ID: 929868832

View in Genome Browser
Species Human (GRCh38)
Location 2:45740772-45740794
Sequence AGGTAGAATCAGAATGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 292}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929868832_929868838 23 Left 929868832 2:45740772-45740794 CCTGCCTCATTCTGATTCTACCT 0: 1
1: 0
2: 3
3: 28
4: 292
Right 929868838 2:45740818-45740840 TTTGAAAGTGCAGTATTACAAGG 0: 1
1: 0
2: 2
3: 19
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929868832 Original CRISPR AGGTAGAATCAGAATGAGGC AGG (reversed) Intronic
900704369 1:4070702-4070724 ATGTAGAATCAGAGAGAGGAAGG + Intergenic
902359946 1:15936950-15936972 GGGTAGCATCAGCAGGAGGCAGG + Intronic
902541679 1:17160003-17160025 AGGTAGAATCAGAGGTAGACTGG - Intergenic
903442010 1:23395280-23395302 AGACAGAGTCAGAAAGAGGCTGG - Intronic
903930983 1:26862425-26862447 AGGTAGACTGAGAAGGAGCCTGG + Intergenic
904056845 1:27676474-27676496 AGGTAGCTTCAGGATGGGGCTGG - Intergenic
904289927 1:29478432-29478454 AGGCTGAATCACAAGGAGGCGGG + Intergenic
904823306 1:33258576-33258598 AGGTAGAAGGAGACTGAGACCGG + Intronic
905021593 1:34818731-34818753 ATCTAAAATCAGAATGAGGCCGG + Intronic
909401507 1:75236935-75236957 AGATAAAATCAGAATGGGGCTGG + Intronic
909676278 1:78242119-78242141 AGGTAGCCTCAGGATGGGGCTGG + Intergenic
909953508 1:81748962-81748984 TCCTAGAATAAGAATGAGGCCGG - Intronic
911594944 1:99788831-99788853 GAGTAGAAACAGAATGAGGAGGG - Intergenic
912026798 1:105185808-105185830 AGGTAGAATGAGAAAGAAGTAGG + Intergenic
914249742 1:145912071-145912093 GAGTAGAATTCGAATGAGGCTGG + Exonic
914344632 1:146788053-146788075 AGTTAGAGTCAGAATGAGGTAGG - Intergenic
915090471 1:153420733-153420755 AGGTGGAATGAGAATGAGAAAGG - Exonic
915095019 1:153456370-153456392 AGGTGGAATGAGAATGAGAAAGG + Intergenic
919973061 1:202593146-202593168 AGGTAGAAAGAGATTGAGCCAGG - Exonic
920081590 1:203378449-203378471 AGTTAGAATCAGAATCACGGAGG - Intergenic
920934483 1:210418373-210418395 AGTTAGCATCAGAATGGAGCTGG + Intronic
921703757 1:218296070-218296092 AGGTAAAATCAGAATGAGGATGG + Intronic
921795415 1:219338067-219338089 ACGTAAAATGAGAATGAGGAAGG - Intergenic
922653820 1:227363705-227363727 AAGTGGAAAAAGAATGAGGCCGG + Intergenic
922759973 1:228122422-228122444 AGGTAGCTTCAGAATGGGGCTGG - Intergenic
922824924 1:228511368-228511390 AGATAGAATGAGAAAGAAGCAGG - Intergenic
923504241 1:234591766-234591788 ATATAGAAACAGAAGGAGGCTGG - Intergenic
924582629 1:245335459-245335481 AGGTAGAATCTGGAGGAGTCTGG + Intronic
1064031038 10:11883041-11883063 AGGTAGAATGACAATGAAGATGG + Intergenic
1064978643 10:21144427-21144449 AAATAAAATCAGAATGGGGCCGG + Intronic
1065588613 10:27242980-27243002 GGGAAGAATCTGAATCAGGCAGG + Intergenic
1065817286 10:29493686-29493708 ACGTAGAATGAGGCTGAGGCTGG - Intronic
1065955567 10:30690791-30690813 ATGTAGAATGAGGCTGAGGCTGG + Intergenic
1067139036 10:43640412-43640434 AGGTAGCTTCAGGATGGGGCTGG + Intergenic
