ID: 929864664

View in Genome Browser
Species Human (GRCh38)
Location 2:45708028-45708050
Sequence GAGGAATGCTGGGATGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 290}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929864659_929864664 1 Left 929864659 2:45708004-45708026 CCTCCTCGATGGCAGGCAGTGCA 0: 1
1: 0
2: 1
3: 9
4: 115
Right 929864664 2:45708028-45708050 GAGGAATGCTGGGATGCTGCAGG 0: 1
1: 0
2: 2
3: 39
4: 290
929864660_929864664 -2 Left 929864660 2:45708007-45708029 CCTCGATGGCAGGCAGTGCATGA 0: 1
1: 0
2: 0
3: 12
4: 101
Right 929864664 2:45708028-45708050 GAGGAATGCTGGGATGCTGCAGG 0: 1
1: 0
2: 2
3: 39
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929864664 Original CRISPR GAGGAATGCTGGGATGCTGC AGG Intronic
900993562 1:6108699-6108721 GAGGAATGGAGGGATGATGAAGG + Intronic
901108018 1:6772720-6772742 TAGGCATACTGGGATGCTGTGGG - Intergenic
903708897 1:25307163-25307185 CAGGACTGTTGGGATGCTACTGG + Intronic
904037662 1:27567528-27567550 GTGGAATGCTGGGAGGCCCCAGG - Intronic
905122299 1:35691364-35691386 GAACAAGGCTGGGAGGCTGCAGG + Intergenic
906201573 1:43963845-43963867 GAGGAAAGCTGGGATGGCGGTGG - Intronic
907437672 1:54459845-54459867 GATCAAAGCTGGGAGGCTGCCGG + Intergenic
907993238 1:59603548-59603570 GAGGAATGCATGAATGCTGGGGG - Intronic
909222645 1:72983233-72983255 GAGGAATCCCGGGCTGCTGCGGG + Intergenic
910284931 1:85543340-85543362 GGAGAATGCTGGGATCCAGCCGG + Intronic
910301330 1:85710071-85710093 GACCAATCCTGGGATGATGCAGG - Intergenic
910410098 1:86934123-86934145 TAGGAAGGCTGGGAGGCGGCTGG + Intronic
911037458 1:93565984-93566006 GAGGAAGGCTGGAAGGCTGAAGG - Intronic
911091778 1:94022900-94022922 GAGGGAGGCTGGGAGGCAGCAGG + Intronic
911509943 1:98799154-98799176 GAGGAATGCTTGTACACTGCTGG - Intergenic
911840331 1:102674770-102674792 GAGAAATCCTGGGATGATGAAGG - Intergenic
912431989 1:109632853-109632875 GGGGGAGGCTGGGAGGCTGCTGG + Intergenic
912726579 1:112064007-112064029 GAGGCATGCTGGGGCCCTGCTGG - Intergenic
913335720 1:117707766-117707788 GAGGAGGTCTGAGATGCTGCTGG + Intergenic
914014207 1:143803151-143803173 GAGGGATGTTGGGAAGCTGTGGG + Intergenic
914163615 1:145158045-145158067 GAGGGATGTTGGGAAGCTGTGGG - Intergenic
914652827 1:149711709-149711731 GAGGGATGTTGGGAAGCTGTGGG + Intergenic
915063885 1:153209008-153209030 GAGTAATTATGGGATTCTGCAGG - Intergenic
916392309 1:164343797-164343819 CAGGAATGCTGGGATCATTCTGG + Intergenic
917055077 1:170972131-170972153 GAGGAATGCTGGGTGGATCCAGG + Intronic
918133483 1:181648878-181648900 AAGGAATGTTGGGGTGCTGGGGG + Intronic
919802343 1:201361447-201361469 AAGGAGGGCTGGGATGCTGGGGG - Intronic
920032381 1:203045232-203045254 GAGGAGTGCTGTGATGTTGGGGG + Intronic
922541663 1:226424896-226424918 GAGGAAAGCTGCAAGGCTGCAGG + Intergenic
922569444 1:226625382-226625404 GAGGATTGCTGGGGCGCAGCAGG - Intergenic
922687972 1:227662530-227662552 GACAAATGCTGGGAAACTGCAGG + Intronic
922719169 1:227891594-227891616 CTGGAATGCTGGGATCCAGCAGG + Intergenic
