACACAGAGGTAGGGTGG + Intronic
1021920337 7:25478719-25478741 GAGGGAGGACAGATGTAGGAAGG + Intergenic
1022232116 7:28424066-28424088 CAGAGAAGACAGAAGAAGGAGGG - Intronic
1022305227 7:29140815-29140837 GAGGGAAGGCAGAAGATTGATGG + Intronic
1022551115 7:31239505-31239527 GAGGGAAGAAAGAAAAAGAAAGG + Intergenic
1022946390 7:35289449-35289471 GACGGAGCACAGAAGATGGCAGG + Intergenic
1023033863 7:36113395-36113417 TAAGTAACACAGAAGAAGAATGG + Intergenic
1023201489 7:37702309-37702331 GAGGGAAAAGGGAAGAAGAAAGG - Intronic
1023635150 7:42202261-42202283 GAGAGAACACAGACCAAAGAGGG - Intronic
1023711856 7:43003137-43003159 GAGGAAACACAGAAGAGGGTAGG - Intergenic
1023739244 7:43263700-43263722 TAGGAAACAGAGAAGAAGGGAGG + Intronic
1023905286 7:44517367-44517389 CATGGCACACAGAAGATGGAAGG + Intronic
1024022597 7:45385677-45385699 GATGGAAGACGGCAGAAGGAAGG + Intergenic
1024604406 7:51012485-51012507 GAAGGAAGACAGAGAAAGGAAGG + Intergenic
1025231751 7:57207245-57207267 GAGGGAAAAAAAAGGAAGGAAGG - Intergenic
1025523668 7:61775962-61775984 GAGGGAACACATCAGAAAGCAGG + Intergenic
1026234711 7:68516883-68516905 GAGGGCACAAAGGAGAAGCAAGG + Intergenic
1026529557 7:71185154-71185176 GAGGGGACAGAGAGGAAGGAAGG - Intronic
1026578629 7:71595604-71595626 GAGCCAACACATATGAAGGATGG - Intronic
1026595739 7:71732999-71733021 GAGGGAAGAAAAATGAAGGAGGG + Intergenic
1026636671 7:72088719-72088741 GAAAGAAGAAAGAAGAAGGAAGG + Intronic
1026789767 7:73324086-73324108 GAGGGAAGAGGGAAGAGGGAAGG + Intronic
1027460128 7:78441577-78441599 GAGGGACCACATTAGCAGGAAGG - Intronic
1028669551 7:93385980-93386002 GTGGAAACACAGAGGATGGAGGG + Intergenic
1028714482 7:93948892-93948914 GAGAGAAAAAGGAAGAAGGAAGG + Intergenic
1028921370 7:96314082-96314104 GAAAGAAGAAAGAAGAAGGAAGG + Intronic
1028967422 7:96817666-96817688 AAGGCAATACAGAAAAAGGAAGG + Intergenic
1029165271 7:98584841-98584863 GAGGGAAGAGAAAGGAAGGAAGG - Intergenic
1029240999 7:99162450-99162472 GAGGCAACAAAGAGGAAGGAAGG - Intergenic
1029493181 7:100883379-100883401 GAGGGAAAACAGAAGAAATGAGG - Intronic
1030337858 7:108344942-108344964 GAGGGAGAAGATAAGAAGGAAGG + Intronic
1030672324 7:112351512-112351534 GAGGGTCCAGAGAGGAAGGAGGG - Intergenic
1030680727 7:112430972-112430994 GAGGCAAGAAAGAAGAAGAAAGG - Intronic
1030769069 7:113450984-113451006 GAGCCAACTCAGAACAAGGAAGG - Intergenic
1030913166 7:115278362-115278384 CAAAGAACACTGAAGAAGGAGGG - Intergenic
1032445235 7:131976630-131976652 GGGTGGACACAGTAGAAGGAAGG - Intergenic
1032487703 7:132300569-132300591 GGGTGGGCACAGAAGAAGGAAGG - Intronic
1033150864 7:138913962-138913984 GAGGGGACAGAAAAGGAGGAGGG + Intronic
1033442538 7:141393439-141393461 GAGAGATCAAAGAGGAAGGAAGG + Intronic
1033583329 7:142755819-142755841 GAGGGAAGAGAGAAGGAGGGTGG - Intronic
1033586340 7:142777327-142777349 GAGGGAAGAGAGAAGGAGGGTGG - Intergenic
1033653792 7:143360822-143360844 GAGAGAAGACAGAAGATGGTGGG + Intronic
1033669995 7:143482563-143482585 GAGAGAAGAATGAAGAAGGATGG - Intergenic
