ID: 929872132

View in Genome Browser
Species Human (GRCh38)
Location 2:45768045-45768067
Sequence GAGAAGCAAAATTGTTGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 339}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929872128_929872132 -10 Left 929872128 2:45768032-45768054 CCAGTGCCCTGGTGAGAAGCAAA 0: 1
1: 0
2: 0
3: 8
4: 185
Right 929872132 2:45768045-45768067 GAGAAGCAAAATTGTTGGCCAGG 0: 1
1: 0
2: 2
3: 35
4: 339
929872123_929872132 21 Left 929872123 2:45768001-45768023 CCTGGAGAGGAGCTATTCCTTGG 0: 1
1: 0
2: 0
3: 26
4: 222
Right 929872132 2:45768045-45768067 GAGAAGCAAAATTGTTGGCCAGG 0: 1
1: 0
2: 2
3: 35
4: 339
929872126_929872132 4 Left 929872126 2:45768018-45768040 CCTTGGCATTGGTGCCAGTGCCC 0: 1
1: 0
2: 1
3: 10
4: 207
Right 929872132 2:45768045-45768067 GAGAAGCAAAATTGTTGGCCAGG 0: 1
1: 0
2: 2
3: 35
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929872132 Original CRISPR GAGAAGCAAAATTGTTGGCC AGG Intronic
900434514 1:2622587-2622609 TAGAAACCAAATTCTTGGCCGGG + Intronic
901839633 1:11945649-11945671 GAGAAGCAAATGCCTTGGCCTGG - Intronic
903758557 1:25681785-25681807 GACAATGAAAAGTGTTGGCCAGG - Intronic
905687284 1:39917662-39917684 GAAAATAAGAATTGTTGGCCGGG - Intergenic
906398568 1:45488213-45488235 AACAAAAAAAATTGTTGGCCAGG - Intronic
906847092 1:49204914-49204936 GAGAGGCAAAATGATTGCCCAGG + Intronic
907191350 1:52651531-52651553 GAAAACAAAAATTGTTGGGCCGG - Intronic
907297163 1:53462649-53462671 GAGAAGTTAAGTTTTTGGCCAGG + Intronic
907540131 1:55208330-55208352 CAGAAACAATAATGTTGGCCAGG + Intronic
908211915 1:61909273-61909295 CAGAAGAAAAATTGTAGGTCAGG - Intronic
909159190 1:72123889-72123911 GTGAAGTACAACTGTTGGCCTGG + Intronic
909294309 1:73927485-73927507 GGGAATCAAAAAGGTTGGCCAGG + Intergenic
909388251 1:75085769-75085791 GAGGAGTAAATTGGTTGGCCTGG - Intergenic
909818227 1:80024642-80024664 GAGAAGAAAACTTGTGGCCCTGG + Intergenic
911066004 1:93789165-93789187 AATATGTAAAATTGTTGGCCAGG + Intronic
911990561 1:104692068-104692090 AAAAAGCAAAATTATTGGCTGGG + Intergenic
912848257 1:113097027-113097049 GAGAAAAAAAAATGATGGCCAGG - Intronic
912855358 1:113164331-113164353 GAGAAACAAAATTATTAGCAGGG - Intergenic
912918569 1:113842699-113842721 GAAAATAAAAAGTGTTGGCCAGG + Intronic
913385434 1:118253582-118253604 GGGAAGCAAAATTGTTAACATGG + Intergenic
914259327 1:145985654-145985676 GGGAAGCACAAATGTTGGCCAGG + Intergenic
914295293 1:146316186-146316208 AAAAAGAAAAATTATTGGCCGGG + Intergenic
914556334 1:148766969-148766991 AAAAAGAAAAATTATTGGCCGGG + Intergenic
914616503 1:149363264-149363286 AAAAAGAAAAATTATTGGCCGGG - Intergenic
916911228 1:169349295-169349317 GAGAAATGAAATTGTTGACCTGG - Intronic
917102606 1:171461114-171461136 CAAAAGAAAAATTGTGGGCCAGG + Intergenic
917477142 1:175378694-175378716 AAGAAGCAGACTTGTGGGCCTGG + Intronic
918366051 1:183808798-183808820 GAGAGGTTAAATTGTTTGCCAGG + Intronic
921350762 1:214232149-214232171 AAGAAGCAGAGATGTTGGCCCGG + Intergenic
922561208 1:226570933-226570955 TAAAAGCAAATTTGTAGGCCAGG + Intronic
924347689 1:243087790-243087812 GAAAAACAAAATTCCTGGCCAGG + Intergenic
924361792 1:243249128-243249150 GTGAAGAAAAATTCATGGCCAGG + Intronic
1062936601 10:1395174-1395196 GAGAATAAAAAATCTTGGCCAGG - Intronic
1063168478 10:3484948-3484970 GAGATGCAGACATGTTGGCCAGG - Intergenic
1064310453 10:14207903-14207925 ATGAAACAAAATTGTTGGCTGGG + Intronic
1065964376 10:30759171-30759193 AAGAAGCAAACTTAGTGGCCAGG - Intergenic
