ID: 929872131

View in Genome Browser
Species Human (GRCh38)
Location 2:45768040-45768062
Sequence CTGGTGAGAAGCAAAATTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 179}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929872126_929872131 -1 Left 929872126 2:45768018-45768040 CCTTGGCATTGGTGCCAGTGCCC 0: 1
1: 0
2: 1
3: 10
4: 207
Right 929872131 2:45768040-45768062 CTGGTGAGAAGCAAAATTGTTGG 0: 1
1: 0
2: 3
3: 14
4: 179
929872123_929872131 16 Left 929872123 2:45768001-45768023 CCTGGAGAGGAGCTATTCCTTGG 0: 1
1: 0
2: 0
3: 26
4: 222
Right 929872131 2:45768040-45768062 CTGGTGAGAAGCAAAATTGTTGG 0: 1
1: 0
2: 3
3: 14
4: 179
929872122_929872131 26 Left 929872122 2:45767991-45768013 CCAGAAGCTTCCTGGAGAGGAGC 0: 1
1: 0
2: 1
3: 26
4: 225
Right 929872131 2:45768040-45768062 CTGGTGAGAAGCAAAATTGTTGG 0: 1
1: 0
2: 3
3: 14
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929872131 Original CRISPR CTGGTGAGAAGCAAAATTGT TGG Intronic
903137871 1:21321195-21321217 CTGGGGAGCAGCAAGATTGTGGG - Intronic
904808154 1:33146163-33146185 CTGGTGGCTTGCAAAATTGTTGG - Exonic
907038194 1:51235406-51235428 CTGATGAGAAGCAGAAAGGTTGG + Intergenic
907441613 1:54481982-54482004 ATGGTGAGAAACAAGAGTGTTGG - Intergenic
907659399 1:56378176-56378198 CTGGTGAGATGCAAAATAAAAGG + Intergenic
909162093 1:72165298-72165320 TTAGTAAGAAGCAAAATAGTTGG + Intronic
910119475 1:83769878-83769900 CTTGAGAGAAGCAAACTTTTAGG - Intergenic
917382296 1:174426116-174426138 CTGAAGGGAAACAAAATTGTTGG - Intronic
920710557 1:208290666-208290688 CTGGTGAGAAACTAAATTGGTGG + Intergenic
923030772 1:230247526-230247548 ATGGTGAGAAGTAAAATGTTTGG + Intronic
923586884 1:235281080-235281102 CTGGTGAGAAGCCACCTTGATGG - Intronic
1064986703 10:21217538-21217560 CTGTTGAGAAAAAAAAGTGTAGG + Intergenic
1065875038 10:29990298-29990320 CTGGTGAGAGTGAAAATTGGAGG - Intergenic
1066189310 10:33041499-33041521 CTGGTGAAAAAAAAAATTGCTGG - Intergenic
1067734298 10:48837454-48837476 CTGGTGGGGAGCCAAACTGTGGG + Intronic
1068506183 10:57902138-57902160 GTGGGGAGAAGCAAATTTGAGGG + Intergenic
1068865254 10:61888417-61888439 ATGGTGAGAAGGCAAATTGAGGG + Intergenic
1069173850 10:65265460-65265482 CTGGTGGGAAAGAAAATGGTAGG + Intergenic
1070359621 10:75674749-75674771 CTGCAGAGTAGCAGAATTGTTGG + Intronic
1071194456 10:83141646-83141668 CAACTGAGAAGCAAAATAGTTGG + Intergenic
1072034451 10:91551657-91551679 ACAGTGAGAAGCAAAACTGTGGG + Intergenic
1072443444 10:95477496-95477518 ATGGGGAGAAGCAAAGTTTTTGG + Intronic
1072806705 10:98428082-98428104 CTGTTGAGAAGCAGAGTTCTGGG - Intronic
1073599072 10:104829262-104829284 CTGGTGAGTAGCAAAATTGGAGG + Intronic
1076548659 10:131263050-131263072 CAGTTTAGAAGCACAATTGTTGG + Intronic
1077142584 11:1031019-1031041 CTGGAGGGCAGCAAACTTGTGGG + Exonic
1079939820 11:26665605-26665627 CTGTTGAGAATAAAAATGGTTGG - Intergenic
1080769180 11:35324820-35324842 CTGGAAATAAGCAAATTTGTTGG - Intronic