1033889584 7:145994831-145994853 GAAGGAAGAAGGAAGAAGGAAGG - Intergenic
1034031689 7:147773699-147773721 GAGAGTACAAAGAAGAAGGAAGG - Intronic
1034625164 7:152487154-152487176 AAGGGAAGAGAGAGGAAGGAAGG - Intergenic
1034744801 7:153514318-153514340 GATGGAGCACAGAAGAGAGATGG + Intergenic
1034978510 7:155461378-155461400 GAGGGAGGAGAGCAGAAGGAGGG - Intronic
1035245450 7:157559838-157559860 GAGAGAACACAGGAGAGAGACGG - Intronic
1035613926 8:988680-988702 CAGGGAACACATCAGATGGAAGG - Intergenic
1035998403 8:4574419-4574441 GAGGGTAAGCAGAAGAAGGGTGG - Intronic
1036453069 8:8885623-8885645 GAAGGAAAACAGCAAAAGGAAGG + Intronic
1036544350 8:9751819-9751841 GCGGGAACAGAAAGGAAGGAAGG + Exonic
1036546085 8:9771289-9771311 GAGGGAGGAGAGAGGAAGGAAGG + Intronic
1037224410 8:16567693-16567715 TGGGAAACACAGAAAAAGGAAGG + Intergenic
1037282093 8:17252728-17252750 GAGGTAACACACATGAATGAAGG - Intronic
1037319528 8:17630160-17630182 TGGGGAAAACAGAAGAAAGACGG - Intronic
1037689435 8:21170186-21170208 GAGGGAAAAGGGAAGGAGGATGG - Intergenic
1037753402 8:21696909-21696931 GAGGGGACATAGTAGAGGGAAGG + Intronic
1037754676 8:21703230-21703252 TGGGGAACACAGAAGAAAAAAGG + Intronic
1037815955 8:22111975-22111997 GGGGGAGCACAGGAGCAGGAAGG + Intergenic
1038044744 8:23756786-23756808 GAGGGAACACTGAAAATGGCTGG - Intergenic
1038308680 8:26427982-26428004 GTGTGCACACATAAGAAGGAGGG + Intronic
1038500218 8:28037538-28037560 GAGGCAACAGTGAAGCAGGAGGG - Intronic
1039007842 8:33060490-33060512 CAGGGAACTCTGAAGCAGGACGG - Intergenic
1039053549 8:33515603-33515625 GAAGGAAGAAGGAAGAAGGAAGG - Intergenic
1039434863 8:37553183-37553205 GATGGAACACAGAGGAAACAAGG - Intergenic
1039762162 8:40589701-40589723 GAAGGAAGAAGGAAGAAGGAAGG - Intronic
1039995073 8:42525170-42525192 AAGGAAATACAGAAAAAGGAAGG + Intronic
1040690960 8:49937872-49937894 AAAGGAACTCAGAAGGAGGAGGG - Intronic
1041126799 8:54649586-54649608 GAGGTAACAAAGATGAAGCAGGG + Intergenic
1041362157 8:57065811-57065833 TGGGGTACACAAAAGAAGGAGGG - Intergenic
1041731708 8:61069420-61069442 AAGGGAAAACAGAGGAAGGAAGG - Intronic
1041746155 8:61211340-61211362 GAGGGGGAAGAGAAGAAGGAGGG - Intronic
1041989265 8:63966238-63966260 GAGGGAAGAAAGAAGAAAGAAGG - Intergenic
1042420991 8:68589420-68589442 GAGAGAAAATAAAAGAAGGAAGG + Intronic
1042678523 8:71351226-71351248 GAGGGAAAACAGTTGAAAGACGG + Intronic
1043665415 8:82805036-82805058 GAGGGAACAAAGGAAAAGGGGGG + Intergenic
1043669998 8:82872330-82872352 GAGGGAAAACAGAATATTGAGGG - Intergenic
1044122115 8:88410841-88410863 GAGGAAACACAGAAGGTGGATGG + Intergenic
1044299061 8:90562799-90562821 GAGGGAAGACAATGGAAGGAGGG - Intergenic
1044627190 8:94245578-94245600 GAGGGGACACAGAGGGAAGAAGG - Intergenic
1044785265 8:95786787-95786809 GAGGGAGCAAAGAGGAAGGAAGG + Intergenic
1044891762 8:96843391-96843413 AAGGAAAGAAAGAAGAAGGAAGG + Intronic
1044923138 8:97186714-97186736 CAGGGAACAGAGAAGTACGAAGG + Intergenic
1045085407 8:98677546-98677568 GAAGGAAGAAGGAAGAAGGAAGG + Intronic