1066002807 10:31119996-31120018 AAAAAGTAAAAATGTTGGCCAGG - Intergenic
1066751151 10:38658801-38658823 GAGCAGCAAAGTTCTGGGCCTGG + Intergenic
1066965893 10:42264290-42264312 GAGCAGCAAAGTTCTGGGCCTGG - Intergenic
1067556340 10:47275991-47276013 GAGAAGCTAAATTGCTCGCCAGG + Intergenic
1068787745 10:60995329-60995351 GAGAAGCAAAATGACTGGCCTGG + Intronic
1068935433 10:62631305-62631327 GAGAACCAAGAATGTTTGCCTGG + Intronic
1069927390 10:71860318-71860340 GGGAAGCCAGATTGCTGGCCGGG + Intergenic
1070080277 10:73179256-73179278 TAGAAATAAAAATGTTGGCCGGG - Intronic
1070610469 10:77928729-77928751 TAGAAGCATATTTTTTGGCCAGG + Intergenic
1071112635 10:82177880-82177902 GAGAAGAAAAAATATTGCCCTGG + Intronic
1072066484 10:91876518-91876540 AAAAAAAAAAATTGTTGGCCAGG + Intergenic
1072186731 10:93046960-93046982 GAGAAGCCAAAAGGTTGACCTGG + Intronic
1072443446 10:95477501-95477523 GAGAAGCAAAGTTTTTGGAAGGG + Intronic
1072589760 10:96818686-96818708 AAAAAGTAAAATAGTTGGCCAGG - Intergenic
1073681750 10:105712331-105712353 GTAAAGCAAAATTGTTGGCAGGG - Intergenic
1073878946 10:107957748-107957770 GAAAAGGAAAATGGATGGCCAGG + Intergenic
1074346157 10:112688247-112688269 GAGAAGAAAAAGACTTGGCCAGG - Intronic
1074563218 10:114553027-114553049 GAGAAGCTTAATTGCTGCCCAGG - Intronic
1075278887 10:121121733-121121755 TACAAACAAAATTGTTGGCACGG - Intergenic
1079441467 11:20518931-20518953 GAAAAGAAAAATTATTGGCTGGG + Intergenic
1079509536 11:21194928-21194950 GATAACAAAAATTGTTGGCTGGG - Intronic
1080749567 11:35139586-35139608 GAGAAGAAAGTTTGTTGGGCAGG + Intronic
1081684573 11:45033157-45033179 CAGCAGCAGAATTGTTGACCAGG + Intergenic
1082056567 11:47822549-47822571 AAGAAAAAAAATTTTTGGCCGGG - Intronic
1082718365 11:56642894-56642916 GACAAGAAAAATAGTTGGGCTGG + Intergenic
1083496909 11:63063264-63063286 GAGAAATAAAATTCTTGGCCAGG - Intergenic
1084297476 11:68222280-68222302 GAAAAGCACAGTTATTGGCCGGG + Intergenic
1084994733 11:72965082-72965104 AAGAAGTAAAATGATTGGCCAGG - Intronic
1085891643 11:80586552-80586574 GAAAAGCAAAATTGCAGCCCAGG + Intergenic
1085892458 11:80597122-80597144 GTAAAGTAAAAATGTTGGCCAGG - Intergenic
1087544285 11:99564381-99564403 TATAAACAGAATTGTTGGCCAGG - Intronic
1088874355 11:113921460-113921482 GATAAAGAAAATTGCTGGCCGGG + Intronic
1090114069 11:123947611-123947633 GAGAAGGAAAAGTGTTGAGCAGG + Intergenic
1090508060 11:127340813-127340835 GAGAAGACAGATTGCTGGCCAGG - Intergenic
1091241809 11:134057967-134057989 TAGAAAAAAAAATGTTGGCCAGG - Intergenic
1091916919 12:4276269-4276291 TAGAAGGCATATTGTTGGCCAGG - Intronic
1091954822 12:4630335-4630357 GAGAAGTTAAATAGTTTGCCAGG + Intronic
1092168529 12:6358561-6358583 GATAAGCAAAAATGTGGGCCGGG + Intronic
1092378844 12:7978420-7978442 AAGAAGCAAAAATTTTGGCTAGG - Intergenic
1093089517 12:14905539-14905561 GAGAGGCAAAATGTCTGGCCTGG + Intronic
1093221672 12:16427675-16427697 GAAAAGAAAAAATGTAGGCCAGG - Intronic
1094047072 12:26179047-26179069 GAGAAGCAAAGTTGAAGCCCTGG + Intronic
1094415748 12:30213141-30213163 GAGAAAAAAAACTGTTGTCCTGG - Intergenic
1094637341 12:32239269-32239291 AAGAAAGGAAATTGTTGGCCGGG + Intronic
1095321496 12:40833389-40833411 GAAAAGACAACTTGTTGGCCAGG - Intronic
1096138353 12:49221475-49221497 GAGAATTAAAAATTTTGGCCAGG - Intronic
1097079097 12:56416560-56416582 GAGAAGCCAGCTTGTTGGCATGG - Exonic
1097244284 12:57598223-57598245 AAGAATCCAAATTGTAGGCCGGG + Intronic