1081051516 11:38347978-38348000 GTGGTGAGAAACAAAAATTTGGG + Intergenic
1081256579 11:40904456-40904478 CGGGAGAGAAGAAAAACTGTTGG - Intronic
1081495153 11:43601819-43601841 CTGGTGAGAAGCAAACTGAGAGG - Intronic
1082078908 11:47996810-47996832 ATGGTGAGAAGAGAAATCGTTGG + Intronic
1084944495 11:72631435-72631457 CTGGAGAGAAGCAGAAGTGGAGG - Intronic
1085526064 11:77165003-77165025 CTGAAGAGAAGCAAGCTTGTAGG + Intronic
1085715641 11:78870843-78870865 CTGGTGACAAGGCAAGTTGTAGG + Intronic
1086573863 11:88315746-88315768 TTCGTGAGAAGACAAATTGTAGG - Intronic
1088121351 11:106374407-106374429 CTCTTGAGAATTAAAATTGTAGG - Intergenic
1088840593 11:113624442-113624464 CCAGTGAGAATCAAAATTTTGGG + Intergenic
1089296609 11:117472712-117472734 CTGATGTTTAGCAAAATTGTAGG + Intronic
1089917365 11:122171233-122171255 CTGGTGCCAAGCACAATGGTTGG - Intergenic
1089976610 11:122737682-122737704 CTGGAGAGAAGCAAAATTGGCGG + Intronic
1091168814 11:133502746-133502768 CTCCTGAGAAGCAGAATAGTGGG - Intronic
1091825757 12:3511513-3511535 CAGGTGAGAAACAAAAGTGAAGG - Intronic
1094391242 12:29952668-29952690 GTGGTGTGAACCAAATTTGTTGG - Intergenic
1100217798 12:92470419-92470441 CTCGTCAGAAGGAAAAGTGTGGG - Intergenic
1101249982 12:102923572-102923594 ATGGTGAGAATCAAAAATTTTGG - Intronic
1101453444 12:104804195-104804217 CTGGTCAGCAGCAAAATTTTTGG + Exonic
1103845764 12:123901117-123901139 ATGCTGAGGAGCAAAATTGTGGG - Intronic
1108613257 13:52105354-52105376 TTGGTGGGAAACAAATTTGTGGG + Intronic
1108885275 13:55173519-55173541 CTATTGAGATGCAAAATTGTAGG - Intergenic
1108914994 13:55597480-55597502 CTGGTGAACTGCAAAAATGTAGG - Intergenic
1109255209 13:60071948-60071970 CTGATGGGAAGCAGAATTGGGGG - Intronic
1111194799 13:84860453-84860475 CTGGATAGAAAAAAAATTGTTGG - Intergenic
1111261277 13:85743915-85743937 CTTGTAAGAAGAAAAATTGCTGG - Intergenic
1113717090 13:112518294-112518316 CTGTTGAGAAGGAATATAGTTGG - Intronic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1116086412 14:40244327-40244349 GTGGTGACAACCAAAAATGTTGG + Intergenic
1116308611 14:43291805-43291827 ATGGTGGGATGCAAAATTGTAGG + Intergenic
1120580183 14:86237915-86237937 CTGGGCAGAGGCAAAAGTGTTGG - Intergenic
1122757624 14:103995205-103995227 CTGGTTAGAAGCCATATTCTAGG + Intronic
1127775843 15:62263845-62263867 CTGGGGAGATGCAAGATTGTTGG - Intergenic
1128054371 15:64688861-64688883 CTGATGAGAAACACAATGGTAGG + Intronic
1128262712 15:66243555-66243577 GTTGTGAGATGCCAAATTGTTGG + Intronic
1129534438 15:76300580-76300602 TTGGTAGGAAGCAGAATTGTAGG - Intronic
1132100278 15:99018176-99018198 CAGGTGAGGAGGAAAATTGAGGG + Intergenic
1132221840 15:100110945-100110967 CTGGTGAGAAGCAGACTTCGTGG - Intronic
1133247811 16:4461002-4461024 CTGCTGGGAAGCAAAACTGAAGG - Intergenic
1134096853 16:11424027-11424049 CTGGGCAGAAGCAAAGCTGTTGG + Intronic
1135276986 16:21121734-21121756 CTTGTTAGAAGCACAATTCTGGG + Intronic
1135564481 16:23500825-23500847 ATGGTCAGAAGCAAAATATTTGG - Intronic