922726673 1:227926030-227926052 CAGGAGTGCTGGGAAGCTGCAGG - Intronic
922925320 1:229342746-229342768 GCGGAAGGCAGGGAGGCTGCGGG + Intronic
923025188 1:230198209-230198231 GTGGGATGCTGAGGTGCTGCGGG + Intronic
923273178 1:232375526-232375548 GAAGAATACTGTGATGCTGATGG - Intergenic
1063603876 10:7506344-7506366 GAGGAAAGCTGGGGTGTTGGGGG + Intergenic
1065275465 10:24081398-24081420 GATGAATGCTGGGATGAGACAGG + Intronic
1065859696 10:29861814-29861836 GAGGAATGCTCGTCTGCTCCAGG + Intergenic
1067069546 10:43121741-43121763 GTGGATTGCTGAGATGCTGGCGG - Intronic
1067448221 10:46366033-46366055 GGTGAATGCTGGCGTGCTGCTGG + Intergenic
1067589156 10:47494733-47494755 GGTGAATGCTGGCGTGCTGCTGG - Intergenic
1067636281 10:48002824-48002846 GGTGAATGCTGGCGTGCTGCTGG - Intergenic
1067877206 10:50017503-50017525 GGTGAATGCTGGCGTGCTGCTGG + Intergenic
1069322444 10:67188521-67188543 GGGGAATCCTTGTATGCTGCTGG + Intronic
1070132842 10:73666829-73666851 GGTGAATGCTGGCATGCTGCTGG - Intergenic
1070354730 10:75628835-75628857 GAGTAATGCTGAGAAGGTGCAGG + Intronic
1070618720 10:77989670-77989692 GGCAAATGCTGGGGTGCTGCTGG + Intronic
1070652873 10:78250668-78250690 GAAGAAGGCTGGGATGCAGCGGG - Intergenic
1071608837 10:87017245-87017267 GGTGAATGCTGGCATGCTGCTGG + Intergenic
1072548285 10:96457293-96457315 GAGGGAGGCTGGGGTGCAGCAGG - Intronic
1072805072 10:98418959-98418981 GAGGAAAGCTGGGAGCCTGCAGG + Intronic
1075123818 10:119683713-119683735 CAGGAAGGCTTGGAGGCTGCAGG - Intergenic
1075466535 10:122655667-122655689 CAGCCATGCTGGGATGCTGCTGG + Intergenic
1075535151 10:123264868-123264890 GAGGAATGGTGGACTGCTGGTGG - Intergenic
1075546161 10:123356424-123356446 GCTGGATTCTGGGATGCTGCAGG + Intergenic
1076103021 10:127797798-127797820 GAGGGATGAGGGGAGGCTGCGGG - Intergenic
1076532743 10:131155574-131155596 GAGGAAAGCTGGGACACTGCTGG - Intronic
1077225764 11:1438498-1438520 CAGGGCTGCTGGGATGCAGCAGG - Intronic
1078528919 11:12121359-12121381 CAGCAAAGCTGGGATGGTGCAGG + Intronic
1078565648 11:12411913-12411935 GGGGAATGCTGAGAAGCTGGGGG - Intronic
1079444147 11:20544755-20544777 GGGGCCTGCTGGGAAGCTGCTGG - Intergenic
1080207974 11:29753125-29753147 GAAGCCAGCTGGGATGCTGCAGG + Intergenic
1080407319 11:31990965-31990987 GAGGAAGGCAGAGATACTGCAGG + Intronic
1080713183 11:34770537-34770559 GAGGAATGCAGGGAAACTGGTGG + Intergenic
1081639665 11:44744131-44744153 GAGGCCTCCTGGGCTGCTGCTGG + Intronic
1083356482 11:62070099-62070121 GAGAAATCCTGGCATGGTGCCGG + Intergenic
1084010393 11:66345171-66345193 GAGGCATGCTGGGATACCGCGGG + Intergenic
1086146389 11:83556835-83556857 AAGGCAAGCTGGGATGATGCGGG + Intronic
1089183443 11:116598687-116598709 GAGGAAGGCTGGGCTGGTGCTGG - Intergenic
1089525106 11:119092137-119092159 GAGGAATGCATGTATGCTGTGGG + Exonic
1089674553 11:120081199-120081221 GAGAAATGCTGGGGTGAGGCAGG - Intergenic
1089674559 11:120081236-120081258 GGGAAATGCTGGGATGAGGCAGG - Intergenic
1090227146 11:125078547-125078569 GAGGAAAGGTGGGAGGCTGAGGG + Intronic