1097864511 12:64548483-64548505 AAGAAGTAAAATTGTTGGCCAGG - Intergenic
1097904735 12:64908207-64908229 GAGATGGATCATTGTTGGCCTGG + Intergenic
1098940391 12:76528025-76528047 TATAAGCATTATTGTTGGCCAGG + Intronic
1100387877 12:94120270-94120292 GAGAAGCCTAATTGTTGTTCCGG - Intergenic
1102280301 12:111613525-111613547 GAGAATGAAAATTCTGGGCCAGG - Intergenic
1102747964 12:115266616-115266638 GAGAAGAAAAGTTGCTTGCCTGG - Intergenic
1104602285 12:130162123-130162145 GAGAGGCAAAGTTGGAGGCCAGG + Intergenic
1105364021 13:19747916-19747938 GAAATACAAAATTGTAGGCCGGG + Intronic
1106013003 13:25843186-25843208 GAGAAGGAACATTCCTGGCCAGG + Intronic
1106748657 13:32733364-32733386 AAAAAGCAAAATTAATGGCCAGG - Intronic
1107472214 13:40701548-40701570 GATAATCAAAAATCTTGGCCGGG - Intergenic
1109736518 13:66491989-66492011 GAGAACCAAACTTTGTGGCCAGG - Intronic
1110874077 13:80488200-80488222 AAGAAGCAATCATGTTGGCCAGG + Intergenic
1111540733 13:89664302-89664324 AATAAGTAAAATTGTTGGCTAGG - Intergenic
1111851027 13:93574996-93575018 GAAAAGGTGAATTGTTGGCCAGG + Intronic
1112792272 13:103016041-103016063 GAGAAGCAAAAGTATAGGCTAGG + Intergenic
1113984562 13:114303488-114303510 AAGAAGCAGAATTGTCGGCCCGG + Intronic
1115579494 14:34743960-34743982 CAAAAACAAAACTGTTGGCCGGG - Intergenic
1115594357 14:34894811-34894833 TAAAAGTAAAATTCTTGGCCGGG + Intergenic
1115658708 14:35468888-35468910 GAAAAGTAAAAATGCTGGCCAGG + Intergenic
1115677688 14:35697640-35697662 AAAAAACAAAACTGTTGGCCAGG - Intronic
1115888617 14:38002232-38002254 GAGAAGTCAATTTGTTGTCCAGG - Intronic
1116086413 14:40244332-40244354 GACAACCAAAAATGTTGGCTTGG + Intergenic
1116794583 14:49376047-49376069 CAAAAGTAAAATAGTTGGCCGGG + Intergenic
1116834748 14:49759221-49759243 GATATTTAAAATTGTTGGCCAGG + Intergenic
1116966925 14:51024727-51024749 GAGAAGCATTATTGTGGGTCAGG + Intronic
1117180376 14:53185379-53185401 GAGAAATAAATTTCTTGGCCGGG - Intergenic
1117227223 14:53674543-53674565 GAGAAGTAAATTTCTGGGCCAGG + Intergenic
1117997913 14:61495381-61495403 GAAGAGCAAAACTGGTGGCCTGG - Intronic
1118585282 14:67346608-67346630 TAGAAACAATATTCTTGGCCAGG - Intronic
1119319835 14:73723843-73723865 GAGAAATGAAATTGTTTGCCTGG - Intronic
1119490544 14:75028851-75028873 GAGAAAAGAAAATGTTGGCCAGG + Intronic
1119742790 14:77025571-77025593 GGGAAGCAAAATTTGTGGCTGGG + Exonic
1122710754 14:103655792-103655814 TAGAAACTAAAATGTTGGCCAGG + Intronic
1123844668 15:24286424-24286446 AAGAAGAAAAAATGTTGGCATGG - Intergenic
1124472792 15:30003099-30003121 GAAATGCAAAATTTTCGGCCGGG - Intergenic
1126614601 15:50564155-50564177 TGGAAGAAAAATTGTTGGGCAGG - Intronic
1126759804 15:51959297-51959319 AAGAAGTAAAATTACTGGCCGGG - Intronic
1127416055 15:58758187-58758209 GAGAAAAAAAATTTTTGGCCAGG - Intergenic
1128858538 15:71043618-71043640 GAGATGCAGAATAGTTGGCTTGG + Intronic
1130543722 15:84840071-84840093 CAGAAGCAAAACTGTTGATCAGG - Exonic
1130663310 15:85848936-85848958 GTGAATCAAAATAGTTGTCCAGG - Intergenic
1130793871 15:87187969-87187991 AAGAAGAAAAAATGTGGGCCAGG + Intergenic
1131331115 15:91500350-91500372 AAGAATTAAAATTTTTGGCCGGG + Intergenic
1133890124 16:9871106-9871128 GAGCAGGAAAATTGTGGGCGTGG - Intronic
1135280228 16:21147905-21147927 TAGAAGAAAAGCTGTTGGCCTGG + Intronic
1135664764 16:24326464-24326486 GAGAAAGAAAAATTTTGGCCGGG - Intronic
1136424889 16:30163266-30163288 AAAAAGAAAAATTGCTGGCCAGG + Intergenic
1136731574 16:32418304-32418326 GAGCAGCAAAGTTCTGGGCCTGG - Intergenic