1137947642 16:52750345-52750367 CTGGTGAGAAAATAAATTCTTGG - Intergenic
1138358344 16:56404351-56404373 ATGGTGAGAATTAAAATAGTTGG - Intronic
1141000456 16:80302712-80302734 GAGGTGAGAGGCAGAATTGTGGG - Intergenic
1141040754 16:80670602-80670624 CTGGTGAGAAGCCAGATGGGTGG - Intronic
1143912767 17:10265568-10265590 ATGGTTAGAAGCAGAATTGGGGG - Intergenic
1151102587 17:71572850-71572872 CTAGTGGGAAGCTAAATAGTTGG + Intergenic
1151135171 17:71939431-71939453 CTGTTGAGTAGCAAAACTTTAGG - Intergenic
1151861357 17:76765064-76765086 CTGGGGTGAAGCAAAATCTTAGG - Intronic
1152061571 17:78079798-78079820 CTGGTCAGAAGCAATATTGAGGG + Intronic
1152160915 17:78668150-78668172 CTGGTGAGTAGCAGAGTTGATGG - Intergenic
1152969529 18:148376-148398 CTGATGAGAAGTGAGATTGTAGG + Intergenic
1153333674 18:3900301-3900323 CTGATGAGAAACAACAATGTCGG - Intronic
1154248525 18:12722155-12722177 TTGGTCAGAAGCAAAAGTTTAGG - Intronic
1155415296 18:25592341-25592363 CTGGTGAAAAGCAAGCTTGCAGG - Intergenic
1155538746 18:26844705-26844727 TTGGCGTGAAGCAAAATTGAAGG + Intergenic
1157322011 18:46641974-46641996 CGGGTGAGAACCAACAATGTGGG - Intronic
1157448948 18:47771422-47771444 CTGGTCAGAAATAGAATTGTTGG - Intergenic
1161350592 19:3789253-3789275 CTGGTGAGAATCAAATTAGGCGG - Exonic
1163711527 19:18850022-18850044 GTGGTGAAAAGCCAAATTTTGGG + Intronic
1166038792 19:40190100-40190122 CTTGTAAGAGGCAAAATTCTGGG - Intergenic
1167914526 19:52729784-52729806 CTGGTGATAAGCAAAAGTTGTGG - Intronic
925186671 2:1851643-1851665 CCGATGAGAAGCATAATTGCCGG + Exonic
925764010 2:7213505-7213527 CTGGTGTGAAGCAAATGTGTAGG - Intergenic
927461816 2:23305812-23305834 CTGGTGATAAATAATATTGTTGG - Intergenic
928214783 2:29352187-29352209 CTGGTGACAATAAAGATTGTGGG + Intronic
929872131 2:45768040-45768062 CTGGTGAGAAGCAAAATTGTTGG + Intronic
931433163 2:62225874-62225896 CAGGTGAGAACCCATATTGTGGG - Intergenic
932323145 2:70836572-70836594 CTGGTGAGGAGCAGACTGGTGGG + Intergenic
933314462 2:80699552-80699574 TTGGTCAGAAGCAATGTTGTGGG - Intergenic
935044663 2:99469815-99469837 CTGGTGATAAACATAATTCTCGG - Intronic
937596475 2:123681183-123681205 ATGTTGGGAAGCTAAATTGTCGG + Intergenic
937602328 2:123753688-123753710 CTGGTGAGATGAAAAATAGATGG + Intergenic
937645435 2:124261313-124261335 CTGCTGAGAGGGAAGATTGTTGG - Intronic
940600054 2:155847507-155847529 CTGTTGATAATCAAAATTCTTGG - Intergenic
942272062 2:174286382-174286404 CTGGTGAGCAGCTGAATTCTAGG + Intergenic
942833414 2:180263933-180263955 CTGGTGAGAATGAAAAGTCTAGG + Intergenic
943631161 2:190253957-190253979 CTGGAAAGAAGCAGAATTGGGGG - Intronic
943723985 2:191233838-191233860 CAGGTGAGATTCAAAATTATTGG - Intergenic
947037840 2:225879662-225879684 CTGGTGAGAAGGAATATTACAGG + Intergenic
947726515 2:232404679-232404701 CTGGTGAGAATCAAAGTGGCTGG - Intergenic
1172931561 20:38589759-38589781 CTGGATAGAAGCACACTTGTGGG - Intergenic
1176889464 21:14296753-14296775 CTAGTGATAATCAAGATTGTGGG + Intergenic
1181010445 22:20037223-20037245 CTGGTGAGAAGTCAAAGTGGCGG + Intronic