1067167206 10:43874765-43874787 AGGTTGAATCACAATGAGCCTGG - Intergenic
1069481560 10:68787316-68787338 AGCTATAAAAAGAATGAGGCAGG - Intronic
1069518920 10:69102110-69102132 AGGAAGAAACAGGATAAGGCAGG - Intronic
1070102223 10:73399150-73399172 TGGTAGGATCAGAATAAGGAAGG + Intronic
1070385633 10:75921836-75921858 AGGAAGGATCAGAAGGAGGAAGG - Intronic
1070485454 10:76926285-76926307 AATTAGAAACAGAAAGAGGCAGG - Intronic
1070523247 10:77273217-77273239 AGGGAGAATAAGAGAGAGGCAGG - Intronic
1070932448 10:80271009-80271031 AGGAAGACCCAGAATGTGGCGGG - Intergenic
1071702965 10:87962055-87962077 AGGTAGAATAAGAAATAGGAAGG - Intronic
1072363682 10:94686791-94686813 AGGTAGAATCAAAATGATAAAGG + Intronic
1073103765 10:101020725-101020747 AGGGAGAGTGAGAATGGGGCGGG + Intronic
1076239053 10:128888783-128888805 AAGAAGGATGAGAATGAGGCAGG + Intergenic
1076269352 10:129137255-129137277 AGGTAGAGTTTGGATGAGGCAGG - Intergenic
1078413780 11:11148860-11148882 GGGGAGAAGCAGAATGAGGCAGG - Intergenic
1078425101 11:11243470-11243492 ATGTGGAAACAGCATGAGGCTGG + Intergenic
1078540784 11:12211446-12211468 AGTGAGAATCAGCATGAGGCTGG + Intronic
1080585003 11:33674103-33674125 AGGTAGAATGAGAAACAGGCAGG - Intergenic
1081193096 11:40128341-40128363 AGGTTGAATCAGAATAGTGCTGG - Intronic
1081868086 11:46370638-46370660 AGGGAAAATCCGAGTGAGGCAGG + Intronic
1083687368 11:64384636-64384658 AGGGAGAATCAGAAAGAGTGGGG - Intergenic
1085316637 11:75548993-75549015 AGCTAGAAGCAGAAGGATGCAGG + Intergenic
1086174838 11:83878733-83878755 GGGTAGAATGAGCATGAGGGAGG + Intronic
1091057145 11:132429930-132429952 AGCTAGAAGCAGACTGAGGAAGG + Intronic
1091167378 11:133491637-133491659 AGGCAGAATGTGACTGAGGCAGG + Intronic
1091813013 12:3415475-3415497 AGGTAGCTTCAGGATGGGGCTGG - Intronic
1092612144 12:10183963-10183985 AGGTAGATTTAGGATGGGGCTGG + Intronic
1092965105 12:13633851-13633873 AGGGAGAATCAGAAACAGGTGGG - Intronic
1093698953 12:22195953-22195975 ACATAGAAGCAGAAAGAGGCAGG + Exonic
1094091674 12:26656898-26656920 AGCTAGAAGCTGAGTGAGGCTGG - Intronic
1094171490 12:27497442-27497464 TGGTAAAATCAGATGGAGGCTGG + Intronic
1094384938 12:29884185-29884207 AGGAAGATTCAGAATGAAGCAGG - Intergenic
1094389253 12:29931710-29931732 AGGTAGCTTCAGGATGAGTCTGG + Intergenic
1094583065 12:31752146-31752168 AGATAGGATGAGAATGAGACAGG + Intergenic
1095214987 12:39537920-39537942 CAGATGAATCAGAATGAGGCAGG + Intergenic
1096511009 12:52128548-52128570 AAATAAAATCACAATGAGGCCGG + Intergenic
1098040743 12:66351968-66351990 AAGTTGAGTCGGAATGAGGCAGG + Intronic
1100406449 12:94276463-94276485 AGGTGGAACCAGAAGGAGGGAGG + Intronic
1101355061 12:103969058-103969080 AGGCAGCATCAGAAGGATGCTGG + Intronic
1101711974 12:107275968-107275990 AGACAGAATCAGAATTAGGCTGG + Intergenic
1102272078 12:111545664-111545686 AGGAAAAATAATAATGAGGCCGG + Intronic
1102514143 12:113435288-113435310 AGGGAGAAGCAGAGTGAGGGAGG - Intronic