1138177334 16:54912632-54912654 GAAATGCAAGTTTGTTGGCCAGG + Intergenic
1138304590 16:55962812-55962834 GAGATGCATAATTGTAGGCAGGG - Intergenic
1140754073 16:78051858-78051880 GAGGACAAAAATAGTTGGCCAGG - Intronic
1141628307 16:85273162-85273184 GAGAGGCCAAGTAGTTGGCCTGG - Intergenic
1141802693 16:86321873-86321895 GAGAAGCTAATTTGGTTGCCAGG + Intergenic
1141920671 16:87133540-87133562 CAGAAGCAAAGTGCTTGGCCTGG + Intronic
1202994816 16_KI270728v1_random:98966-98988 GAGCAGCAAAGTTCTGGGCCTGG + Intergenic
1203021503 16_KI270728v1_random:411308-411330 GAGCAGCAAAGTTCTGGGCCTGG + Intergenic
1142798318 17:2326807-2326829 AAAAAGAAAAATTTTTGGCCGGG + Intronic
1143018937 17:3906424-3906446 AAGAAGTACCATTGTTGGCCGGG - Intronic
1143323247 17:6081358-6081380 AAAAAAAAAAATTGTTGGCCAGG - Intronic
1143999882 17:11043575-11043597 GAGAGGTAAAATAGTTTGCCTGG - Intergenic
1147651058 17:42062316-42062338 GAGAAGCAGAAATCCTGGCCAGG + Intronic
1147927935 17:43956665-43956687 GACAAGGAGAATTGTTGGCTGGG - Intronic
1149358430 17:55868504-55868526 GATAAGTAAAATTTGTGGCCTGG + Intergenic
1149780056 17:59390295-59390317 AAGAAATAAATTTGTTGGCCAGG - Intronic
1149878962 17:60268104-60268126 AAGAGTTAAAATTGTTGGCCGGG - Intronic
1150546939 17:66168902-66168924 GAGAAGCACAAGGGTTGGTCAGG - Intronic
1151224722 17:72639990-72640012 GAGAAGCACAATTGTGGGCTGGG + Intergenic
1154244349 18:12682482-12682504 GAGAAAGAAATTTCTTGGCCAGG - Intronic
1156547961 18:37984514-37984536 AAGAGGTAAAATTGATGGCCTGG - Intergenic
1157262070 18:46184424-46184446 GAAAACCAAAATTTATGGCCAGG + Intronic
1157467987 18:47964819-47964841 GAGAAGGAAAATTGTCAGCCTGG - Intergenic
1158595024 18:58808426-58808448 AAGAAGCAAAACGGTAGGCCGGG - Intergenic
1158935588 18:62361572-62361594 CAGAATCAAAAATGTTGGTCTGG - Intronic
1160506604 18:79430676-79430698 GAAAAACAAAATTCATGGCCGGG - Intronic
1160951729 19:1670854-1670876 GAGAAGAAAAAGAGTGGGCCGGG - Intergenic
1161123544 19:2543518-2543540 GAAAAGAAAAATTGCAGGCCGGG - Intronic
1162047043 19:8006811-8006833 GAAAAACAAAATTGTAGGCCAGG - Intronic
1162305898 19:9873447-9873469 AAAAACCAAAAATGTTGGCCAGG - Intronic
1163472103 19:17503634-17503656 AAAAAAAAAAATTGTTGGCCGGG + Intronic
1163642346 19:18468926-18468948 GAGAAGCAAGGTTGCTGGGCAGG - Intronic
1163930284 19:20383657-20383679 TAAAAGAAAAATTTTTGGCCAGG - Intergenic
1165720747 19:38077964-38077986 GAAAAGCAAAAATATTGGCCAGG - Intronic
1166398721 19:42462042-42462064 AAGAAGCAGAATTGTGGGCCAGG + Intergenic
1167303157 19:48691320-48691342 AAGAAAAAAAATTGTAGGCCGGG - Intergenic
1167480073 19:49724737-49724759 AAGAAACATCATTGTTGGCCGGG - Intergenic
1168143726 19:54407179-54407201 TAAAAGTAGAATTGTTGGCCGGG + Intergenic
1168214393 19:54914632-54914654 AAGAAGCAAAGATGGTGGCCGGG - Intronic
1168672406 19:58250612-58250634 GAGAAGCCAAAATTTTGGTCAGG - Intronic
1202706446 1_KI270713v1_random:27709-27731 GAAAAAAAAAATTGTTGGCCGGG - Intergenic
926191426 2:10730946-10730968 GAAAAAAAAAATTGTTGGCAGGG - Intronic
926272719 2:11378728-11378750 GAGAGGCAAAATAGCTTGCCCGG - Intergenic
926900739 2:17749392-17749414 AAGAAGAAAAATTAATGGCCGGG + Intronic
926957650 2:18319155-18319177 TAGAACAAAAAATGTTGGCCTGG + Intronic
928260128 2:29758927-29758949 GAGAAGGCAAATTGTTGGACAGG - Intronic
929113962 2:38428793-38428815 AAGAAGAAAAACTGGTGGCCGGG - Intergenic
929872132 2:45768045-45768067 GAGAAGCAAAATTGTTGGCCAGG + Intronic
