ID: 929868232

View in Genome Browser
Species Human (GRCh38)
Location 2:45736348-45736370
Sequence CATGATAGGCGGGAGTTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 107}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929868225_929868232 -2 Left 929868225 2:45736327-45736349 CCCCAGGTCAGAGAGCTATTACA 0: 1
1: 0
2: 3
3: 22
4: 228
Right 929868232 2:45736348-45736370 CATGATAGGCGGGAGTTGGAAGG 0: 1
1: 0
2: 1
3: 7
4: 107
929868227_929868232 -4 Left 929868227 2:45736329-45736351 CCAGGTCAGAGAGCTATTACATG 0: 1
1: 0
2: 2
3: 7
4: 124
Right 929868232 2:45736348-45736370 CATGATAGGCGGGAGTTGGAAGG 0: 1
1: 0
2: 1
3: 7
4: 107
929868226_929868232 -3 Left 929868226 2:45736328-45736350 CCCAGGTCAGAGAGCTATTACAT 0: 1
1: 0
2: 9
3: 73
4: 554
Right 929868232 2:45736348-45736370 CATGATAGGCGGGAGTTGGAAGG 0: 1
1: 0
2: 1
3: 7
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929868232 Original CRISPR CATGATAGGCGGGAGTTGGA AGG Intronic
900271542 1:1792310-1792332 GATGATAGGTGGGAGTAGGGTGG - Intronic
900624140 1:3600487-3600509 GAGGACAGGCGGGAGCTGGAGGG + Intronic
900663040 1:3795661-3795683 CAGGAGAAGGGGGAGTTGGAAGG + Intronic
903540179 1:24092373-24092395 GATGCTGGGCGGGAGTGGGAAGG - Intronic
905732427 1:40305988-40306010 CATGATGGGTGGGAGGTGGCAGG + Intronic
907839867 1:58146512-58146534 CATGATTGCCAGGAGTGGGAAGG - Intronic
910430407 1:87154406-87154428 CAAGACAGGTGGCAGTTGGATGG + Intronic
912765096 1:112401698-112401720 CATGAAAGGCGGGAGTTTGTGGG + Intronic
913485195 1:119327394-119327416 CATGAAAGCCGGGAGCAGGAGGG - Intergenic
916070344 1:161166360-161166382 CTGGATTGGCGGGACTTGGAAGG - Intergenic
918002800 1:180513323-180513345 CATGTCAGGCAGGAGTTGCATGG + Intergenic
920507488 1:206526690-206526712 CATTAAAGGCAGAAGTTGGAGGG + Intronic
923456066 1:234166673-234166695 CAGGATAGGAGGGAGCAGGAAGG + Intronic
924069290 1:240259388-240259410 CATGAAAGGCAGTAGTTGAAGGG + Intronic
924318996 1:242828488-242828510 CATGATCGGCGTGAGTTGGAGGG + Intergenic
1068168001 10:53356188-53356210 AATGATAGGGGAGACTTGGAAGG + Intergenic
1069841299 10:71341080-71341102 AATGAGAGGCAGGAGCTGGAAGG - Intronic
1070730942 10:78827964-78827986 CATCACAGGCTGGAGGTGGAGGG - Intergenic
1072692823 10:97583004-97583026 CATGAAAGGCCAGAGCTGGAAGG + Intronic
1074071453 10:110073863-110073885 CATGTTAGTCGGGGGTGGGAAGG - Intronic
1075237921 10:120748321-120748343 CATGTGAGGCGGTAATTGGATGG - Intergenic
1076033917 10:127182930-127182952 CATCAGAGGCGGGAGTTGGCAGG + Intronic
1080456276 11:32422417-32422439 AATGATAGGCAGAAGGTGGAAGG - Intronic
1080729001 11:34929053-34929075 CATGGTGGACTGGAGTTGGATGG + Intronic
1083437054 11:62649749-62649771 CATGAGAGGGTGGAGGTGGACGG + Exonic
1083886763 11:65576872-65576894 CTGAAGAGGCGGGAGTTGGAGGG - Intronic
1084119176 11:67058977-67058999 CCTGATGGGCGGGGGCTGGAGGG + Intronic
1085661977 11:78376705-78376727 CATGATGAGGGAGAGTTGGAGGG + Intronic
1088366320 11:109043893-109043915 CAGGAAAGGCAGGAGGTGGAAGG + Intergenic
1088368650 11:109065116-109065138 CAAGATAGGAGGGGTTTGGATGG - Intergenic