1046531521 8:115452030-115452052 GAGAGAACATAGGAGAAGAAGGG - Intronic
1046765720 8:118067382-118067404 GAAGTAACAAAGAAGAATGAGGG + Intronic
1046980849 8:120335083-120335105 GAGGGAATGGGGAAGAAGGAAGG + Intronic
1047177644 8:122556593-122556615 AAGGGGACAAAGAAGAAGGAAGG + Intergenic
1047398273 8:124523796-124523818 GAGGGAAGACAGTGTAAGGAAGG + Intronic
1047503295 8:125458913-125458935 GTGGGAACACAGAGGAGGGGAGG + Intergenic
1047540609 8:125762076-125762098 GAGAGAAGTCAGAAGAGGGATGG + Intergenic
1047549061 8:125850070-125850092 GAGAGAAAAAAGAGGAAGGAAGG - Intergenic
1048013048 8:130473946-130473968 GAGGGAACACAGAGGAAGGAGGG + Intergenic
1048053997 8:130846624-130846646 GAGGGAAGGAAGGAGAAGGAAGG - Intronic
1048073828 8:131047072-131047094 AAGGAAAAACAGAAGAAGGCAGG - Intergenic
1048194533 8:132321506-132321528 GAGAGCAAACAGAAGCAGGAGGG - Intronic
1048326212 8:133441414-133441436 GAAGGAAGAAAGAAAAAGGAAGG - Intergenic
1048525472 8:135198384-135198406 GAGGGAAAAGAAAAGAAGGAAGG + Intergenic
1049767775 8:144362900-144362922 GAGGGAAGATAGAAGAAGCTGGG - Intergenic
1050125865 9:2355742-2355764 GCGGGAAAACAGAATAATGAAGG + Intergenic
1050746445 9:8881903-8881925 GAGGAAAGAAAGGAGAAGGAAGG + Intronic
1050753684 9:8973207-8973229 GAGGGAGGAGAGAAGGAGGAGGG - Intronic
1051059971 9:13034464-13034486 GAGGGGAAACAGCAGAAGAATGG - Intergenic
1051177236 9:14373111-14373133 AAGGGAACACTGGAGAAGGGTGG + Intronic
1051215751 9:14795566-14795588 GAGGAAGCACAGAAAAGGGAGGG + Intronic
1052093822 9:24361179-24361201 AAGGGAACATAGAAGAAGAGGGG + Intergenic
1052856753 9:33411774-33411796 GAGGGAACACTGAAGAATGTAGG - Intergenic
1052902088 9:33801985-33802007 GAGGGAAGAGAGAAGGAGGGTGG - Intergenic
1053209020 9:36211921-36211943 GGGAGAACACAGTTGAAGGAAGG - Exonic
1055157891 9:73087350-73087372 AAGGGAACTCAGAAGCTGGAGGG - Intergenic
1055199002 9:73634156-73634178 CAGAGAACACTGAAGCAGGAAGG + Intergenic
1055520954 9:77080687-77080709 GTGGGAACACAGAAAGAAGATGG - Intergenic
1056045783 9:82714145-82714167 GGAGGGACACTGAAGAAGGATGG - Intergenic
1056212661 9:84379671-84379693 GAAAGAAAAAAGAAGAAGGAAGG - Intergenic
1056233405 9:84569501-84569523 GATGGAACACAGGGGAAGGTAGG - Intergenic
1056578478 9:87873175-87873197 GAGGGAAGAAAGGAGAGGGATGG + Intergenic
1056617021 9:88177525-88177547 GAGGGCATGCAGGAGAAGGATGG + Intergenic
1056883755 9:90420332-90420354 GAGGGCACACAGGTAAAGGATGG + Intergenic
1057147907 9:92770769-92770791 CAGGGAACAGTGAGGAAGGAGGG - Intergenic
1057167624 9:92941139-92941161 GAGGGAAAACAGCAGGGGGAAGG + Intergenic
1057464986 9:95304774-95304796 AAGGGAAAACAGAAGAAATAAGG + Intronic
1057891591 9:98874110-98874132 GATGGCACCCAGAAGGAGGAAGG - Intergenic
1057980154 9:99652440-99652462 AATGGAAAACAGAAAAAGGAGGG + Intergenic
1058069276 9:100585199-100585221 GAGGGAATGAAGAAGGAGGAGGG + Intronic
1058111228 9:101032462-101032484 AGGAGCACACAGAAGAAGGAAGG - Intronic
1058146620 9:101419145-101419167 GAGGGAAGAGGGAAGAAGGAAGG - Intergenic
1058388032 9:104461500-104461522 CAGGTAAGAGAGAAGAAGGAAGG + Intergenic