930045615 2:47169067-47169089 GAAAAGAAAGTTTGTTGGCCGGG - Intronic
931654952 2:64502470-64502492 AAAAAACAAAATTGTGGGCCGGG + Intergenic
932888696 2:75571310-75571332 GGGGAGAAAAATTGCTGGCCAGG - Intergenic
933494415 2:83030305-83030327 GATATGCAACATTATTGGCCTGG + Intergenic
933616489 2:84487140-84487162 GAGACCCAAAATTTTTGTCCTGG + Intergenic
933633707 2:84683716-84683738 GAGAAAAAAAAATATTGGCCGGG - Intronic
934314145 2:91900970-91900992 GAGCAGCAAAGTTCTGGGCCTGG + Intergenic
935396131 2:102611139-102611161 AAGAAAGAAAATTTTTGGCCGGG - Intergenic
937421121 2:121755996-121756018 GAGCAGCAAAATTTTGGGCGGGG - Intronic
940952361 2:159689665-159689687 GAAAAGTAAAAATGCTGGCCAGG - Intergenic
941740742 2:169032637-169032659 GTGAAGCAAAATTTTTTTCCTGG - Intergenic
943760468 2:191602288-191602310 TAAAATCAAAATAGTTGGCCGGG - Intergenic
944467697 2:200019881-200019903 GAAAATAAAAATTGTTGGCAAGG - Intergenic
946256726 2:218447751-218447773 GAGATGGAAAACTGTTGCCCAGG + Intronic
946475780 2:220005238-220005260 GGGAAGGAAAACTGTGGGCCAGG - Intergenic
946528182 2:220542437-220542459 GAGAATCAACATTATTTGCCTGG + Intergenic
946915208 2:224512389-224512411 AGGAAGCTAAAGTGTTGGCCGGG - Intronic
948390057 2:237605531-237605553 GAAAAGCAAATTGGTTGGCCAGG + Intergenic
1169821926 20:9721350-9721372 TAGGAGCAAGAATGTTGGCCAGG + Intronic
1170518574 20:17158970-17158992 CAGAAGCAACATTGTTGGTTTGG + Intergenic
1172323761 20:34018404-34018426 GAGAAGCAAGGTTATTTGCCTGG - Intronic
1173685558 20:44921107-44921129 AAGAAACAAAATTGATGGCCAGG - Intronic
1175375776 20:58522929-58522951 GAGAAGCAAAATTTGGGGGCTGG + Intergenic
1175688424 20:61048018-61048040 GAGATGCAGAATTACTGGCCGGG - Intergenic
1176136821 20:63526702-63526724 AAGAAGGAAATTTGTTGGCTGGG + Intergenic
1177348259 21:19900757-19900779 CAGAAGCAAGATTGCTGGGCTGG - Intergenic
1177945739 21:27468028-27468050 GAAAAGCAAAATTACTGTCCTGG + Intergenic
1178640125 21:34338714-34338736 GAGAAAGAAAATTGTTTACCTGG - Intergenic
1179216792 21:39374407-39374429 ACGAAGAAAGATTGTTGGCCAGG + Intergenic
1179216967 21:39375832-39375854 AATAATCAAAGTTGTTGGCCAGG - Intergenic
1179245995 21:39634697-39634719 GAGAACCAATATGCTTGGCCAGG - Intronic
1180540905 22:16446836-16446858 GAGCAGCAAAGTTCTGGGCCTGG + Intergenic
1180758016 22:18176610-18176632 GAGGAACAAAATAGGTGGCCTGG - Intronic
1180768304 22:18360402-18360424 GAGGAACAAAATAGGTGGCCTGG - Intergenic
1180778004 22:18501989-18502011 GAGGAACAAAATAGGTGGCCTGG + Intergenic
1180810729 22:18759300-18759322 GAGGAACAAAATAGGTGGCCTGG + Intergenic
1180826183 22:18863626-18863648 GAGGAACAAAATAGGTGGCCTGG - Intergenic
1181196877 22:21193555-21193577 GAGGAACAAAATAGGTGGCCTGG + Intergenic
1181212651 22:21299569-21299591 GAGGAACAAAATAGGTGGCCTGG - Intergenic
1181544777 22:23595917-23595939 GAGAAGCATCATTGCTGGCCAGG + Intergenic
1181815530 22:25433942-25433964 GAGAAGCATCATTGCTGGCCAGG - Intergenic
1182340354 22:29615275-29615297 GAAAAGCAAACTAGTTAGCCAGG + Intronic
1185160378 22:49224067-49224089 TAGAAAGAAAAGTGTTGGCCAGG + Intergenic
1203229923 22_KI270731v1_random:101290-101312 GAGGAACAAAATAGGTGGCCTGG - Intergenic
1203276323 22_KI270734v1_random:89532-89554 GAGGAACAAAATAGGTGGCCTGG - Intergenic
951229860 3:20165754-20165776 CCTAAACAAAATTGTTGGCCAGG + Intronic
954741509 3:52754776-52754798 GAAAAACAAAACTGTGGGCCGGG + Intronic
954987542 3:54809076-54809098 GAGACGCTATATTGTTGTCCAGG + Intronic
955283760 3:57618901-57618923 GACAAACACATTTGTTGGCCAGG - Intergenic