1090231674 11:125111514-125111536 GAGGAAAGCGGGGCGGCTGCGGG - Intronic
1090258776 11:125304013-125304035 TAGGAATGCAGGGATGTTGTTGG + Intronic
1090447538 11:126776834-126776856 CAGGAAAGCTGGGACACTGCTGG - Intronic
1091657938 12:2359461-2359483 CCGGATTGCTGTGATGCTGCAGG + Intronic
1091859350 12:3765448-3765470 GAGGAAAGCAAGGATGCTGCAGG + Intergenic
1092149036 12:6234295-6234317 GAGAGATGCTGAGATGCTGGAGG + Intronic
1092660662 12:10734668-10734690 TGTGAATGCTTGGATGCTGCTGG + Intergenic
1096031077 12:48415629-48415651 TAGAAATGCTGGCATGCTGCAGG + Intergenic
1096520677 12:52182862-52182884 GGGGAACGCTGGGCTGCGGCTGG + Intronic
1096774704 12:53956819-53956841 CAGGAAGGCTGAGGTGCTGCGGG + Exonic
1096840862 12:54378726-54378748 GAGGGATGCTGGGAAGGGGCTGG + Intronic
1099229018 12:80001700-80001722 GAGGTATGCAGGGATTCTACAGG + Intergenic
1100025353 12:90121787-90121809 GAGGAATGCACAGATGCTGGTGG + Intergenic
1102495562 12:113316719-113316741 GAGGACTGGTGGGATGGAGCGGG - Intronic
1104874939 12:132027122-132027144 GAGGTGTGCTGGGATGCTTCTGG + Intronic
1105718717 13:23092940-23092962 CAGGAATGCTGGGATGCCCGTGG - Intergenic
1106161271 13:27203340-27203362 GTGGCATCCTGGGCTGCTGCTGG - Intergenic
1107632319 13:42355173-42355195 CAGGAGTGCTGAGATCCTGCTGG + Intergenic
1107817307 13:44255682-44255704 GGGGGATGGTGGGATGGTGCAGG - Intergenic
1108680586 13:52776944-52776966 GAGGAATGCAGGGATGTCTCAGG + Intergenic
1111604410 13:90519531-90519553 GGGAAATGCAGGGCTGCTGCTGG - Intergenic
1111880889 13:93955646-93955668 CAGGAATGCTGAGATGCTGGAGG + Intronic
1113018037 13:105850478-105850500 GATGAAGGCTGGGAGGCTGGAGG + Intergenic
1113219087 13:108077924-108077946 GAGGAATATGTGGATGCTGCTGG + Intergenic
1113462397 13:110491350-110491372 GAGGAAGGCTGTGTGGCTGCGGG - Intronic
1113654900 13:112061833-112061855 GAGCAAAGCTGGGAGGCCGCCGG - Intergenic
1114066775 14:19066772-19066794 GAGGGATGCTGGTCTGCTGTTGG - Intergenic
1114095491 14:19333255-19333277 GAGGGATGCTGGTCTGCTGTTGG + Intergenic
1114551572 14:23535394-23535416 GAGCAGTGCTGTGAGGCTGCAGG + Intronic
1114991601 14:28296011-28296033 GAGAAATGCTGGGCTTCTTCTGG + Intergenic
1117108841 14:52427657-52427679 TAGGAAAGCTGGGATGGTGTTGG - Intergenic
1118408191 14:65448234-65448256 GAAGAGTGCTGGGATGATGCAGG + Intronic
1118443705 14:65833653-65833675 GAGGAGTCCTGTTATGCTGCTGG + Intergenic
1118763437 14:68894554-68894576 CAGGAATGCTGGGTCCCTGCTGG - Intronic
1120552791 14:85891798-85891820 GAAGAATCCTGGGGTGATGCAGG + Intergenic
1121029992 14:90649977-90649999 TAGGCATGCTGGGCTGCTACTGG + Intronic
1121358061 14:93231491-93231513 CGGGAATGGTGGGATGCTGGGGG + Intergenic
1121840241 14:97127959-97127981 ATGAAATGCTGGGATGGTGCAGG + Intergenic
1122394515 14:101413988-101414010 GAGGAATGCAGGGATGCCACTGG - Intergenic
1122982705 14:105198802-105198824 CAGAAATGCTGGGGTGCTGCAGG + Intergenic
1128080760 15:64855525-64855547 GAGGAAAGCTGGGGGGCTGCAGG - Intronic
