ID: 929869441

View in Genome Browser
Species Human (GRCh38)
Location 2:45745760-45745782
Sequence TCACCACTGTTCAGATACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 123}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929869441 Original CRISPR TCACCACTGTTCAGATACTG AGG (reversed) Intronic
912257880 1:108079930-108079952 TCAGAACTGTTCAGATCCTGGGG + Intergenic
915030982 1:152880316-152880338 TCACCACTGTACAGCTGCAGGGG + Intronic
917103082 1:171465277-171465299 TCGCCACTGCTCACATACTTTGG - Intergenic
917533288 1:175855928-175855950 TGACCACTCTTCAGATGGTGGGG - Intergenic
921178063 1:212610042-212610064 TCACCAGTGTCCAGACAGTGGGG + Intronic
921800756 1:219399629-219399651 TCTCCACTGATCAGGTACTATGG + Intergenic
922122258 1:222684034-222684056 CTACCACTGTTAAGATAATGAGG - Intronic
923592890 1:235335808-235335830 TCCCCACTGTTTAGATATTAGGG + Intronic
1065228451 10:23571454-23571476 TCACCATTGGTCAAATACAGTGG + Intergenic
1065989227 10:30991554-30991576 GCACCACTGCACAGAAACTGGGG - Intronic
1072738739 10:97896848-97896870 TTAGCACTGTTCATACACTGGGG - Intronic
1072817115 10:98520225-98520247 TCCCCACTGTTCAGAGAATCAGG - Intronic
1072897479 10:99379210-99379232 TTGGCACTGTTGAGATACTGTGG + Intronic
1073517410 10:104088964-104088986 TCCCCACTGTTCAGATGGTTTGG - Intergenic
1074443175 10:113496643-113496665 TCATCACTGTTCAGACAAGGGGG - Intergenic
1080327663 11:31096269-31096291 TTATCATTGTTCAGAAACTGTGG - Intronic
1081540759 11:44033010-44033032 TCACCAGTCTTCTGAGACTGAGG - Intergenic
1082837283 11:57660536-57660558 TCCCAGCTGTTCAGAGACTGAGG + Intronic
1084921063 11:72470249-72470271 TACCCACAGTTCAGATCCTGTGG - Intergenic
1091306867 11:134541895-134541917 TCAGCTCTGGTCAGACACTGTGG + Intergenic
1096424046 12:51485819-51485841 TCACCATTGTGAAGATAGTGAGG - Exonic
1108167482 13:47708646-47708668 TCACCACTTTGCAGACACAGAGG - Intergenic
1113023503 13:105915365-105915387 TCTCCACTATTTAGATACTTTGG - Intergenic
1113308297 13:109102638-109102660 GGACCACTGCTCAGATATTGTGG - Intronic
1115451978 14:33558211-33558233 GCCCCACTGGTCAGAAACTGTGG - Intronic
1116159268 14:41248196-41248218 TAACCTATGTTCTGATACTGAGG - Intergenic
1125130444 15:36278639-36278661 TCATCTCTGTTCAGAGAATGTGG - Intergenic
1125663526 15:41412978-41413000 TCAACACTTTTAAGAAACTGAGG + Intronic
1126807727 15:52368894-52368916 TAACTACTGTACAGATTCTGAGG + Intronic
1128685246 15:69679591-69679613 TCAGCACAGTTCAGATAATATGG - Intergenic
1130354354 15:83116523-83116545 TCATCCATGTTCAGATAATGGGG + Intronic
1131751679 15:95515595-95515617 TCACTTCTTTTCAGATGCTGTGG - Intergenic
1133778334 16:8916160-8916182 TCACCACTGTACAGTGACTCAGG + Intronic
1135573254 16:23565650-23565672 CCCCCATTTTTCAGATACTGAGG + Intronic
1136124134 16:28164383-28164405 TCAGCACTGTCCAAATAGTGGGG + Intronic
1138261808 16:55629117-55629139 TCACCACTGCTAACATACTTTGG + Intergenic
1143837328 17:9702738-9702760 TCTCCACCGTGCAGATAGTGTGG + Intronic
1155159604 18:23185043-23185065 TCACACCTGTTCAGCTCCTGAGG + Intronic
1155825257 18:30434452-30434474 CCACCACTTTGCAGATAGTGAGG + Intergenic
1156035573 18:32763496-32763518 TCAACACTATTCAGATAATTGGG + Intronic
1158591096 18:58779501-58779523 TCACCTATATTCAAATACTGGGG + Intergenic
1159106640 18:64008798-64008820 TAAACACTGGTCAGATTCTGGGG + Intergenic