955556437 3:60142660-60142682 GAAACGCAAAAATGTTAGCCGGG - Intronic
956457563 3:69438458-69438480 TAGAAGCAAAATTGTAGGAATGG + Intronic
956856716 3:73282348-73282370 TAGAATCTAATTTGTTGGCCTGG + Intergenic
957682645 3:83457468-83457490 GAGAAGCAGAACTGTGGCCCTGG - Intergenic
958517700 3:95139964-95139986 GAGAAGAAAAATTGTTATCATGG - Intergenic
961256501 3:125558956-125558978 AAGAAGCAAAGCTTTTGGCCAGG + Intronic
961366804 3:126405365-126405387 GAGCTGCAAAAATCTTGGCCTGG + Intronic
961762343 3:129180942-129180964 GACAAGTAGAATTGTTGGCAAGG + Intronic
963036610 3:141035570-141035592 AAAAAGAAAACTTGTTGGCCAGG - Intergenic
963054667 3:141175980-141176002 GTAAAATAAAATTGTTGGCCAGG + Intergenic
963475814 3:145802571-145802593 GAGAAGCAATATTAATGGCAGGG - Intergenic
963773565 3:149415467-149415489 TAGAAGCAAAGTTGTTGGAGGGG - Intergenic
964139992 3:153386733-153386755 AAAAAGCAAAAATGTTGGCCAGG - Intergenic
964364571 3:155935494-155935516 TAGAAGCAACATTATAGGCCAGG - Intronic
964410412 3:156391732-156391754 GTGAAGTAAAAATGTTTGCCTGG - Intronic
965986761 3:174763291-174763313 CAGATACAAAAATGTTGGCCGGG + Intronic
967333715 3:188319051-188319073 AAGAATCATAATTTTTGGCCGGG - Intronic
967629238 3:191723927-191723949 GAGATGCAACATTGTTGACTTGG - Intergenic
967837311 3:193975328-193975350 CAGAGGCAAAATTGTTCCCCAGG - Intergenic
968149783 3:196328004-196328026 AAGAAGTAATATTGTCGGCCAGG + Intronic
968839035 4:2987643-2987665 CAGAAGCAGAATTGTTGGCCAGG + Intronic
969167110 4:5325296-5325318 GAAAAGCAAGATTTTTGTCCTGG - Intronic
969819932 4:9712228-9712250 GAAAAACAAAATTGAGGGCCGGG - Intergenic
969931433 4:10634741-10634763 GAAAAGCCAAATTGTTCTCCAGG - Intronic
970549937 4:17169502-17169524 GAGAGGCAAAGTTCTTGGGCTGG - Intergenic
971957260 4:33437485-33437507 GTGAAGCAAAATTTCTGGACCGG + Intergenic
972033208 4:34488856-34488878 TAGAAGCAAACATGTTGGCTAGG + Intergenic
972321379 4:37976547-37976569 GAGAAGCAGAATTCTTGGGCTGG + Intronic
973120364 4:46514402-46514424 GAGAAGCAAAATTATTAAGCAGG + Intergenic
975638384 4:76473808-76473830 GACAATAAAAAGTGTTGGCCAGG + Intronic
976124853 4:81822865-81822887 AAAAAGGAAAATTGTTAGCCTGG + Intronic
977136561 4:93311992-93312014 GAGAAGTAAAATTTTTAGGCAGG + Intronic
980456860 4:133055427-133055449 GAAAAGCCATATTGTTGGACTGG + Intergenic
981249566 4:142583499-142583521 GAGAAGCCAAATGGTTGGAAGGG - Intronic
981652114 4:147072166-147072188 GAAAAGAAAAAATTTTGGCCTGG + Intergenic
981876212 4:149549218-149549240 GAGCAAGAAAATTGATGGCCGGG + Intergenic
982038445 4:151370670-151370692 GGGAGGCAAAACTGTTGGCCAGG - Intergenic
983593435 4:169440632-169440654 GGGAAGCGAAACAGTTGGCCTGG + Intronic
984647916 4:182239372-182239394 TATAAGCAAGATTTTTGGCCGGG - Intronic
985272131 4:188203619-188203641 AAGAAGCAGAATTATGGGCCGGG - Intergenic
988109610 5:26801176-26801198 GAAAAGAAAATTTTTTGGCCGGG + Intergenic
990418227 5:55607111-55607133 GAAAAAGAAAACTGTTGGCCTGG + Intergenic
991177885 5:63712018-63712040 AGGAAGCAAAATTGATGCCCGGG - Intergenic
991271052 5:64781618-64781640 GAGAAGCAATATTGTGCCCCAGG - Intronic
992641184 5:78769605-78769627 GATGAACAAAAGTGTTGGCCTGG - Intronic
992858990 5:80892778-80892800 AAGAAGCAAAAATTTTGGTCAGG - Intergenic
994184065 5:96799159-96799181 GAGAATGGAAATTTTTGGCCAGG - Intronic
994397681 5:99239360-99239382 GAGAAACAAAGGTGTTTGCCGGG + Intergenic
995267062 5:110174396-110174418 GAGAAGCAGATTTGTGGTCCAGG + Intergenic