1132311596 15:100861729-100861751 CAGAAATGCTGGGAGGCTGGAGG - Intergenic
1133583695 16:7171080-7171102 GAAGAAAGCTGGGATGGAGCTGG - Intronic
1133739828 16:8642788-8642810 GAGGAAGGCTGGGAAGCATCAGG + Intronic
1134036687 16:11036451-11036473 GAGGCATGCTGAGCTGCTGGGGG - Intronic
1134378918 16:13706306-13706328 GAGGAGGGCTTGGCTGCTGCAGG + Intergenic
1135488462 16:22886433-22886455 GTGAAGTGCAGGGATGCTGCCGG + Intronic
1136173490 16:28502431-28502453 GAGGTATGATGGGATGGTGGAGG - Intronic
1138328434 16:56193376-56193398 GAGCAATGCTGGGAGGGTGGGGG - Intronic
1140659169 16:77170827-77170849 CAGGGATGCTGAGCTGCTGCAGG + Intergenic
1140698222 16:77556302-77556324 GTGGAATGCAGGGATGCACCAGG + Intergenic
1142604722 17:1075122-1075144 GAGGATGGCTGGGATTCAGCAGG + Intronic
1143243734 17:5465934-5465956 GAGGAAGGCTAAGAGGCTGCAGG - Intronic
1143433015 17:6900676-6900698 GAGGAAGGCTGGGATGCAGCTGG - Intronic
1144578037 17:16442248-16442270 TAGGAATGGTGCAATGCTGCAGG - Intronic
1144834749 17:18150967-18150989 GAGGAATGCTGTGCTGCTCCAGG + Intronic
1145001010 17:19304630-19304652 CAGGAGTGCTGGGATGCAGTTGG - Intronic
1145055584 17:19701832-19701854 GAGGAAGGCTGGCATGGTGGAGG - Intronic
1145055913 17:19703986-19704008 CAGGAAGGCTGGCATGCTGGAGG - Intronic
1145768574 17:27476433-27476455 GAGCAGTGCTGGGGCGCTGCCGG + Intronic
1146496868 17:33330359-33330381 CAGGACTGCAGGGAGGCTGCTGG + Intronic
1147426475 17:40348111-40348133 GAGGAGTGATGGGGTGCTGGAGG + Intronic
1147649418 17:42053600-42053622 TAGGAATGCTGGGGAGCTGGAGG - Intronic
1148550704 17:48549310-48549332 GAGCAATGCTGGACTTCTGCAGG + Exonic
1148557012 17:48584862-48584884 GAGGGAGCCTGGGATGCTGGAGG - Intronic
1149658392 17:58322272-58322294 GAGGGAAGCTGGCAGGCTGCTGG - Intronic
1150582504 17:66487634-66487656 AGGGAAGGCAGGGATGCTGCTGG - Intronic
1152374411 17:79911680-79911702 GAGGAAAGCTGGGAGGATGAGGG - Intergenic
1152930982 17:83109749-83109771 GAGGCCTGCTGGGAAGCTTCTGG - Intergenic
1160536910 18:79599559-79599581 GAGGAATGCTTGCATGTTGCTGG - Intergenic
1161541766 19:4856112-4856134 CAAGGATGCTGGGATGCGGCTGG + Intronic
1162659931 19:12161029-12161051 GAGGAAAGCAGGGACTCTGCTGG + Intergenic
1165269174 19:34690076-34690098 GTGGAATCCTGGGATTCTTCAGG - Intergenic
1165730581 19:38142359-38142381 GAGAGAAGCTGGGATGCTCCTGG - Intronic
1165891302 19:39113820-39113842 GAAGGGTGCTGGGAGGCTGCAGG + Intergenic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1166887861 19:45972850-45972872 GAGGGAGGCTGGGAAGCTCCCGG + Intronic
925034891 2:677292-677314 GAGCACGGCTGGGATGCTGACGG + Exonic
925058478 2:873251-873273 CAGGGCTGCTGAGATGCTGCAGG - Intergenic
926045820 2:9708890-9708912 CTGGGAGGCTGGGATGCTGCTGG + Intergenic
926324201 2:11770322-11770344 TAGGACCCCTGGGATGCTGCTGG + Intronic
927654613 2:24934907-24934929 GAGGAAAGCTTGGTTGCTGGAGG + Intergenic
927685127 2:25165299-25165321 GAGGAATGATAGGATCCTGGTGG - Intronic
927792081 2:26018199-26018221 GGAGAATGCTGGGATAGTGCAGG + Intergenic