1106611965 13:31292296-31292318 TTTTAGTATCAGAATGAGGCTGG + Intronic
1106803817 13:33285592-33285614 AGGTAGTAGCAGCCTGAGGCTGG + Exonic
1107063716 13:36189086-36189108 AGGAAGAATCAGCATGAGCATGG - Intronic
1107398785 13:40048211-40048233 AGGTAGCTTCAGGATGGGGCTGG - Intergenic
1108101954 13:46966391-46966413 AGGAAGACTCAGGATGAGTCCGG - Intergenic
1109551704 13:63910912-63910934 GGGTACAGTGAGAATGAGGCAGG - Intergenic
1110253533 13:73407113-73407135 AGGAAGAGTCATAATTAGGCTGG + Intergenic
1110306332 13:73991673-73991695 AAGTGGAATCAAAAAGAGGCAGG - Intronic
1110407598 13:75168226-75168248 AGAGAAAAGCAGAATGAGGCAGG + Intergenic
1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG + Intronic
1113245138 13:108386798-108386820 AGAGAGAATCAGAATAAGGATGG - Intergenic
1114918785 14:27299840-27299862 AGATAAAATCAGAATGAAGGGGG - Intergenic
1114993772 14:28320448-28320470 AGGTAGAATAGGAATTATGCAGG - Intergenic
1115558571 14:34562266-34562288 AGGTGGAATCGGACAGAGGCAGG - Intronic
1115788867 14:36856730-36856752 TGCTAGAATCTGAATGAGGCAGG + Intronic
1117642613 14:57816137-57816159 AGGGAGAATCACAATGATGGTGG + Intronic
1119562493 14:75602307-75602329 AGGTAGCCTCAGAAGGGGGCTGG - Intronic
1120957563 14:90096298-90096320 AGGTAGTTTCAGAATGGGGCTGG - Intronic
1120996070 14:90419613-90419635 AGGAAGAGGTAGAATGAGGCTGG + Intergenic
1122313422 14:100811672-100811694 TGTTGGAATGAGAATGAGGCTGG - Intergenic
1122861758 14:104585747-104585769 AGACAGAATCAGAGAGAGGCAGG + Intronic
1123792733 15:23738583-23738605 AGTTAAAACCACAATGAGGCCGG - Intergenic
1124341584 15:28893372-28893394 AGCCAGAATCAGTAAGAGGCTGG - Intronic
1125896466 15:43306980-43307002 AGAATGAATGAGAATGAGGCTGG - Intergenic
1126759406 15:51955606-51955628 AGAAAGAATGAGAATGAAGCTGG + Intronic
1128352893 15:66903235-66903257 TGGTAGAAACAGAATGAGCTGGG + Intergenic
1128464885 15:67902092-67902114 AGATAGCATCAGAATGGGGCTGG + Intergenic
1128720752 15:69946636-69946658 AGGTAGAATAAGAATCAAGAAGG + Intergenic
1128805245 15:70526137-70526159 AGGCAGAAGCAGAATGAGTTGGG - Intergenic
1129263675 15:74382726-74382748 AGCTGGCATCAGAATGGGGCCGG - Intergenic
1129638676 15:77351376-77351398 AAGTATGATCAGAATGAGGCAGG + Intronic
1132345543 15:101106386-101106408 AGGGAGAGAAAGAATGAGGCCGG + Intergenic
1134556933 16:15173516-15173538 AGATAGATTCAGGATGGGGCTGG - Intergenic
1134917512 16:18085234-18085256 AGATAGATTCAGGATGGGGCTGG - Intergenic
1135860313 16:26050160-26050182 AGGTAGCTTCAGGATGGGGCTGG - Intronic
1136361273 16:29781333-29781355 AGGAAGAAAGAGAAAGAGGCTGG + Exonic
1137002070 16:35237837-35237859 ATGCAGAATCAGAATGAAGTAGG - Intergenic
1137018390 16:35397988-35398010 ATGTGGAATCAGAATGAAGCAGG - Intergenic
1137775670 16:51052481-51052503 AGGAAGAAACAGAATGGGGCAGG - Intergenic
1139989360 16:70927253-70927275 AGTTAGAGTCAGAATGAGGTAGG + Intronic
1141087317 16:81105520-81105542 AGATAGCTTCAGGATGAGGCAGG + Intergenic