1160142542 18:76338514-76338536 TCCCCACTGGTCAAGTACTGGGG + Intergenic
1160391645 18:78538670-78538692 TCCCCACTGATCAAGTACTGTGG + Intergenic
1164183776 19:22843441-22843463 TCTCCAGTTTTCAGATACTTGGG + Intergenic
1165609038 19:37134288-37134310 TCACCACTGTCCAGGAAATGTGG + Intronic
1166856042 19:45783057-45783079 TCACCCCTGTTCAGGCTCTGAGG - Exonic
1168045360 19:53790370-53790392 TTACTTCAGTTCAGATACTGTGG - Intergenic
1168516697 19:57015205-57015227 TCACTCCTCTTCAGACACTGTGG + Intergenic
927303844 2:21547559-21547581 TAACCACAGTTCAGACACTTGGG + Intergenic
927464371 2:23325919-23325941 TCACCAATGCTCAGAGATTGTGG - Intergenic
929607132 2:43242112-43242134 TGAGCACTGTGCAGATACAGTGG - Intronic
929869441 2:45745760-45745782 TCACCACTGTTCAGATACTGAGG - Intronic
931988962 2:67770135-67770157 TAGCCACTGTTCAGATTTTGAGG - Intergenic
933515641 2:83297501-83297523 TCACTAATGTGTAGATACTGTGG + Intergenic
934709922 2:96508195-96508217 TCTCCGCTGTGCAGAGACTGAGG + Intergenic
937126479 2:119478008-119478030 TGACCACGGTTCAGAGACTGTGG - Intronic
940246361 2:151621629-151621651 CCACCACTGTTCAATTTCTGTGG + Intronic
1170803924 20:19613298-19613320 TGGGCACTGTTCAGATACTGAGG - Intronic
1172037534 20:32020211-32020233 TCACCACTGTTTTTATACGGAGG - Intronic
1174127406 20:48317209-48317231 TCTCCACTGTTCAGAGGCTTAGG - Intergenic
1174361716 20:50033012-50033034 TCAGCACTCTCCTGATACTGAGG - Intergenic
1178776928 21:35560583-35560605 ACATCACTTCTCAGATACTGGGG - Intronic
1180832736 22:18914307-18914329 TTAGCACTGCTCAGATACTGGGG + Intronic
1181067129 22:20312092-20312114 TTAGCACTGCTCAGATACTGGGG - Intergenic
1181633423 22:24163338-24163360 ACACCTGTGTACAGATACTGTGG + Intronic
1183108219 22:35629773-35629795 TCACCACTGATCAAATACACAGG + Intronic
1203282821 22_KI270734v1_random:139612-139634 TTAGCACTGCTCAGATACTGGGG + Intergenic
949850468 3:8415453-8415475 TGATTACAGTTCAGATACTGAGG - Intergenic
953736477 3:45498222-45498244 TCACTGCTGTTCACAAACTGGGG - Intronic
960050971 3:113239301-113239323 ATACAACTGATCAGATACTGGGG + Intronic
961706269 3:128788428-128788450 TAACCACTCATCATATACTGTGG - Intronic
962017639 3:131458763-131458785 TGACCACTGGACAGATACGGTGG - Intergenic
965282299 3:166769510-166769532 TCACCCCTGGCCAGATACAGTGG - Intergenic
966568565 3:181412425-181412447 TCAACAGAGTTCAGATACAGAGG + Intergenic
967230564 3:187333923-187333945 TCACCATTTTTCAGATACAAAGG - Intergenic
967610088 3:191494851-191494873 TCCCCACTGTGCAGTTACTCTGG + Intergenic
969347396 4:6577854-6577876 CCAGCACTGTTCAGGCACTGGGG - Intronic
973085761 4:46057823-46057845 TAACCACTGTTTATTTACTGAGG - Intronic
973792866 4:54394637-54394659 TCACCACTGTTCAGAGAGGGAGG - Intergenic
974099935 4:57405490-57405512 TCATCATTATTCAGAGACTGTGG - Intergenic
976769147 4:88632637-88632659 TCACCTCTGTTCTGCTACTGAGG - Intronic
977998557 4:103527611-103527633 TCACTACAGTTAAGAAACTGAGG + Intergenic
982204084 4:152984012-152984034 TCACCACTGCTGAGAGACAGAGG + Intergenic
982547313 4:156750351-156750373 TAACCAGAATTCAGATACTGTGG - Intergenic
983378890 4:166966598-166966620 TCTTCACTGCTCAGAAACTGCGG - Intronic
985480296 5:106172-106194 TCACCACTGTAAAAATTCTGAGG + Intergenic
986396501 5:7335960-7335982 TCACCATTGTTCTGTTACTTAGG + Intergenic