1093920701 12:24856360-24856382 CATAATAGGAGGGCATTGGAAGG - Intronic
1103093569 12:118115171-118115193 CATGATTGCTGGGGGTTGGAGGG - Intronic
1103204156 12:119115214-119115236 GATAATAGGTGGGTGTTGGAGGG + Intronic
1117342941 14:54807379-54807401 CATAATAGGGGGAAGTTTGATGG - Intergenic
1117802669 14:59461437-59461459 CATGGTAGGCAAGAATTGGAGGG - Exonic
1118371827 14:65144185-65144207 CATGACAGGCTGCAGTTGAAAGG - Intergenic
1123181896 14:106479261-106479283 CATGAAGGTCGGGAGTTGAATGG - Intergenic
1202945009 14_KI270726v1_random:17468-17490 CATGAAGGTCGGGAGTTGAATGG + Intergenic
1124639660 15:31389627-31389649 CATGGAAGGTGGGAGTAGGATGG + Intronic
1139393682 16:66622731-66622753 CATGAGAGGCAGGTGTGGGATGG - Intronic
1139804696 16:69554735-69554757 CATGCTAGGCAGGAGGAGGAAGG - Intergenic
1142601749 17:1056398-1056420 CAGGATAGGCAGGATTTGGAGGG - Intronic
1147527467 17:41239924-41239946 CATGATAGGGGGAAGTTCCAAGG + Intronic
1148846518 17:50533024-50533046 CATGGAAGGCGGGGGTTGGTGGG + Intronic
1149780311 17:59392218-59392240 CATGATAAGCCTGAGTTGGTTGG + Intronic
1151322130 17:73358651-73358673 CATGAGAGGAGGGGGTTGGTCGG + Intronic
1154402614 18:14056009-14056031 CATGCTAGGCGGGCTGTGGAAGG - Intergenic
1155164676 18:23222737-23222759 CATAAAAGGATGGAGTTGGATGG + Intronic
1156804824 18:41165255-41165277 CATAAAAGGAGGGAGTTGGAAGG + Intergenic
1165139947 19:33692919-33692941 CATGAAAGGAGGGAAGTGGATGG - Intronic
1167381394 19:49140236-49140258 CAAGGTAGGCGGGAGGAGGAGGG + Intronic
929868232 2:45736348-45736370 CATGATAGGCGGGAGTTGGAAGG + Intronic
930889362 2:56365034-56365056 CATGACATGCAGGAGTTGCATGG - Intronic
932568966 2:72927482-72927504 CATGATAGGCAGGGGTTGTGTGG - Intronic
936787912 2:116117615-116117637 CATGATAGAGTTGAGTTGGAGGG - Intergenic
939403399 2:141724981-141725003 CATAAAAGGCGGGATTGGGAAGG - Intronic
941765498 2:169292124-169292146 CAGGATTGGCTGGAGTTGAAGGG - Intronic
948113071 2:235472455-235472477 CATGATGAGCTGGAGTTGCAGGG - Intergenic
948608734 2:239153726-239153748 CAAGAAAGCAGGGAGTTGGAGGG + Intronic
1169414470 20:5404165-5404187 GATAATTGGCGGAAGTTGGAAGG - Intergenic
1169634330 20:7671026-7671048 CATGATAGGTGGGATTTTAATGG - Intergenic
1170063465 20:12285242-12285264 CATGATAGGTGGGACTTTGCAGG - Intergenic
1172888901 20:38249797-38249819 CATGATTGGTGGGGGTTGGGGGG - Intronic
1172900890 20:38334152-38334174 CATGATTGTCGTGAGTTGTAAGG + Intronic
1181645069 22:24226531-24226553 CCTGGTAGGGGGAAGTTGGAGGG - Intronic
1183031518 22:35110027-35110049 CATTAAAGGCGGGAATGGGAAGG + Intergenic
1184027609 22:41869557-41869579 CCTGGTAGGCGGGGGTTGCAGGG - Intronic
1184381439 22:44147265-44147287 CATGATAAGAAGCAGTTGGAGGG + Intronic
950201648 3:11048628-11048650 CATGGTAGGAGGCAGTTGGAGGG - Intergenic
956806767 3:72821978-72822000 CAGGAGAGCCAGGAGTTGGATGG - Intronic
957263468 3:77930078-77930100 CATGATATGAAGGAATTGGATGG + Intergenic
965717147 3:171617264-171617286 GATGAGAGGCTGGAGTTGAAGGG - Intronic
970952906 4:21776836-21776858 CCTGAGAGGCGGGGGTTGAAAGG - Intronic