1058948820 9:109884029-109884051 GAAGGAACACAGATCAGGGAAGG + Intronic
1059432275 9:114257405-114257427 GAGGGAACACAGGAGAAGATGGG - Intronic
1059672321 9:116503164-116503186 GAAGGAAGAAGGAAGAAGGAGGG + Intronic
1059987545 9:119835292-119835314 GAAGGAAGAGAGAGGAAGGAAGG + Intergenic
1060035275 9:120250205-120250227 GAGGGTACGTAGAAGGAGGATGG - Intergenic
1060187961 9:121575352-121575374 CCAGGACCACAGAAGAAGGAAGG - Intronic
1060297792 9:122355039-122355061 GAGGGAAGGAAGAGGAAGGAGGG + Intergenic
1060967645 9:127720803-127720825 GAGGGAAGAAAGAAGGAGGGAGG - Intronic
1062074790 9:134579911-134579933 GAGGAAAGAAGGAAGAAGGAAGG + Intergenic
1062144046 9:134979062-134979084 GAGGAAAGAGAGAAGGAGGAAGG + Intergenic
1185569379 X:1121577-1121599 AAAGGACCCCAGAAGAAGGAAGG + Intergenic
1185574897 X:1163614-1163636 AAGGAAAGAAAGAAGAAGGAAGG + Intergenic
1185688279 X:1948314-1948336 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1185688580 X:2133890-2133912 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1185708453 X:2282595-2282617 GAGGGGAGAGAGAAGAAAGAGGG + Intronic
1185954881 X:4478384-4478406 GAGGAAAGAGGGAAGAAGGAAGG + Intergenic
1186045528 X:5532662-5532684 GAGGGGAGAAAGAAAAAGGAAGG + Intergenic
1186695369 X:12025130-12025152 TAGGTTACACAGAAGAAAGAAGG - Intergenic
1187161276 X:16767677-16767699 GAATGAACACAGAAGCAAGATGG - Intergenic
1187439165 X:19302416-19302438 CAGGGAAAACAGAAGACAGATGG - Intergenic
1187708053 X:22026832-22026854 GAGGGAGGAAAGAAGAAGGAAGG - Intergenic
1187788221 X:22917728-22917750 GACAGTACACAGAAAAAGGAGGG + Intergenic
1188966601 X:36561065-36561087 GAAGGAAGAAGGAAGAAGGAAGG - Intergenic
1189197148 X:39162259-39162281 GATGAAAGAGAGAAGAAGGAAGG - Intergenic
1189206110 X:39240448-39240470 GAAGGAAGACAGAAGGAAGAGGG - Intergenic
1189720986 X:43917415-43917437 GAGGGAACCCAGATGAAGCCTGG - Intergenic
1189882940 X:45510927-45510949 GAGGGAAAAGGGGAGAAGGAGGG - Intergenic
1190071321 X:47282202-47282224 GAGGGAGAAAGGAAGAAGGATGG - Intergenic
1190101606 X:47526422-47526444 AAATGAAGACAGAAGAAGGAAGG - Intergenic
1190469990 X:50769209-50769231 GAGGGAAGAAAGGGGAAGGAGGG + Intronic
1190489223 X:50964499-50964521 GAGAGAACAAAAAAGAAAGAGGG + Intergenic
1190515891 X:51223270-51223292 GAGGGAAGAAAGAGGAGGGAAGG - Intergenic
1190743423 X:53305921-53305943 GGGGGAACACCAAAAAAGGAAGG + Intronic
1190747414 X:53332691-53332713 GAGGGAGGACAGAAGACGCAGGG - Intergenic
1191764453 X:64682111-64682133 GAGGGAAAACAGAACTAGGGAGG + Intergenic
1191894515 X:65977664-65977686 GAGGTTACAGAGAAAAAGGAAGG - Intergenic
1192117192 X:68422651-68422673 GAGGGAGGAAAGAAGAAGAAAGG + Intronic
1192318766 X:70072052-70072074 GAGGAAGCACAGAGGAAGAAAGG + Intergenic
1192730497 X:73798491-73798513 GAGGGAAGGGAAAAGAAGGATGG + Intergenic
1192958257 X:76096140-76096162 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1193103002 X:77636908-77636930 GAAGGAAGAAGGAAGAAGGAAGG + Intronic