1141417337 16:83886148-83886170 AGGAGGAAGCAGAAGGAGGCTGG + Intergenic
1141459345 16:84168245-84168267 CGTCAGAGTCAGAATGAGGCTGG - Intronic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1141952401 16:87347395-87347417 AAGATGTATCAGAATGAGGCCGG + Intronic
1142700266 17:1655514-1655536 ACGCAGAATCAGGATGAGACGGG + Exonic
1144158358 17:12531078-12531100 AAATAGAATCTGAAAGAGGCAGG - Intergenic
1144462906 17:15472574-15472596 AGGTAGCTTCAGGATGAGACTGG + Intronic
1147000306 17:37358046-37358068 AAGTAGAAACAGAATCAGGAAGG + Intronic
1150997549 17:70336263-70336285 AGGCAGCATCAGAGTGAGGCAGG - Intergenic
1151276989 17:73042502-73042524 AGCAATAATCAGAAAGAGGCTGG + Intronic
1151742449 17:75992932-75992954 AGTAAGAATCAGAAGCAGGCAGG - Intronic
1153261662 18:3230266-3230288 AGCTAAAATGAAAATGAGGCAGG + Intergenic
1154235671 18:12603452-12603474 AGGTAGCTTCAGGATGGGGCTGG + Intronic
1155725137 18:29072203-29072225 AGCTAGAATCCAAATGAGACAGG + Intergenic
1156581439 18:38381247-38381269 AGTTAGAACCACAGTGAGGCAGG + Intergenic
1157373255 18:47138058-47138080 AGGGAGGCTGAGAATGAGGCAGG + Intronic
1157442190 18:47719610-47719632 AGGTAGGATGAGAAGGAGCCAGG - Intergenic
1157876093 18:51275039-51275061 AGGTAGCCTCAGGATGGGGCTGG + Intergenic
1158243606 18:55405747-55405769 AGGTAGGAAAAGAAAGAGGCAGG + Intronic
1159338860 18:67108199-67108221 AGGTAGAATAATAATGAAGAAGG + Intergenic
1159783786 18:72690745-72690767 AAGTAGAAGCAGAAGGAAGCAGG + Intergenic
1160367306 18:78337436-78337458 AGGTAGGAGCAGCAGGAGGCCGG - Intergenic
1161712293 19:5855707-5855729 AGGTAAAAGCAAAAAGAGGCTGG - Intergenic
1162010056 19:7807667-7807689 AGGTAAAATGAGAATGAGGGCGG - Intergenic
1164076503 19:21823863-21823885 ATTTAGAATCAGCCTGAGGCTGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166252487 19:41580911-41580933 AGGCAACTTCAGAATGAGGCTGG - Intronic
1166586488 19:43953603-43953625 AGGTAGTTTCAGGATGTGGCTGG - Intronic
1166794247 19:45416782-45416804 AGGTGGAGCCTGAATGAGGCAGG + Intronic
1167169902 19:47824125-47824147 CCCTAGAAACAGAATGAGGCTGG - Intronic
1167397600 19:49241469-49241491 TGGAAGAATAATAATGAGGCCGG + Intergenic
1167608262 19:50493215-50493237 AGGTAGAAGGAGAATGGGGAGGG + Intergenic
926640745 2:15233743-15233765 AGGTAAAAACTGTATGAGGCTGG + Intronic
927310123 2:21620972-21620994 AGGAAGAAGCAGAATTAAGCAGG - Intergenic
927498563 2:23566396-23566418 AGTTAGAATCAGAACCAGCCTGG + Intronic
928113009 2:28525621-28525643 GGGTAGAATGAGACTGAGCCTGG - Intronic
929576322 2:43055079-43055101 GGGTAGAGTCAGCATGAGGATGG + Intergenic
929868832 2:45740772-45740794 AGGTAGAATCAGAATGAGGCAGG - Intronic
929910954 2:46089185-46089207 ATGTAGAATAAGAATGAGGAGGG - Intronic
930774925 2:55162027-55162049 AGGCAGAATGCCAATGAGGCTGG + Intergenic
931060294 2:58521230-58521252 AGTTAGAATCAGAAAAATGCAGG - Intergenic
931131425 2:59340882-59340904 AGTAAGAAGCAGAATGAGACAGG + Intergenic