1184175132 22:42784714-42784736 CTGGGGAGACGGAAGATTGTTGG + Intergenic
1184329069 22:43814523-43814545 CTGGTGAGAAGCATAACAGCAGG - Intergenic
1185382226 22:50514863-50514885 CTGGGGAGAGGCAAGATTTTAGG - Intronic
952232610 3:31447707-31447729 CAAGTGAGAAGGTAAATTGTAGG - Intergenic
953598206 3:44337813-44337835 CTGGGGGGAATCAAAATTATAGG + Intergenic
955795645 3:62633717-62633739 CTGCTGTGAAGCAAAGATGTAGG - Intronic
957734318 3:84187414-84187436 GTGGTAAGAGGCAATATTGTGGG + Intergenic
959401833 3:105912112-105912134 CTGCTGAGAAAGAAGATTGTGGG + Intergenic
959531069 3:107434007-107434029 TTGATGAGAGGCAGAATTGTGGG - Intergenic
963245295 3:143052928-143052950 CTGGGGATAAGCAAATGTGTTGG + Intronic
965353934 3:167650174-167650196 GTGGTGAGAAGTAAAAATTTTGG - Intronic
965722530 3:171677546-171677568 CTGGTGAGTATCATAATGGTGGG - Exonic
966589507 3:181666034-181666056 CTGATGAAAAGCAAAATATTAGG + Intergenic
967334232 3:188324729-188324751 CTGGAGAGATCTAAAATTGTTGG + Intronic
969549009 4:7851931-7851953 CTGGTCAGAAGCAATGGTGTGGG - Intronic
969926956 4:10594105-10594127 CTGGTGGGAAGCAGAAGAGTGGG - Intronic
972335207 4:38101779-38101801 ATTGTGAGAGGCAAAATTGACGG - Intronic
973560976 4:52134890-52134912 CTGATGAAATGCAAAATTGTAGG + Intergenic
974281774 4:59804436-59804458 CTGGTGTGATGAAAAATTTTTGG + Intergenic
978965067 4:114730598-114730620 TTTGTGAGAAGCAAAGTTTTGGG + Intergenic
979174717 4:117649682-117649704 TTGGTGAGACACAAAATTCTTGG + Intergenic
986795128 5:11202747-11202769 CTGGAGAAAAGCAAAATAGAGGG - Intronic
988660832 5:33266415-33266437 CTGGTAAGAGACAGAATTGTAGG + Intergenic
989400005 5:40998759-40998781 CTGGTGAGAAGGTAAATGGTAGG + Intronic
992223786 5:74598675-74598697 CTTTTTAGAAGCAAAATTCTTGG - Intergenic
992938064 5:81731730-81731752 GAGGAGAGAAGCAAAATTTTGGG - Intronic
993165545 5:84349513-84349535 TTGGTGACAAACATAATTGTGGG + Intronic
994347075 5:98699853-98699875 TTGGGGAGAAACAAAATGGTTGG - Intergenic
995308827 5:110688378-110688400 ATGGGGAGAAACAAAATTCTTGG + Intronic
996894984 5:128470229-128470251 CTGCTGAGCAGCCAAATTGCAGG + Intronic
1001711889 5:173785687-173785709 CTGGTAAGAAGCTAAAGTGATGG - Intergenic
1002955236 6:1856150-1856172 CTGGTGAGGATCAAACTTGTCGG + Intronic
1003274215 6:4634872-4634894 ATTCTTAGAAGCAAAATTGTTGG - Intergenic
1005233814 6:23736482-23736504 TTGGAGAGAAGATAAATTGTGGG - Intergenic
1006341813 6:33451591-33451613 CAGGTGAGAAACAAAATAGGAGG + Intronic
1008247965 6:49202561-49202583 TTGGTGAGGAGCAGAATTCTAGG + Intergenic
1009533406 6:64850027-64850049 CCTGTAATAAGCAAAATTGTAGG - Intronic
1009591228 6:65673330-65673352 GTGGTAAGAGGCAATATTGTGGG + Intronic
1010688627 6:78881307-78881329 CTGGAGAAAAGCAAAACTATGGG + Intronic
1010805109 6:80226507-80226529 CTGGTGAAAATGAAAATGGTAGG + Intronic
1011492306 6:87904734-87904756 CTGATGAGAACAAAAATTCTAGG + Intergenic
1011723918 6:90189160-90189182 TTGGAGAGAAGCAACAATGTAGG + Intronic