929056818 2:37885473-37885495 CAGGAATTCTGAGATGCTGAGGG - Intergenic
929864664 2:45708028-45708050 GAGGAATGCTGGGATGCTGCAGG + Intronic
930243860 2:48963484-48963506 GGGGCAGGCTGTGATGCTGCTGG - Exonic
931224696 2:60319533-60319555 CAGGTTTCCTGGGATGCTGCAGG - Intergenic
932751690 2:74375404-74375426 GAGGAAGACTGGGGTGCTCCGGG + Intronic
933610984 2:84435068-84435090 GAGGGAAGCTGGGACTCTGCTGG - Intronic
936776386 2:115978866-115978888 GAGGAATGCTTATATGCTGCTGG - Intergenic
937541125 2:122955498-122955520 GGGAAATTATGGGATGCTGCAGG - Intergenic
938295539 2:130176556-130176578 GTAGAAAGCTGGGCTGCTGCAGG + Exonic
938461086 2:131497269-131497291 GTAGAAAGCTGGGCTGCTGCAGG - Intergenic
938484173 2:131686867-131686889 GAGGGATGCTGGTCTGCTGTTGG - Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
938774110 2:134525933-134525955 TAAGAAGGCAGGGATGCTGCGGG + Intronic
939887708 2:147699107-147699129 AGGGAAAGCTGGGATGCTGATGG + Intergenic
939891035 2:147736496-147736518 GAGGAATGCTAGTATACTACTGG + Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
941420922 2:165282048-165282070 GGAGAATGCTGGGCTGCTGGTGG + Intronic
941846239 2:170136687-170136709 GAGAAATGCTAGTATCCTGCTGG + Intergenic
941929252 2:170924354-170924376 GAGGAAGGCTGGGGTGCTGAGGG - Intergenic
942548638 2:177091548-177091570 GAGGGATTGTAGGATGCTGCAGG - Intergenic
944913841 2:204337289-204337311 GAAGGATGCTGGGAAGCTCCTGG + Intergenic
946301112 2:218824506-218824528 CTGGAAAGGTGGGATGCTGCAGG - Intronic
946321197 2:218955497-218955519 GACCAATGCTGAGATGCTGGAGG - Intergenic
947250235 2:228094743-228094765 GAGGAATTATGTGATGCTGAGGG + Intronic
948479268 2:238240002-238240024 GCGGACGGCTGGGCTGCTGCTGG - Exonic
948516574 2:238507732-238507754 GTGAAATGGTGAGATGCTGCTGG - Intergenic
948676682 2:239600991-239601013 GAGAAAGGCTTGGAAGCTGCAGG - Intergenic
948692530 2:239715681-239715703 GAGGATTGCGGGGCTGATGCTGG - Intergenic
948915363 2:241032026-241032048 GAGGAAAACTGGAATTCTGCAGG - Intronic
1170085335 20:12525207-12525229 GAGGAAAGCTTTTATGCTGCTGG + Intergenic
1170605040 20:17869602-17869624 GAGGAAAGGAGGGATGGTGCAGG - Intergenic
1171970695 20:31563204-31563226 GAGAAGGGCTGGGCTGCTGCTGG - Intronic
1173407463 20:42778950-42778972 TGGGAATGCTGAGATGCTACTGG - Intronic
1173846556 20:46192293-46192315 GAGGGATGCTGGGGAGGTGCAGG + Intronic
1174174437 20:48636069-48636091 GTGGAAGCCAGGGATGCTGCTGG - Intronic
1175162786 20:57021364-57021386 GAGGAATTGAGAGATGCTGCGGG + Intergenic
1175259303 20:57664576-57664598 GAGGAGCGCAGGGAGGCTGCTGG + Intronic
1178551463 21:33543033-33543055 GAGGCATGCTGGGAGCCTGGAGG + Exonic
1178790496 21:35695277-35695299 GTGAAATGATGGGATGATGCTGG - Intronic
1178854486 21:36239235-36239257 GAGGAATCCTGGCATGCCCCGGG + Intronic
1179462503 21:41547199-41547221 GGGCCATGCTGGGAGGCTGCTGG + Intergenic
1179519363 21:41932056-41932078 GTGGAGTGGTGGGATGCTGGAGG - Intronic
1181011610 22:20044141-20044163 GAGGCATCCTGGCATGCTCCAGG + Intronic