1193228498 X:79013712-79013734 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1193367018 X:80646816-80646838 TAGAGAACACAGGAGAAAGAAGG - Intergenic
1194200357 X:90947469-90947491 GAGGGAAAAGAAAAGAAAGAAGG - Intergenic
1194728666 X:97428656-97428678 GAGGGTTAAGAGAAGAAGGAGGG - Intronic
1194738031 X:97537637-97537659 GAGTGAGCACAGAAGATGGAAGG - Intronic
1194739549 X:97556604-97556626 GAGGGCACACAGAGGTAAGAAGG - Intronic
1194934577 X:99932660-99932682 AAGGCAAGACAGAAGAAAGAAGG - Intergenic
1195031134 X:100928798-100928820 GAGCGGGCGCAGAAGAAGGAGGG + Exonic
1195117013 X:101709351-101709373 GAGGGAATAAAGAAGTGGGAAGG + Intergenic
1195322020 X:103728153-103728175 CAGGGTCCAGAGAAGAAGGAAGG + Exonic
1195746617 X:108124920-108124942 AAGGGAACACAGAGAAAGTAGGG - Intronic
1196376557 X:115039700-115039722 GAGTGACCACAGAAGCAGCATGG + Intergenic
1196455987 X:115892021-115892043 CAGGGAACACAAACCAAGGAAGG + Intergenic
1196465623 X:115969091-115969113 CAGGAGACACAGAAGATGGAGGG - Intergenic
1196834502 X:119801986-119802008 GAAGGGAAAGAGAAGAAGGAAGG - Intergenic
1197815949 X:130498721-130498743 GAGGGAAGAAGGAAGAAAGAGGG - Intergenic
1198102111 X:133431146-133431168 GAAGGAGGAGAGAAGAAGGAGGG + Intergenic
1198383424 X:136105262-136105284 GAGGGAAGAAAGAGGAGGGAGGG + Intergenic
1198383429 X:136105280-136105302 GAGGGAAGAAAGAGGAGGGAGGG + Intergenic
1199574623 X:149301505-149301527 GAGGGCAAACAGCAGAAGGCAGG + Intergenic
1199703499 X:150404004-150404026 GAAGGAAGAAAGAAGAAGGGAGG + Intronic
1199751542 X:150824103-150824125 GAAGGAAGAAGGAAGAAGGAAGG + Intronic
1199899603 X:152160020-152160042 GAGGGGAGACAGAAAAGGGAAGG - Intergenic
1200546352 Y:4523864-4523886 GAGGGAAAAGAAAAGAAAGAAGG - Intergenic
1200685516 Y:6254958-6254980 GAGGGAACAGAGAAGAGGCCAGG - Intergenic
1200868134 Y:8067424-8067446 TAGGGAAAACAGAATAAAGATGG + Intergenic
1200991046 Y:9346199-9346221 GAGGGAACAGAGAAGAGGCCAGG - Intergenic
1200996367 Y:9386810-9386832 GAGGGAACAGAGAAGAGGCCAGG - Intergenic
1200998882 Y:9455365-9455387 GAGGGAACAGAGAAGAGGCCAGG - Intergenic
1201001536 Y:9475674-9475696 GAGGGAACAGAGAAGAGGCCAGG - Intronic
1201004202 Y:9495976-9495998 GAGGGAACAGAGAAGAGGCCAGG - Intergenic
1201006857 Y:9516288-9516310 GAGGGAACAGAGAAGAGGCCAGG - Intergenic
1201009509 Y:9536594-9536616 GAGGGAACAGAGAAGAGGCCAGG - Intergenic
1201012100 Y:9557296-9557318 GAGGGAACAGAGAAGAGGCCAGG - Intergenic
1201047362 Y:9901135-9901157 GAGGGAACAGAGAAGAGGCCAGG + Intergenic
1201376662 Y:13330374-13330396 GAGGGCAAACAGAAGCAGGGTGG + Intronic
1201550410 Y:15211883-15211905 GAGGGAGGAAAGAAGAAGGAAGG + Intergenic
1201701079 Y:16882896-16882918 GAGGGAAAAAAGGAGAAGGAAGG + Intergenic
1201741302 Y:17326645-17326667 AAAGGAAGAAAGAAGAAGGAAGG + Intergenic
1202131979 Y:21621043-21621065 GAGGGAACAGAGAAGAGGCCAGG + Intergenic
1202196729 Y:22305656-22305678 GAGGGAACAGAGAAGAGGCCAGG - Intergenic
1202366000 Y:24165487-24165509 GAGGGAACAAAGAGAAAGAAAGG - Intergenic
1202504782 Y:25504636-25504658 GAGGGAACAAAGAGAAAGAAAGG + Intergenic