995762554 5:115578491-115578513 GATAAAGAAAAATGTTGGCCGGG - Intergenic
996042544 5:118832045-118832067 GAGAAGAAAAATTTCTGTCCAGG - Intergenic
996689392 5:126322218-126322240 GAGGAATAAAATTGTTAGCCAGG - Intergenic
997122297 5:131187959-131187981 GACATTCAAAATTGTTGGCCAGG + Intronic
999579349 5:153018620-153018642 TAAAAGTAAAATTGTCGGCCGGG + Intergenic
1000802764 5:165749212-165749234 GAGAAGGGAAATTGTTAGACAGG - Intergenic
1001959364 5:175871191-175871213 GAGCAGCAAGCTTGTGGGCCTGG + Intronic
1002319210 5:178365175-178365197 AATAAGCAAAATTGTTTTCCTGG + Intronic
1002511891 5:179725692-179725714 AAAAAAAAAAATTGTTGGCCAGG + Intronic
1004598985 6:17129547-17129569 AAAAAAAAAAATTGTTGGCCAGG + Intronic
1005071843 6:21869199-21869221 GAGAAAGAAAAAAGTTGGCCGGG - Intergenic
1005752347 6:28895074-28895096 CAGAAGAAATATTGCTGGCCGGG - Intergenic
1006262875 6:32891526-32891548 GAGAAAAGAAAATGTTGGCCAGG + Intergenic
1006331458 6:33394039-33394061 GACAATAAAAAATGTTGGCCAGG - Intronic
1006885471 6:37378303-37378325 GAGAAAGAAAAATGTAGGCCGGG + Intronic
1008079012 6:47175566-47175588 TATATGCAAAATTGTTTGCCTGG - Intergenic
1008698861 6:54074951-54074973 GAGAAAAAAAATTCCTGGCCAGG + Intronic
1011585421 6:88919612-88919634 TAGAAATAAAATTGTGGGCCAGG - Intronic
1011719081 6:90136540-90136562 GAGAAGGTAAATAGTGGGCCAGG - Intronic
1013064981 6:106675117-106675139 GAAAACAAAAATTGTTGGCAAGG - Intergenic
1013345975 6:109261138-109261160 TAAAAAAAAAATTGTTGGCCGGG + Intergenic
1013511449 6:110848007-110848029 TAGAAGGAAATTTGCTGGCCGGG - Intronic
1013811004 6:114044308-114044330 TAGATGAAAAATTCTTGGCCTGG - Intergenic
1013883985 6:114939257-114939279 ATAAAGAAAAATTGTTGGCCAGG - Intergenic
1015301502 6:131657866-131657888 CAGAAGTAAAATTTTAGGCCAGG + Intronic
1015983152 6:138858993-138859015 GAAAAGGAAAATTCTAGGCCAGG - Intronic
1016191278 6:141267948-141267970 AAGAAGCAAAAATGCTGGTCTGG + Intergenic
1016684035 6:146861324-146861346 GGGAAGCAAAATTGTGGATCAGG + Intergenic
1017748569 6:157469057-157469079 CAAAGGCAAAATTGTTGGCTAGG + Intronic
1020039216 7:4988481-4988503 GAAAAGAAAAACTGTTGGCTGGG - Intronic
1020156078 7:5725979-5726001 GAAAAGAAAAACTGTTGGCTGGG + Intronic
1020318234 7:6922075-6922097 GAAAAACAAAATTGAGGGCCAGG + Intergenic
1022323587 7:29309727-29309749 GAGAAGCACATTTGGTGGCAAGG - Intronic
1023440892 7:40183876-40183898 GAAAAGCATCATTGTTGGCCGGG + Intronic
1024748911 7:52440299-52440321 GGCTAACAAAATTGTTGGCCAGG + Intergenic
1025142941 7:56480524-56480546 GAAAAAAAAAATTGTTGACCAGG + Intergenic
1025258580 7:57401494-57401516 GAAAAAAAAAATTGTTGGCCGGG + Intergenic
1025610060 7:63070172-63070194 GAAAAAAAAAATTGTTGGCTGGG - Intergenic
1025796354 7:64741179-64741201 TAGAAGTAAAAATATTGGCCAGG - Intergenic
1025872722 7:65449803-65449825 AAGAGCTAAAATTGTTGGCCTGG - Intergenic
1027171154 7:75873607-75873629 AAAAAGCAACATTCTTGGCCAGG + Intronic
1031939511 7:127773156-127773178 GAGAATGAAAATTCTTGGCCAGG + Intronic
1031957209 7:127954775-127954797 GAAAAGCCAAATTGATGGCCTGG + Intronic
1032277645 7:130473679-130473701 GGGAACCAAAATTGTTGCTCTGG - Intergenic
1033277846 7:139986024-139986046 GAGAAAACAAAGTGTTGGCCAGG + Intronic
1034345196 7:150381645-150381667 GAGAAGGAAAGTGGTTTGCCTGG + Intronic
1035832204 8:2708812-2708834 GATGAGCAAAATTGTTGAACAGG - Intergenic
1036167288 8:6447842-6447864 AGAAAACAAAATTGTTGGCCGGG - Intronic
1036650837 8:10642721-10642743 GCAAAGGAAATTTGTTGGCCTGG + Intronic