1181558395 22:23685272-23685294 GAGGATCGCTGGGATTCAGCAGG + Intergenic
1181861873 22:25825245-25825267 GAGAGATGCTGGGAGGCTGTGGG + Intronic
1182370386 22:29806335-29806357 CAGGAATGCTGTGCTGCTGCAGG + Intronic
1182790807 22:32951289-32951311 GAGGAAGGCAGCCATGCTGCTGG - Intronic
1182936275 22:34225101-34225123 TAGGATGGCTGAGATGCTGCAGG + Intergenic
1182942066 22:34286403-34286425 CAGCAGGGCTGGGATGCTGCGGG - Intergenic
1183699818 22:39444890-39444912 GAGGAATGATTGGATGTCGCTGG - Intergenic
1184224740 22:43122959-43122981 AAGGGATGCTGGGAAGCTGAGGG + Intronic
1184268613 22:43364484-43364506 GAGGAATGCTCAGAGGCAGCAGG - Intergenic
1184415402 22:44349252-44349274 GCTGAATCCTGGGCTGCTGCTGG + Intergenic
1184821750 22:46914886-46914908 GAGGAAGCCTGGGCTGCTGTAGG + Intronic
1185264919 22:49896320-49896342 AAGGTCTGCTGGGATGCTTCTGG - Intergenic
1185321462 22:50201879-50201901 GAGGAAGGCTGGGGACCTGCGGG - Intronic
950440081 3:13005415-13005437 GAGGACTGCTGGTCTGCTGGGGG - Intronic
951594011 3:24297592-24297614 GGGAAATGGTGGGATGCTGGCGG + Intronic
952932266 3:38369480-38369502 GAGGTGGGCTGGGATGCTGATGG - Intronic
952997526 3:38899453-38899475 GAGGAATGCAGGGGAGCTGATGG - Intronic
953211966 3:40884199-40884221 GATATATTCTGGGATGCTGCTGG - Intergenic
953418963 3:42739997-42740019 GGGGAAGGGTGGGAGGCTGCTGG - Intronic
953609091 3:44432763-44432785 GAGGGAAGCTGGGATGTTGGAGG - Intergenic
954431378 3:50472634-50472656 GAGCAATGCTGGGAACCTGGTGG - Intronic
954616959 3:51974032-51974054 GAGGAACGCTGGGAAGAGGCCGG + Exonic
955148888 3:56347400-56347422 GAGGAAAGCTGGGAGGCTGGAGG + Intronic
957933704 3:86915164-86915186 GAAGAAAAGTGGGATGCTGCTGG - Intergenic
958799073 3:98735246-98735268 GAGGATTCCTGGGATGGTGTAGG - Intronic
959180693 3:102976013-102976035 CAGGAGTGCTGGGATGGTGCAGG - Intergenic
959905161 3:111703212-111703234 GAGGGATGCAGGGATGGTGCTGG + Intronic
961554594 3:127689366-127689388 GAGGGAAGCTGGGTCGCTGCTGG + Exonic
963010940 3:140769772-140769794 GAGGAGTGCAGGGATGGTGCAGG - Intergenic
966146560 3:176818691-176818713 GAGGATTGCTGGGTTGCTTGAGG - Intergenic
966875867 3:184321344-184321366 GACGAAGGCTGGGATTCTGAAGG - Exonic
967016669 3:185488611-185488633 GAGCAGACCTGGGATGCTGCCGG - Exonic
967734270 3:192935655-192935677 GAGGACTCCTTGGATCCTGCAGG + Intergenic
969119786 4:4899682-4899704 GAGGCATGCAAGGATGCTGCGGG + Intergenic
971268340 4:25114106-25114128 TAGGAAAGCTGGGCTGCTGTCGG - Intergenic
972335838 4:38106686-38106708 GAAGAATGAGGGGATACTGCAGG - Intronic
972534811 4:39990761-39990783 GAGGATTGCTTGGATCCTGGGGG - Intergenic
973268815 4:48238898-48238920 GAGTAATGCTGGGATGCATAAGG - Intronic
974027557 4:56746997-56747019 GAGAAATGCCGGGATGGGGCTGG - Intergenic
976142527 4:82007394-82007416 GAGGAATTCTGGGAAGATGATGG + Intronic
977425328 4:96861463-96861485 GAGACAAGCTTGGATGCTGCAGG + Intergenic
978061410 4:104344783-104344805 GAGGGAGGCTGGGAGGCTGAGGG + Intergenic
978779198 4:112532243-112532265 GAGGAAACCTGGGAGGCTGGAGG + Intergenic