972342618 4:38165679-38165701 CATGATGGAGGGGAGTTGAAGGG - Intergenic
972346453 4:38196515-38196537 CAGGAGAAGGGGGAGTTGGAGGG + Intergenic
981463929 4:145044470-145044492 CATGGTGGGTGGGAGTTGGGGGG - Intronic
982070201 4:151687758-151687780 CATGACAGGCAGGAGTTGAGGGG - Intronic
986146089 5:5079190-5079212 CAGGACAGGCTGGGGTTGGATGG - Intergenic
986749244 5:10771707-10771729 CAAGGTAGGTGGGAGTTGGGGGG - Intergenic
987764166 5:22203664-22203686 CATTATAGGCAAGAGTAGGAAGG - Intronic
991674102 5:69075177-69075199 CAGGACAGGCGGGTGCTGGAAGG - Intergenic
991898897 5:71436748-71436770 CATTATAGGCAAGAGTAGGAAGG - Intergenic
996192975 5:120567952-120567974 CATGTTAGGCCTGAGTGGGATGG - Intronic
1001178651 5:169497273-169497295 CATGGGAGGTGGGGGTTGGAGGG + Intergenic
1003187861 6:3848964-3848986 CATCAGAGGCGGGAGGAGGAGGG + Intergenic
1005801553 6:29430266-29430288 CTTTAGAGACGGGAGTTGGAGGG - Intronic
1012011946 6:93799786-93799808 CTTGATAGGTGGGTGATGGAGGG + Intergenic
1013620147 6:111879941-111879963 CAGGGTAGGAGGGAGTTGGGGGG + Intergenic
1017571015 6:155744424-155744446 CATGATAGGCGAGTGTTCCACGG - Intergenic
1018914169 6:168122595-168122617 CTTGATGGGCGGGAGCTGGTTGG + Intergenic
1019195554 6:170280379-170280401 CAAGACAGGCGGGAGCCGGATGG + Intergenic
1019219454 6:170462799-170462821 GAAGGTAGGCGGGAGTTGAATGG - Intergenic
1024325626 7:48107238-48107260 CATTATAGGCAGGACCTGGATGG + Intronic
1025614686 7:63107422-63107444 CATAATAGGGGGAAGTTTGATGG + Intergenic
1035562276 8:614845-614867 CGTGACAGGTGGAAGTTGGATGG + Intronic
1037107077 8:15122130-15122152 CATGATATGATAGAGTTGGAGGG - Intronic
1039845630 8:41323608-41323630 CAGGACAGGAGGGAGGTGGAGGG + Intergenic
1042857506 8:73282909-73282931 CATGCTAGTCTGGAGGTGGAGGG + Intergenic
1042930340 8:74007143-74007165 CATGACAGGCGGGAGTAGCCTGG + Intronic
1043824654 8:84911670-84911692 CATGAAATGGGGGAGTGGGAAGG - Intronic
1043968447 8:86505077-86505099 CATGCTGGGAGGGAGGTGGAAGG - Intronic
1048542777 8:135357800-135357822 CAGCAGAGGTGGGAGTTGGAGGG + Intergenic
1051682067 9:19617372-19617394 CATGTTAGATGGCAGTTGGAGGG - Intronic
1055976406 9:81959440-81959462 CATGAAAGGGTGCAGTTGGAGGG + Intergenic
1056261575 9:84854159-84854181 AATGACAGGTGGGAGTTGGAGGG + Intronic
1057164440 9:92914782-92914804 CATGGTTGGTGGGGGTTGGAAGG + Intergenic
1057493913 9:95544722-95544744 TAGGATAAGTGGGAGTTGGATGG - Intergenic
1058508770 9:105693995-105694017 CAAGCTAGGTGGGAGATGGAGGG - Intergenic
1060380296 9:123163969-123163991 CATGGGAGGCAGGAGTTGGAAGG + Intronic
1062649778 9:137569576-137569598 CTTGATAGACGGGGGGTGGATGG - Intronic
1185475993 X:416008-416030 AATGAAAGGCGGGATTTGGGCGG - Intergenic
1187223591 X:17354350-17354372 TAAGATAGGCCGGAGGTGGATGG - Intergenic
1188457553 X:30384157-30384179 GATGAAAGGTGGGAGGTGGATGG - Intergenic
1189686305 X:43567281-43567303 CAAGATTGGCTGGAGTTGCATGG + Intergenic
1190444665 X:50511951-50511973 CTTGAGAGGGGAGAGTTGGAGGG - Intergenic
1191980218 X:66917122-66917144 GATGAAAGGAAGGAGTTGGAGGG - Intergenic