986578661 5:9239937-9239959 TCAAAATTGTTCAGATCCTGCGG + Intronic
990099952 5:52170082-52170104 TCAGCACTGGTGAGATATTGGGG + Intergenic
992608951 5:78490855-78490877 TTCCCACTTTTTAGATACTGGGG + Intronic
994854865 5:105105546-105105568 ACAGCACTGTGAAGATACTGAGG + Intergenic
998061016 5:139118864-139118886 TCACCCCACATCAGATACTGAGG + Intronic
1002347116 5:178555804-178555826 TCACTACTGTTCACAGACGGTGG + Intronic
1005373235 6:25156308-25156330 TCCCCACTGTTCATATCCTCTGG + Intergenic
1005421312 6:25654292-25654314 TCACCACTGTTGAGAACATGGGG + Intronic
1010954060 6:82070397-82070419 TCTCCACTCCTCAGGTACTGTGG - Intergenic
1012235017 6:96803536-96803558 CGACCACTGTACAGATACTGAGG - Intronic
1013005521 6:106069597-106069619 TCTCCACTGCTCAGATACCGTGG + Intergenic
1014056438 6:117021209-117021231 TCAAATCTGTGCAGATACTGAGG + Intergenic
1015981919 6:138847815-138847837 TCACAAATGTTCAGACACAGAGG - Intronic
1017101374 6:150852457-150852479 AAACCACTGGGCAGATACTGAGG + Intergenic
1020769408 7:12369448-12369470 TAAACACTGTTAGGATACTGAGG + Intronic
1023280396 7:38563538-38563560 TCACAGCTATTCAGATCCTGGGG - Intronic
1023481107 7:40635808-40635830 TCACCATTGTGCAGATACCCAGG + Intronic
1027391446 7:77707883-77707905 TCAGCACTTTACATATACTGTGG + Intronic
1031008742 7:116501325-116501347 TGACAACTGTTGTGATACTGGGG - Intronic
1031025947 7:116680386-116680408 TCCCAACTGTTCAAATACTCAGG - Intronic
1031819341 7:126480076-126480098 ACACCATTGTTCAGTTACTCAGG - Intronic
1031987245 7:128171177-128171199 GTCCCACTGTTCAGAAACTGGGG + Intergenic
1035706072 8:1676059-1676081 TCAGCACTGATCAGAAACAGAGG - Intronic
1038819829 8:30942144-30942166 TCGCCACTGCTCAGAAACTCTGG - Intergenic
1040452294 8:47560305-47560327 TCTCCACTGTACAGATTCTTGGG + Intronic
1040911787 8:52527106-52527128 TGACATCTGTTCAGCTACTGAGG + Intergenic
1041082410 8:54226180-54226202 TCACCACTACTCAGAGGCTGAGG - Intergenic
1041750799 8:61259116-61259138 TCATCTCTGTTTAGAAACTGAGG + Intronic
1042136511 8:65637819-65637841 TCACCACTTTCCAGAGATTGTGG - Intergenic
1042397159 8:68306172-68306194 TCACCACTGCTAACATACTTTGG + Intronic
1042556424 8:70037130-70037152 TCACAACTGCTCAGTTTCTGGGG + Intergenic
1044523039 8:93221942-93221964 TCACCACTGTAAAGATGTTGCGG - Intergenic
1046563078 8:115863930-115863952 TCACCACTGATGAGATGCGGAGG + Intergenic
1047555883 8:125929805-125929827 TCAACTCAGCTCAGATACTGGGG - Intergenic
1048099263 8:131330817-131330839 TCACCAGGGTTCAGAAATTGGGG + Intergenic
1049263738 8:141653787-141653809 TGAGCACTGTGCAGAAACTGAGG - Intergenic
1049403300 8:142440515-142440537 TCACCACTGTTGACACAGTGAGG + Intergenic
1053004827 9:34597424-34597446 TCACCACAGTTGAGTTTCTGGGG - Intergenic
1053334665 9:37255865-37255887 TCAGCACTGTTAAGAATCTGTGG - Intronic
1060683999 9:125591397-125591419 TCACCACTGTTTAGGAAATGAGG + Intronic
1186207690 X:7217204-7217226 TGATCCCTGATCAGATACTGAGG + Intergenic
1187551201 X:20307248-20307270 TCATCACAGTTCAAATCCTGAGG - Intergenic
1194575260 X:95605360-95605382 TCTCTGCTGTTCAGTTACTGAGG - Intergenic
1199617097 X:149665043-149665065 TTCCCAGTGTTCAGTTACTGAGG + Intergenic
1199625544 X:149738205-149738227 TTCCCAGTGTTCAGTTACTGAGG - Intergenic
1200274549 X:154719229-154719251 TGGACACTGTGCAGATACTGGGG + Intronic