981650405 4:147050876-147050898 AAGGAATTCTGGAATCCTGCAGG + Intergenic
983935024 4:173496261-173496283 GAGAAATGATGGAATGATGCAGG + Intergenic
985495997 5:206477-206499 GAAGATTGCTGGGAGGCTGGAGG + Intronic
985555573 5:556309-556331 AAGGAATGCTGAGACGCAGCGGG + Intergenic
986175647 5:5349798-5349820 GAGGAATGCTGTGGGGCTGTTGG + Intergenic
986299645 5:6467813-6467835 GAGGAATGTGTCGATGCTGCAGG - Intronic
986975921 5:13393762-13393784 GAGAAATGTTGGGTTGCTCCTGG - Intergenic
988883895 5:35534403-35534425 GAGAAATTGTGAGATGCTGCAGG - Intergenic
990724281 5:58736154-58736176 TAGGAATGGTGCAATGCTGCAGG - Intronic
993446879 5:88023830-88023852 ATGGAATGCTGGTATGCTGCTGG - Intergenic
994514025 5:100746951-100746973 GAGGCATGTAGGGTTGCTGCAGG + Intergenic
995357571 5:111256890-111256912 AAGGACTGCTGGAATGTTGCTGG - Intronic
996101713 5:119451534-119451556 GAGGATTGATTGGATGTTGCGGG - Intergenic
998394657 5:141811077-141811099 GAGAAATGCTGGGCTGTAGCGGG - Intergenic
999050923 5:148523262-148523284 CATTAATGCTGGGAGGCTGCTGG - Exonic
1000406014 5:160889203-160889225 GAGGAATGTTGGAAGGCTGCGGG - Intergenic
1001562200 5:172677119-172677141 GAGGAATGCTGCTGTGCTGCTGG + Intronic
1001811856 5:174635042-174635064 GAGGAATGCTGAGATGCCAGGGG + Intergenic
1002376887 5:178795334-178795356 CAGGAATGCTGTGCTGCTCCGGG - Intergenic
1003516519 6:6823145-6823167 GACGAATGCTGCGAGGATGCTGG - Intergenic
1005159990 6:22848231-22848253 GAGGAATGAGGTCATGCTGCTGG - Intergenic
1006922263 6:37634744-37634766 GGGGGATGGGGGGATGCTGCTGG - Exonic
1007395466 6:41575436-41575458 AAGGAATGGTGGGAAGCTGAGGG + Intronic
1008677025 6:53829882-53829904 GAGGAATGCAGGAATTCTACAGG - Intronic
1008724720 6:54403112-54403134 GAGTAATGCTGAGAAGGTGCAGG - Intergenic
1009684273 6:66936336-66936358 GAGGGAGGCTGGGAGGCTGAGGG + Intergenic
1010965533 6:82202616-82202638 GAAGAATGCTGCTATGCTACTGG - Exonic
1012909624 6:105104395-105104417 GAGTAATTCTGTGAGGCTGCAGG - Intronic
1015001872 6:128227335-128227357 GAGGGATTCTGGGAAGCTGATGG + Intronic
1016664219 6:146616027-146616049 GAGGAATGCTAGTACACTGCTGG - Intronic
1017072992 6:150592938-150592960 AAGGAGTGCTGTGTTGCTGCTGG - Intergenic
1018240927 6:161773920-161773942 GAGGAAGGGAGTGATGCTGCTGG + Intronic
1018344706 6:162888407-162888429 TAGGATCGCTGGGCTGCTGCTGG + Intronic
1019383504 7:740556-740578 GAGGAATGCTGCTGTCCTGCAGG - Intronic
1020898863 7:13977049-13977071 GAGAAATGCCTGGATGCTGATGG - Intronic
1021406695 7:20276023-20276045 GAGGAATGCTTGTACGCTGCTGG + Intergenic
1022852155 7:34274848-34274870 GAGAAATGCTGAGATGCTTCAGG + Intergenic
1023846541 7:44123922-44123944 GGGGAAAGCTGGGACGCTGGGGG - Intronic
1023909373 7:44542459-44542481 GAGCAGTGCTGGGAAGGTGCTGG - Intergenic
1023993611 7:45145496-45145518 CAGGACTGCTGGGCTGCTGCAGG + Intergenic
1026964570 7:74431042-74431064 GAGGAGTGCTGGGCTGCTGAGGG - Intergenic
1028957481 7:96709905-96709927 GAGGAATGCTGGGATACTGGAGG + Intergenic
1029466346 7:100727625-100727647 GAGGAAGGCAGGGATGATGGAGG + Intergenic