931328156 2:61249783-61249805 TGGTAGAAACAGAAACAGGCTGG - Intronic
931819444 2:65936628-65936650 AGGTGGAATCAAAGTGTGGCTGG - Intergenic
932803283 2:74761767-74761789 AGGAAGAATCAGTCTGAAGCAGG + Intergenic
932805170 2:74777279-74777301 AGGCAGGATCAGGAGGAGGCAGG + Intergenic
934517781 2:94999514-94999536 AGGCAGGCGCAGAATGAGGCAGG + Intergenic
935123548 2:100202574-100202596 AGGAAGAATCATAATGACCCAGG + Intergenic
935143607 2:100378026-100378048 AGGGAGAAACAGAAAGAGGTAGG - Intergenic
936048275 2:109203241-109203263 GGGCAGCATCAGGATGAGGCAGG + Intronic
936489934 2:112961271-112961293 AGGCAGCATCAGAATGACGCTGG - Intergenic
936650852 2:114424033-114424055 TGTTGGAATCAGAATCAGGCTGG - Intergenic
937278699 2:120702841-120702863 AGGAAGGAGCAGAATGAGGTCGG - Intergenic
939575147 2:143886843-143886865 AGGTAGCTTCAGGATGGGGCTGG + Intergenic
939918717 2:148081782-148081804 ATGTAGAATAAGAATGGGGAAGG - Intronic
941155751 2:161975903-161975925 AGGTGAAATCAGAGTGAGGTGGG + Intronic
941191947 2:162395582-162395604 AGGCAAAGTCAGAATGAGGGTGG + Intronic
941920987 2:170850524-170850546 AGGTAGAAGCAGACTAAGGAGGG + Intronic
942282744 2:174383241-174383263 AGGTAGAAGGAGAAAAAGGCAGG + Intronic
942648214 2:178137822-178137844 AGCAAAAATCAGCATGAGGCTGG + Intronic
944279935 2:197884446-197884468 ACGTAGCAACAGAAGGAGGCTGG + Intronic
946115496 2:217458427-217458449 AAGGAGAATAAGAAAGAGGCTGG - Intronic
947245792 2:228046905-228046927 ATGTGGAATCATAATGAGGTTGG - Intronic
947810894 2:233003348-233003370 AGGAAGGATCAGAAATAGGCTGG - Intronic
947967238 2:234291555-234291577 AGGTAGCTTCAGGGTGAGGCTGG - Intergenic
948994541 2:241571838-241571860 AGGCAGAGTCTGAATGAAGCTGG + Intronic
949029452 2:241785077-241785099 AGGGAGAATTATTATGAGGCTGG + Intronic
1169300124 20:4434960-4434982 AGCTATAATCACAATGAGCCTGG + Intergenic
1169570755 20:6902568-6902590 TGGCAGAGTCAGAATTAGGCAGG - Intergenic
1169649288 20:7849127-7849149 ATGTAGAATCAGAGTGATCCTGG - Intergenic
1170869681 20:20193908-20193930 AGAAATAATTAGAATGAGGCTGG - Intronic
1171336583 20:24390704-24390726 AGGTAGAATCAGAGGGAAGGTGG - Intergenic
1172327570 20:34048517-34048539 AGTTAGAATTAGAATCAGTCAGG + Intronic
1172674870 20:36661659-36661681 AGGTAGACTGAAAGTGAGGCTGG + Intronic
1174210942 20:48877433-48877455 AGTTAGAATCTAACTGAGGCTGG - Intergenic
1174501340 20:50987259-50987281 AGGAAGAATGAGAAACAGGCAGG + Intergenic
1174718235 20:52783482-52783504 ACGGAGAATCAGAAAGTGGCAGG + Intergenic
1175085734 20:56456984-56457006 AGGGAGTATAAGAATGAAGCAGG - Intronic
1175680013 20:60979340-60979362 AGCTGCAATCAGAAGGAGGCAGG - Intergenic
1175844057 20:62049421-62049443 AGACAGAATCAGAAAGAGGGCGG - Intronic
1177926696 21:27225790-27225812 TGGTAGAAACAGAAGGAGGAGGG + Intergenic
1178775332 21:35544774-35544796 AGGGAGGATCAGCAAGAGGCAGG - Intronic
1180059678 21:45378398-45378420 AGGAAGAATCACAAAGAGCCTGG - Intergenic
