ID: 929871397

View in Genome Browser
Species Human (GRCh38)
Location 2:45762066-45762088
Sequence GCAGCTACTCCCCTAGAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 93}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929871397 Original CRISPR GCAGCTACTCCCCTAGAGAG TGG (reversed) Intronic
903084179 1:20840041-20840063 GTTGCTATTCCCTTAGAGAGTGG + Intronic
905275675 1:36816414-36816436 TCAGCTACTCCAGTAGAAAGTGG + Intronic
906562864 1:46772061-46772083 TCAGCTACTTACCTAGAGATGGG - Intronic
908250063 1:62258778-62258800 GAGGGTTCTCCCCTAGAGAGAGG + Intronic
909536788 1:76745974-76745996 ACAGCCACTCCTCTAGGGAGTGG + Intergenic
913997781 1:143665622-143665644 GCAGCTACTCACCTAGAGCAAGG - Intergenic
914225259 1:145714694-145714716 CCAGCTTCTCCCCTGGAGAAGGG - Intergenic
914508198 1:148307586-148307608 GCAGCTACTCACCTAGAGAAAGG - Intergenic
916871957 1:168925078-168925100 GAAGCTACTTCCATTGAGAGAGG - Intergenic
918123041 1:181556600-181556622 GGACCTTCTCCCCTAAAGAGGGG + Intronic
1064027659 10:11861360-11861382 TCAGCAACTGCCCTAGAGTGTGG - Intronic
1070919923 10:80178157-80178179 GCACCCACTCCCCAGGAGAGAGG + Intronic
1072622818 10:97091257-97091279 CCATCTTCTCCCCTGGAGAGGGG + Intronic
1073287252 10:102396391-102396413 CCAGCCCCTCCCCCAGAGAGAGG - Intronic
1073739055 10:106385349-106385371 ACAGCTACTTCCCCAGAAAGGGG + Intergenic
1077042198 11:529797-529819 CCAGCTCCTCCCCTTGAGGGAGG - Intergenic
1080006362 11:27411826-27411848 TCGGCCACTCCCCTAGAGAATGG - Intronic
1080661846 11:34302903-34302925 GCACCAACTACCCTAGATAGAGG - Intronic
1080871366 11:36239887-36239909 GCAGATGCTCCTCTGGAGAGAGG + Intergenic
1081266490 11:41030276-41030298 GCAGCTATTCCTCAAGAGAACGG + Intronic
1081575178 11:44314701-44314723 GCAGCTACCCCCCCAGCCAGGGG - Intergenic
1083304480 11:61755344-61755366 CCGGCTAATCCCCTAGAGAGAGG + Intronic
1083669207 11:64291197-64291219 GCAGCAACTCCCCCAGAGGTGGG + Intergenic
1084319218 11:68364105-68364127 GCAGGTACCCCTTTAGAGAGGGG - Intronic
1084430624 11:69108837-69108859 GGAGCTCCTCCCCCAGGGAGTGG - Intergenic
1085278601 11:75315624-75315646 CCACGTACTCTCCTAGAGAGTGG + Intronic
1089562727 11:119353014-119353036 GAAGCCCCTCCCCTAGGGAGAGG + Intergenic
1089632793 11:119794053-119794075 GCAGCTACTCCCATGGTGATGGG + Intergenic
1090332042 11:125939946-125939968 GCAGCTACTCCCATTCACAGGGG - Intergenic
1090545541 11:127762751-127762773 GAAGCTACTCCCCAAGAGAAAGG - Intergenic
1096035706 12:48468210-48468232 GCAGCTGCTGCTTTAGAGAGGGG + Intergenic
1100337357 12:93643739-93643761 ACGTATACTCCCCTAGAGAGTGG - Intergenic
1111056057 13:82952752-82952774 GCATCCACTCCCCTGGAAAGGGG + Intergenic
1113293984 13:108938125-108938147 ACAGTCACACCCCTAGAGAGGGG - Intronic
1118510489 14:66466357-66466379 TCAGCTACTTACCTAGAGATGGG - Intergenic
1124167675 15:27342623-27342645 CCAGCTTCTCCCCTTGAAAGAGG - Intronic
1124343798 15:28907827-28907849 GCAGCCACTCCCCTGGGGAAAGG - Intronic
1126319699 15:47408833-47408855 GCACCTACTCCCCAAGACAGAGG - Intronic
1127261469 15:57329752-57329774 GCAGCGCCTCCCCAGGAGAGAGG - Intergenic
1127473306 15:59309614-59309636 GCAGCTACTGCCATACTGAGTGG - Intronic
1129165234 15:73773414-73773436 GCAGGTATTTCCCTCGAGAGAGG + Intergenic
1129245655 15:74277321-74277343 GCAGCTACTCCTCCAGATGGCGG + Intronic
1129652588 15:77501806-77501828 GCACCTTCCCTCCTAGAGAGTGG - Intergenic
1129769387 15:78193760-78193782 GCACCTCCTCCCCTGCAGAGAGG + Intronic
1130014239 15:80174906-80174928 GCACCTGCTCCCCTAGGCAGAGG - Intronic
1139951796 16:70676043-70676065 TCAGCTACTACCTCAGAGAGAGG - Intronic
1140540167 16:75749629-75749651 ACAGCTTCTCCACTAGAGATGGG + Intronic
1142274161 16:89107241-89107263 GCAGCTGCTGCCCTAAAGAAGGG - Intronic
1149557658 17:57585668-57585690 CCAGCTACTCCACTGAAGAGTGG - Intronic
1161241294 19:3225163-3225185 TCAGCTGCACCCCCAGAGAGGGG - Intronic