1030828170 7:114186940-114186962 AAGGAATGCTGAGGTCCTGCAGG + Intronic
1031078726 7:117238547-117238569 GAGGACTTCAGGGATGCTGTGGG - Intergenic
1032169391 7:129571938-129571960 GGTGAATGCAGTGATGCTGCGGG - Intergenic
1033599176 7:142876699-142876721 GAGGGGAGCTGGGATGCTGCAGG - Intronic
1033606003 7:142928982-142929004 GAGGGGAGCTGGGATGCTGTGGG - Intronic
1034136855 7:148778904-148778926 GAGGAATAATGGGGTGCTACAGG - Intronic
1034294319 7:149958462-149958484 GAGGAATGCTGGGATCAGGCAGG - Intergenic
1034544130 7:151778565-151778587 GGGGAATGCTGGGATGTAGCAGG - Intronic
1034811749 7:154138410-154138432 GAGGAATGCTGGGATCAGGCAGG + Intronic
1036784505 8:11677102-11677124 GTGGGAGGCTGGGATGCTGGGGG + Intronic
1039268936 8:35859502-35859524 GAGGAATGCTGAAAGGCTGTAGG - Intergenic
1041089495 8:54288717-54288739 ATGGAATGATGGGATCCTGCAGG + Intergenic
1043506077 8:80904474-80904496 GAGGACTGGTGGGATACGGCAGG - Intergenic
1047356325 8:124125567-124125589 GAGAGATGCTGGAATGTTGCTGG - Intergenic
1048139283 8:131777451-131777473 GGGGACAGCTGGGATGCTGGAGG - Intergenic
1049471743 8:142777799-142777821 GGGGAAGGCTGGGCTGCCGCGGG - Exonic
1049593283 8:143472191-143472213 AAGGAGTTCTGGGTTGCTGCTGG + Intronic
1049737644 8:144218323-144218345 GTAGAATGCTTGGAGGCTGCTGG - Intronic
1049811547 8:144576412-144576434 CAGGAATGCTGGGGTGATGTGGG - Intronic
1050161584 9:2725107-2725129 GAGAAATGCAGGGAAGCTGAGGG + Intronic
1052836045 9:33250819-33250841 GAGGAATGAGAGGATGATGCAGG + Intronic
1055238701 9:74157559-74157581 GAGAAAGGCTGCCATGCTGCAGG - Intergenic
1055550185 9:77425937-77425959 GAGAAGAGCTGGGATGCTACAGG - Intronic
1056018242 9:82415014-82415036 GGGGAATGCTGGCACACTGCTGG + Intergenic
1056753314 9:89367275-89367297 GAGGACTGCTGGGGAGCTCCTGG + Intronic
1057913974 9:99041542-99041564 GAGGAGTGCAGAGAGGCTGCGGG + Intronic
1057994832 9:99811729-99811751 GAGGAAAGCAGGGAGGCAGCAGG + Intergenic
1058941043 9:109812803-109812825 GAGCAAGGCAGTGATGCTGCTGG - Intronic
1059538778 9:115110406-115110428 GGGGAAGGCTGGGTTGCTGGGGG + Intronic
1060736890 9:126071687-126071709 CAGGATTGCTGAGATGCAGCAGG - Intergenic
1061275398 9:129567144-129567166 GAGAAAGGCTGGTATGCTGGAGG - Intergenic
1061634995 9:131902057-131902079 GAGGATTGCTGGGTGGCTGGAGG - Intronic
1061781549 9:132999268-132999290 GGGGGCTGCAGGGATGCTGCGGG + Intergenic
1185757854 X:2666278-2666300 GAGCAATGCTGAGAAGCTGGTGG + Intergenic
1186742984 X:12537695-12537717 GGGGAATGGGGGGATGCGGCGGG - Intronic
1187568947 X:20481382-20481404 GAGGAATGCTGTGGTCCTACTGG + Intergenic
1190621016 X:52287309-52287331 GGGGAATGCTGGTACACTGCTGG - Intergenic
1190648360 X:52544171-52544193 GGGCGATGCTGGGGTGCTGCTGG + Intergenic
1190679365 X:52811606-52811628 GGGCAATGCTGGGGTGCTGTTGG + Intergenic
1194962383 X:100250509-100250531 GGGGCATGCTGAGATGCTCCTGG - Intergenic
1199407464 X:147479300-147479322 GAGCAATGGTGGAATTCTGCTGG - Intergenic
1200914114 Y:8556360-8556382 GAGGAATGCAGGGATGGAGATGG - Intergenic