1180074991 21:45457668-45457690 AAGCAGAATCTGAATGGGGCAGG - Intronic
1182383890 22:29919040-29919062 AGGGAGAATAAGAAATAGGCTGG - Intronic
1182471860 22:30553787-30553809 AGGTAGAGACAGAGTGAGGCAGG + Intergenic
1183285619 22:36960890-36960912 AAGTGGAATGAGAATGAGGGTGG - Intergenic
1183464904 22:37974736-37974758 AGGTTTTTTCAGAATGAGGCAGG - Intronic
1183671587 22:39276053-39276075 AGGTAGAAGCAGCAGGTGGCCGG + Intergenic
1184506421 22:44906530-44906552 AGCTAGCATCTGAATGAGTCTGG - Intronic
1185020426 22:48371422-48371444 AGGTAAAATGAGACTGAGTCTGG - Intergenic
949978231 3:9480204-9480226 AGGTAGAATCAGGTTGTGGTTGG - Intergenic
950063118 3:10088984-10089006 AGATAGAATCATCATCAGGCTGG + Intronic
950177861 3:10888390-10888412 AGGAAGAATCTGACTGAGGATGG + Intronic
950699583 3:14731487-14731509 AGGTAGAATCTGAAGGACACAGG + Intronic
951219154 3:20051288-20051310 AGGTAGAATGATAAGGAGGTGGG + Intronic
951346133 3:21548254-21548276 AGGTAGAAACAGTATCAGCCAGG - Intronic
951601242 3:24378112-24378134 AGGCAGAAACTGAATCAGGCAGG + Intronic
952037543 3:29221029-29221051 GGGTAGAATGAGAAAGGGGCAGG - Intergenic
952235145 3:31471632-31471654 AGCCAGAAACAGAATGAGCCAGG + Intergenic
952967772 3:38631757-38631779 AGCTGGAGTCAGAATGAGGCTGG - Intronic
953115218 3:39986259-39986281 AAGTGTAACCAGAATGAGGCTGG - Intronic
953500001 3:43424101-43424123 GGGCAAAGTCAGAATGAGGCTGG - Intronic
953624324 3:44558151-44558173 AGGTAGAATCAGTAGGAGAGAGG + Intronic
954392775 3:50276109-50276131 AGGGAGAATCCGAAAGAGGCGGG - Intronic
955266820 3:57452065-57452087 AGGCAGAAAGAGACTGAGGCAGG - Intronic
955338679 3:58107965-58107987 AGGTCAACTCAGAATAAGGCAGG + Intronic
957842754 3:85692931-85692953 AAGAAAAATCAGAAGGAGGCCGG + Intronic
957842853 3:85693589-85693611 AGAAAAAATCAGAAGGAGGCTGG + Intronic
961445814 3:126980967-126980989 AGTTAAAACCACAATGAGGCTGG + Intergenic
961581970 3:127890781-127890803 AATCAGAATCAGAATGAGTCAGG - Intergenic
963290090 3:143478448-143478470 AGGCAGAGTCAGCAGGAGGCTGG + Intronic
965784333 3:172320081-172320103 TGGAAGAATCTGAAAGAGGCCGG + Intronic
966531983 3:180991263-180991285 AGGTATCATGAGAATGAGGAAGG - Intergenic
967117916 3:186358556-186358578 AGGTGGAAACAAAATGTGGCTGG - Intronic
969959271 4:10927027-10927049 AGATAGAATCAGTATGCGACTGG + Intergenic
970439021 4:16063895-16063917 AGGTAGAACCAGAGTAAGACTGG + Intronic
973996225 4:56462124-56462146 ATGAAGAATCAAAATGAGGACGG + Intergenic
974348516 4:60714505-60714527 AGGGATAATGAAAATGAGGCAGG - Intergenic
978023754 4:103847158-103847180 TTGTAGAATCAGGATGATGCTGG - Intergenic
978334730 4:107654182-107654204 AGGTAGACTGAGAAAGAAGCTGG - Intronic
978627921 4:110708486-110708508 AGGAAGAAACAGAAAAAGGCTGG - Intergenic
981454758 4:144940567-144940589 CGGTAGAATAGGAATGAGGATGG - Intergenic
982516864 4:156363462-156363484 TAATAGAATCAGAATGATGCTGG - Intergenic
982782740 4:159507988-159508010 ATGTATCATCAGAATGGGGCCGG + Intergenic