1012435581 6:99211768-99211790 CTGGAGAGATGCAACATTGCTGG - Intergenic
1013684281 6:112561099-112561121 CTGGAGAAAAGCAATATTTTAGG + Intergenic
1016916014 6:149245132-149245154 CAGGTGAGAAGCAACATTTTTGG + Intronic
1017030104 6:150213614-150213636 CTGATGAAATGCAAAATTGCAGG + Intronic
1018028833 6:159826285-159826307 CTGGAGAGAAGCTGCATTGTAGG - Intergenic
1022355943 7:29614521-29614543 CTGCTGAGATGCAAAAGTGAGGG - Intergenic
1022497681 7:30863271-30863293 CTGGAGAGAAGCAGAGTGGTGGG + Intronic
1023633127 7:42183305-42183327 CTGGTGAAAAGCAAATATGGAGG - Intronic
1024862242 7:53858100-53858122 GTGTTGAGAAGAAAAACTGTAGG - Intergenic
1030865406 7:114696622-114696644 CTGGAGACAACCAAAAATGTTGG - Intergenic
1032368466 7:131323064-131323086 CTGGTGAGAAAAAATTTTGTTGG + Intronic
1032568629 7:132975149-132975171 CTGGTGAGTATTAAAAATGTAGG - Exonic
1036958919 8:13222594-13222616 GTGGTGAGAAGCAAGAGTGCTGG - Intronic
1038998801 8:32956432-32956454 CTGGGGAAAAGTAAAATTATAGG - Intergenic
1041872488 8:62650665-62650687 CTGGTGATAATCAGAAATGTAGG - Intronic
1043010977 8:74881063-74881085 CTGCTGATAAACAAAACTGTTGG + Intergenic
1043865870 8:85375183-85375205 GTGGAGAGAAGCAAAAATGTTGG - Intronic
1044337887 8:91009642-91009664 CTTCTGAAAAGAAAAATTGTTGG - Intronic
1046900324 8:119516707-119516729 TTGGTAAGAAACAATATTGTTGG + Intergenic
1047659873 8:127021544-127021566 TTGGTGTGATTCAAAATTGTAGG - Intergenic
1047796593 8:128263135-128263157 CTGGGGAGTAGCACCATTGTTGG + Intergenic
1050609049 9:7332100-7332122 CAGTAGAGAAGAAAAATTGTAGG + Intergenic
1051423378 9:16910905-16910927 CTTGAGAGAAGGAAAACTGTTGG - Intergenic
1053054289 9:34985072-34985094 CTGGAGAGAAGCAGATTTGAAGG + Intergenic
1053355041 9:37438399-37438421 CGTGTGAGAAGCAAGCTTGTGGG - Exonic
1056110028 9:83385735-83385757 CTGGTGAAAAAAAAAAATGTTGG + Intronic
1056888750 9:90469619-90469641 GTGGTGAGCAGCAGAAATGTCGG + Intergenic
1056892956 9:90513397-90513419 GAGGTTAGAAGCAAAATTCTGGG + Intergenic
1059265708 9:113028388-113028410 CTGGTCAAAAGGAAATTTGTAGG + Intergenic
1059548447 9:115202879-115202901 CTGGAGTGAAGCAAAAATATGGG + Intronic
1059737712 9:117118815-117118837 CTGTGGAGAAACAACATTGTAGG - Intronic
1059776764 9:117483982-117484004 CTAGTGAGAAGCATTAATGTTGG - Intergenic
1188559874 X:31455387-31455409 CTGGTGAAAAACAATAATGTAGG - Intronic
1189104225 X:38220328-38220350 CATGTGAGAGGCAAAATTCTGGG + Intronic
1191604705 X:63048425-63048447 TTGGTGAGATACAAAATTCTTGG + Intergenic
1195266552 X:103186373-103186395 CTGGTGAGAATAAAAAATGGAGG - Intergenic
1195369523 X:104159157-104159179 CTGATGCAAAGCAAAAGTGTTGG + Intergenic
1197920617 X:131589842-131589864 ATGGTGAGAAAAAAAACTGTTGG + Intergenic
1198279019 X:135124097-135124119 CTGGCTAGAAGTAGAATTGTAGG - Intergenic
1198291939 X:135248423-135248445 CTGGCTAGAAGTAGAATTGTAGG + Intergenic
1198297972 X:135305402-135305424 CTGGCTAGAAGTAGAATTGTAGG + Intronic
1199103664 X:143837314-143837336 GTGGGGAGAAGCCAGATTGTGGG - Intergenic