927495082 2:23546647-23546669 GGAGCTCCTCCCCGGGAGAGGGG - Intronic
928873900 2:36014315-36014337 GGAGCTACTACCATAAAGAGAGG + Intergenic
929653041 2:43701281-43701303 GCAGCTACTTCTCAAGAGAAAGG + Intronic
929762984 2:44821291-44821313 GCAGCTCCTCCCCCAGGCAGAGG - Intergenic
929871397 2:45762066-45762088 GCAGCTACTCCCCTAGAGAGTGG - Intronic
938154760 2:128925044-128925066 GCAGCAAATGCCCTAGAGAAGGG - Intergenic
944355209 2:198779238-198779260 ACAGCTGCTCTTCTAGAGAGGGG - Intergenic
948018563 2:234710702-234710724 GCAGCATCTCCCCTAGCGATGGG + Intergenic
948741824 2:240053417-240053439 GCAGGTGCTCCCAGAGAGAGGGG - Intergenic
1170716849 20:18839309-18839331 GCAGCTCCTCCCGTTGAGAAGGG + Intergenic
1171317685 20:24209797-24209819 GCAGCCACTCCCATAGCTAGTGG - Intergenic
1171992542 20:31708002-31708024 GCAGCTGCTGCCTGAGAGAGTGG + Intronic
1172672871 20:36646275-36646297 GCAGCTGCTCCCCTAGAAACAGG - Intergenic
1173813882 20:45972470-45972492 GGAGCCACGCCCCAAGAGAGCGG - Intergenic
1175822422 20:61917539-61917561 GCAACTCCTCCCCAAGACAGGGG + Intronic
1177926074 21:27217224-27217246 TCAGCTAGTCCCAGAGAGAGGGG - Intergenic
1184378028 22:44127139-44127161 GCAGCTACTCCACAAGAAAAAGG - Intronic
949875906 3:8625987-8626009 GCGGCTGCTGCCCTAGAAAGTGG + Intronic
950181588 3:10917442-10917464 GCAGCTCCTCCCCTATAAAATGG + Intronic
956107353 3:65834006-65834028 GCACCTACTTCCCTAGACACTGG + Intronic
966780402 3:183579597-183579619 GCAGGTACCCACATAGAGAGAGG - Intergenic
971355759 4:25894066-25894088 GCAATTTCTCCCCTAGACAGAGG - Intronic
990614118 5:57489755-57489777 GCAGCTACTCCCCTTAGAAGAGG + Intergenic
991593858 5:68282438-68282460 GTGGCCACTCCTCTAGAGAGAGG + Intronic
994053047 5:95383560-95383582 CCAGCTTCTCTCCTAGTGAGTGG - Intergenic
995976312 5:118039499-118039521 GCAGATACTGCCTTATAGAGGGG - Intergenic
996451086 5:123625598-123625620 GCAGGTACTCCCCTAAAGTCAGG - Intergenic
1004029562 6:11853008-11853030 ACATATACTCCCCAAGAGAGTGG - Intergenic
1007610723 6:43147188-43147210 GCAGCTACAGCCCAAGGGAGAGG - Intronic
1016111447 6:140230286-140230308 CCATTTACTCCCCTAGAAAGGGG + Intergenic
1016252073 6:142055659-142055681 GCAGCTGCTCCCTTAGAGGTAGG + Intergenic
1016408147 6:143753566-143753588 GCAGCTTTTCCCCAAGACAGAGG + Intronic
1016848547 6:148593442-148593464 GCGGCGACTCCTGTAGAGAGGGG - Intergenic
1019609105 7:1927993-1928015 GCAGCTACTTCTCCAGACAGTGG + Intronic
1019731196 7:2630564-2630586 GCACCCACTGCCCTAGAGTGCGG + Intergenic
1022924988 7:35047704-35047726 GCAGCTACTGCCCTAGGCACTGG - Intergenic
1023913930 7:44574350-44574372 GCAGCAACTGCCTGAGAGAGAGG + Intronic
1026110033 7:67451720-67451742 CCACCTCCTCCCCTAGAGAGAGG - Intergenic
1031825247 7:126557073-126557095 GAAGCTGCTCCCCTAAAGAAGGG + Intronic
1035278070 7:157759856-157759878 CCAGCTCCTCCCCAAGAGAGGGG - Intronic
1037405109 8:18533966-18533988 GCAACTGCAACCCTAGAGAGGGG + Exonic
1038535141 8:28348397-28348419 CAAGCTAATCCCCTAGAGAGTGG + Exonic
1040979637 8:53233299-53233321 GCACATCCTCCCCTACAGAGTGG - Intronic
1043253690 8:78106581-78106603 GCATTCACTCCCCTGGAGAGGGG - Intergenic
1047626790 8:126664889-126664911 GCAGATTCTCCCTTAGAAAGTGG - Intergenic
1050594657 9:7193834-7193856 GGGGCTACTTCCCTGGAGAGAGG + Intergenic
1053146433 9:35715177-35715199 GCAGCTGCTCCCTGAGGGAGAGG + Exonic
1058723562 9:107780989-107781011 GAAGCCACACCCCTAGAAAGGGG - Intergenic
1187372995 X:18725914-18725936 GCAGCTCCTCCCTTGGAGAGTGG + Intronic
1193083945 X:77431500-77431522 GAGGCTTCTCCTCTAGAGAGTGG - Intergenic
1195236143 X:102900464-102900486 GCAGCTGTGCCCCTGGAGAGGGG - Intergenic
1196828473 X:119758748-119758770 GCAGCCCCGCCCCTCGAGAGCGG + Exonic
1201644078 Y:16208278-16208300 GCATCAACTCCCCTTGAAAGTGG + Intergenic
1201658737 Y:16377043-16377065 GCATCAACTCCCCTTGAAAGTGG - Intergenic