1037032388 8:14125184-14125206 AAGAATCACTATTGTTGGCCAGG + Intronic
1037982052 8:23261383-23261405 AAGAGGCAAAATTGTTGCCTTGG + Exonic
1040391271 8:46952819-46952841 GAGAAGCAAAACAGTGTGCCTGG - Intergenic
1040783001 8:51133126-51133148 GAAAAGAACAATTGTTGGCAGGG + Intergenic
1041633170 8:60111048-60111070 AAGAAGCATAATTATAGGCCGGG - Intergenic
1042436252 8:68768533-68768555 GAGAACCAGAATTGTTGGTATGG - Intronic
1042548402 8:69971538-69971560 TAAAAACAAAATTTTTGGCCAGG - Intergenic
1043383450 8:79726829-79726851 GAAAAGAAAAAATATTGGCCAGG - Intergenic
1044126423 8:88463703-88463725 AAGACTCAATATTGTTGGCCGGG - Intergenic
1044879445 8:96708111-96708133 GAGATGCAACATTGATGGCTTGG - Intronic
1046408193 8:113802916-113802938 GGGAAGCACCATGGTTGGCCAGG + Intergenic
1049091717 8:140519752-140519774 GAGTAGCAAAGTGGCTGGCCAGG + Intergenic
1049986519 9:956692-956714 AAGAAGCCAATTTGTTGACCAGG + Intronic
1050228835 9:3494280-3494302 GATAAGCAGAGTTGTTGACCTGG + Intronic
1050655013 9:7818443-7818465 AAGAAATAAAATTGTCGGCCGGG - Intronic
1052744846 9:32430486-32430508 GAGAGGCTAAATAGTTGGCCCGG - Exonic
1053159025 9:35800733-35800755 GAGAAGCAGATTTGGTGGACGGG + Exonic
1053491328 9:38506470-38506492 AAGAAGAAAACTTGTAGGCCAGG + Intergenic
1053580678 9:39400969-39400991 AAGAATCAATATTGTTGGCCAGG + Intergenic
1053845174 9:42229017-42229039 AAGAATCAATATTGTTGGCCAGG + Intergenic
1054102265 9:60959774-60959796 AAGAATCAATATTGTTGGCCAGG + Intergenic
1054584094 9:66947088-66947110 AAGAATCAATATTGTTGGCCAGG - Intergenic
1055590314 9:77805697-77805719 TAAAAGCAAACTTTTTGGCCGGG - Intronic
1055873393 9:80913602-80913624 AAGAAACAAAATTTTTGGTCCGG - Intergenic
1057598974 9:96440636-96440658 CAGAATTAAAACTGTTGGCCAGG - Intergenic
1058075029 9:100642303-100642325 TACAAGCAAAATTTTTGCCCAGG - Intergenic
1058339599 9:103878224-103878246 AAGAATCAGAATTATTGGCCGGG - Intergenic
1058339949 9:103882628-103882650 GAAACGCAAAACTGTTGGCTTGG - Intergenic
1058481443 9:105399898-105399920 GAAAATGAAAATTTTTGGCCAGG + Intronic
1060577152 9:124706809-124706831 AGGGAACAAAATTGTTGGCCGGG - Intronic
1060825860 9:126687725-126687747 GAGAAGAAAAATTACTTGCCCGG + Intronic
1062655478 9:137602538-137602560 GAAAAGGAAAAGTGTGGGCCGGG - Intergenic
1185545013 X:936403-936425 GAGAAAGAAAACTGTTGGGCTGG - Intergenic
1186107539 X:6223723-6223745 GAGAATCAAAATTGAAGCCCAGG - Intronic
1187351862 X:18526040-18526062 AAGACTCAATATTGTTGGCCGGG - Intronic
1188728510 X:33615355-33615377 GAGAAGCAAAATAGAGGGTCCGG - Intergenic
1189144654 X:38643449-38643471 GAAAAGCAAAATTGTTAGAATGG + Intronic
1190829573 X:54047892-54047914 AGGAATCAAAAGTGTTGGCCGGG + Intronic
1192401203 X:70838121-70838143 TAGAAACACATTTGTTGGCCAGG + Intronic
1194344509 X:92746703-92746725 TAGAAAAAAAATTGTTGGCCAGG - Intergenic
1194392522 X:93337958-93337980 TAGAAGTATAATTGCTGGCCGGG + Intergenic
1194496152 X:94620142-94620164 AAGAAGCAAAAGTGGAGGCCGGG + Intergenic
1197530352 X:127616626-127616648 GAGAAGCAGAACTGGTGGGCAGG - Intergenic
1197803725 X:130379147-130379169 GTGAATCAAAATTCTTGGCCCGG + Intergenic
1198179734 X:134194749-134194771 GAAAATAAATATTGTTGGCCGGG + Intergenic
1200486783 Y:3778860-3778882 GAGAAGCACAATTGTTGTGACGG - Intergenic
1200652853 Y:5863343-5863365 TAGAAAAAAAATTGTTGGCCAGG - Intergenic
1201182062 Y:11358418-11358440 GAGCAGCAAAGTTCTGGGCCTGG + Intergenic
1201317364 Y:12661044-12661066 AAGAAGTACAAGTGTTGGCCAGG - Intergenic