984574375 4:181429897-181429919 AGTTAGAATAAGGAAGAGGCAGG - Intergenic
984932156 4:184857589-184857611 AGTTAGAATGAGCATTAGGCCGG - Intergenic
985078093 4:186238054-186238076 AGTTAGGGTGAGAATGAGGCAGG - Intronic
985139321 4:186822353-186822375 AGGTAGCTTCAGGATGGGGCTGG - Intergenic
985427179 4:189842462-189842484 AGATAGCTTCAGAATGGGGCTGG - Intergenic
985718261 5:1475120-1475142 AGGATGAAGCAGAGTGAGGCGGG + Intronic
986707242 5:10462159-10462181 AGGTAGCTTCAGGATGGGGCTGG - Intronic
989615917 5:43336437-43336459 AGAATGAATCAGAATGAGTCAGG + Intergenic
992394227 5:76357005-76357027 AGGTAGCCTCAGGATGGGGCTGG + Intergenic
995053602 5:107734540-107734562 GGGTGGGATCAGAATGTGGCAGG + Intergenic
995559899 5:113369270-113369292 AGGTAGCTTCAGGATGAGGCTGG - Intronic
996623372 5:125538112-125538134 AGGTAGCTTCAGGATGGGGCTGG - Intergenic
997194940 5:131973110-131973132 AGGAAGAATGAGAAAGAGTCAGG + Intronic
999088404 5:148913315-148913337 AGGATGAAGCAGCATGAGGCAGG - Intergenic
999320807 5:150613952-150613974 ATGGGGAATCAGAAGGAGGCTGG + Intronic
1000237555 5:159376587-159376609 AGGTAGGGTCAGGATTAGGCAGG - Intergenic
1002282933 5:178143749-178143771 AGGTCGAAGCAGAATGCTGCTGG - Intronic
1003099414 6:3165539-3165561 AGGTAGCTTCAGGATGGGGCTGG - Intergenic
1005870875 6:29974050-29974072 ATATAGAATTAGAAAGAGGCTGG + Intergenic
1007226780 6:40320798-40320820 AGGAAGAAGCAGCATGAGTCTGG + Intergenic
1008326394 6:50187350-50187372 AGGCAGAATGACAATGAGGATGG - Intergenic
1008654182 6:53594383-53594405 AGGTGGAATCTGAAGCAGGCAGG - Intronic
1010853492 6:80807489-80807511 AGTTAGTATGAGAATGAGGAAGG + Intergenic
1010854313 6:80818662-80818684 AGGTAGAAGAAGGTTGAGGCTGG + Intergenic
1012815249 6:104016021-104016043 AGGTGGAATCAGAAAAAGACAGG - Intergenic
1013041319 6:106436587-106436609 AAGTAGAATAAGATTGCGGCCGG - Intergenic
1013434538 6:110089090-110089112 AGGTTGAATCAGAAACAGACAGG + Intergenic
1013862457 6:114652218-114652240 AGGGAGAAGCAGAATTGGGCAGG - Intergenic
1013902233 6:115171133-115171155 AGGGAAAATCAGCATGAGTCAGG - Intergenic
1015472544 6:133621963-133621985 AACTTGAAACAGAATGAGGCAGG - Intergenic
1015542429 6:134328635-134328657 ACTTAGAAAAAGAATGAGGCTGG - Intergenic
1017832315 6:158141668-158141690 AGGAAGAATCAAAAAGAGCCAGG + Intronic
1019448324 7:1082917-1082939 AGATAAAATCAGACTGAGGTGGG + Intronic
1020190027 7:5988450-5988472 AGGGAGAATGAGAATGAGGCAGG + Intronic
1020292895 7:6736225-6736247 AGGGAGAATGAGAATGAGGCAGG - Intergenic
1020987194 7:15150791-15150813 TGTTAGTATCAGAATGATGCTGG + Intergenic
1021467339 7:20959997-20960019 AGGAAGAAACAGAAGGAGGGAGG - Intergenic
1021650001 7:22823683-22823705 ACGTACCTTCAGAATGAGGCAGG - Intergenic
1022833344 7:34090396-34090418 AGGGAGAAGCAATATGAGGCTGG - Intronic
1023466756 7:40464448-40464470 AGGGACAAACAGAATTAGGCAGG + Intronic
1023567813 7:41540940-41540962 AGGAAGAAACAGGAGGAGGCTGG + Intergenic
1024906812 7:54392478-54392500 AGGGAGAATTATTATGAGGCTGG + Intergenic
1027643774 7:80770647-80770669 AGGTAGACTGAAAATGAGGTAGG - Intronic
1028491353 7:91415415-91415437 AGGGACAACCAGAATGAAGCAGG - Intergenic
1030424253 7:109353235-109353257 GGATAGAAACAGAATGAAGCTGG + Intergenic
1030513460 7:110514082-110514104 ATTTGGTATCAGAATGAGGCTGG + Intergenic
1031613100 7:123850001-123850023 AGGTAGAATTAGAGTGACACTGG + Intronic
1032131814 7:129235403-129235425 AAGAAGAATGAGAAGGAGGCTGG - Intronic
1032592540 7:133205590-133205612 AGATAAAATCAAAATAAGGCTGG + Intergenic
1036098848 8:5755525-5755547 AGGCAGAGTTAGAAGGAGGCAGG + Intergenic
1037944022 8:22975239-22975261 AGGTAGAAACAGGGTGGGGCAGG - Intronic
1039907042 8:41794281-41794303 TGGTTGAAGCAGAGTGAGGCAGG - Intronic
1040739134 8:50550232-50550254 AGGCAGGCTCAGAATGAGGTGGG - Intronic
1041842425 8:62287778-62287800 GGTTAGAATCAGAATGTGGAAGG - Intronic
1041916757 8:63146271-63146293 AGGTGGAATCAGGAGGAGGAGGG + Intergenic
1044533356 8:93333004-93333026 AGGAAGAAACAAAATGAGGAAGG + Intergenic
1045860523 8:106811137-106811159 AGGTAGTACCAGAATTAGGGAGG + Intergenic
1046744199 8:117859848-117859870 ACATAGAATGAAAATGAGGCTGG + Intronic
1047362790 8:124184378-124184400 AGGTGGAAGAAGAATGAGGTTGG + Intergenic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1048200427 8:132369510-132369532 AGGGAGTATAAAAATGAGGCTGG + Intronic
1050360792 9:4829200-4829222 AGGGAAAATCAGAATCAGTCTGG + Intronic
1051187901 9:14479974-14479996 AGGAAGAAGGAGAAGGAGGCAGG + Intergenic
1052592100 9:30511697-30511719 AGGCAGAATCAGAATCAAGTTGG + Intergenic
1053116521 9:35509051-35509073 AATCAGAATCAGAATGAGGCTGG + Intronic
1053485724 9:38454622-38454644 AAGTGGAAGCAGAATGGGGCTGG - Intergenic
1054817144 9:69486246-69486268 AGTCAGAATTAAAATGAGGCCGG - Intronic
1055685111 9:78764871-78764893 AGGTAGCCTCAGGATGTGGCCGG + Intergenic
1058135435 9:101302609-101302631 TGGTTGAATCAGAATGTGGTTGG + Intronic
1058637086 9:107047725-107047747 GGGGAGAGACAGAATGAGGCCGG - Intergenic
1187839430 X:23471517-23471539 AAGTAGTAACAGAATGAAGCAGG + Intergenic
1187947027 X:24436023-24436045 AGGTAGGATAAGGATGAGGTAGG - Intergenic
1189170613 X:38905853-38905875 AGGTAGCATGAGCATTAGGCTGG + Intergenic
1189515540 X:41710691-41710713 AGGTAGTTTCAGGATGAGGCTGG + Intronic
1189516481 X:41717949-41717971 AGGTAGCTTCAGGATGGGGCTGG + Intronic
1189709571 X:43795590-43795612 AGGTAGCTTCAGGATGGGGCTGG - Intronic
1190381640 X:49844863-49844885 AAGTATAATGAGACTGAGGCTGG + Intergenic
1190408969 X:50115665-50115687 GGGTAGCTTCAGAATGAGGATGG - Intergenic
1193979648 X:88166134-88166156 TTTTAGAATCAGAATGATGCTGG + Intergenic
1199798436 X:151226273-151226295 AGGTAAAAGCTGAGTGAGGCTGG + Intergenic
1200205432 X:154312181-154312203 AGGGAGAATGAGAATAAGGCTGG - Intronic
1200577582 Y:4909069-4909091 AGGTAGCCTCAGGATGGGGCAGG + Intergenic
1201317122 Y:12658436-12658458 AGGTAGAACAAGAATGAAGTGGG + Intergenic