ID: 929872852

View in Genome Browser
Species Human (GRCh38)
Location 2:45773184-45773206
Sequence GAGCAGAGTTGGAAGACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 205}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929872852_929872856 4 Left 929872852 2:45773184-45773206 CCCACAGTCTTCCAACTCTGCTC 0: 1
1: 0
2: 3
3: 19
4: 205
Right 929872856 2:45773211-45773233 ATGTCACTGTCCCCAGGAGAAGG 0: 1
1: 0
2: 1
3: 15
4: 230
929872852_929872864 25 Left 929872852 2:45773184-45773206 CCCACAGTCTTCCAACTCTGCTC 0: 1
1: 0
2: 3
3: 19
4: 205
Right 929872864 2:45773232-45773254 GGGTCACCCAGGCTACAGGAGGG 0: 1
1: 0
2: 2
3: 35
4: 359
929872852_929872863 24 Left 929872852 2:45773184-45773206 CCCACAGTCTTCCAACTCTGCTC 0: 1
1: 0
2: 3
3: 19
4: 205
Right 929872863 2:45773231-45773253 AGGGTCACCCAGGCTACAGGAGG 0: 1
1: 0
2: 1
3: 21
4: 224
929872852_929872865 30 Left 929872852 2:45773184-45773206 CCCACAGTCTTCCAACTCTGCTC 0: 1
1: 0
2: 3
3: 19
4: 205
Right 929872865 2:45773237-45773259 ACCCAGGCTACAGGAGGGTGAGG 0: 1
1: 0
2: 8
3: 45
4: 393
929872852_929872855 -2 Left 929872852 2:45773184-45773206 CCCACAGTCTTCCAACTCTGCTC 0: 1
1: 0
2: 3
3: 19
4: 205
Right 929872855 2:45773205-45773227 TCTCTGATGTCACTGTCCCCAGG 0: 1
1: 0
2: 2
3: 31
4: 269
929872852_929872862 21 Left 929872852 2:45773184-45773206 CCCACAGTCTTCCAACTCTGCTC 0: 1
1: 0
2: 3
3: 19
4: 205
Right 929872862 2:45773228-45773250 AGAAGGGTCACCCAGGCTACAGG 0: 1
1: 0
2: 0
3: 14
4: 159
929872852_929872857 5 Left 929872852 2:45773184-45773206 CCCACAGTCTTCCAACTCTGCTC 0: 1
1: 0
2: 3
3: 19
4: 205
Right 929872857 2:45773212-45773234 TGTCACTGTCCCCAGGAGAAGGG 0: 1
1: 0
2: 2
3: 27
4: 273
929872852_929872859 14 Left 929872852 2:45773184-45773206 CCCACAGTCTTCCAACTCTGCTC 0: 1
1: 0
2: 3
3: 19
4: 205
Right 929872859 2:45773221-45773243 CCCCAGGAGAAGGGTCACCCAGG 0: 1
1: 0
2: 0
3: 28
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929872852 Original CRISPR GAGCAGAGTTGGAAGACTGT GGG (reversed) Intronic
900615970 1:3565801-3565823 GAGCAGAGTTGGAAGGCACCTGG - Intronic
902047489 1:13536635-13536657 GATTAGAGTTGAAGGACTGTTGG - Intergenic
902168376 1:14591060-14591082 GAGCAGATTTAGGAGAGTGTAGG + Intergenic
904013720 1:27405022-27405044 GAGCAGAGCTGGGACACGGTGGG + Exonic
908060823 1:60346822-60346844 TGGCAGAGCTGCAAGACTGTGGG - Intergenic
909893117 1:81032799-81032821 GACCAGAGAGGGAAGACAGTTGG + Intergenic
913133420 1:115863785-115863807 GAGCAGTTTGGGAAGAGTGTGGG + Intergenic
915802238 1:158806786-158806808 GAGCAGAGATGGAAAGGTGTTGG - Intergenic
916406919 1:164506941-164506963 GAGCAGAGTTGGAAAGCTTGTGG + Intergenic
916417886 1:164609884-164609906 GAGGAGAGTTGGAAAACTCATGG + Intronic
920942992 1:210501492-210501514 GTGGAGGGTTGGAAGGCTGTTGG + Intronic
921240217 1:213172679-213172701 GAGAAGAGTTGTGAGACTGTGGG + Intronic
922580697 1:226695729-226695751 CAGCAGAATTGGAAGACAGATGG + Intronic
924659274 1:246001928-246001950 AACCAGAGCTGGAAGACTGGCGG - Intronic
1068968675 10:62939697-62939719 GAACAGAGGAGGAAGTCTGTTGG - Intergenic
1069565622 10:69461589-69461611 GTGCAGTGTGGGGAGACTGTGGG + Intronic
1070393444 10:75990817-75990839 GATCAGGGCTGGAGGACTGTGGG + Intronic
1072965477 10:99968820-99968842 GAGCAAAATTCAAAGACTGTTGG - Intronic
1073061507 10:100736375-100736397 GAGCTGAGTTGGCAGCCTGGGGG - Intronic
1074850077 10:117432530-117432552 GAGCAGAGGTGGAGGAATGGGGG - Intergenic
1075079624 10:119374548-119374570 GGGCAGAGTTGGAAGTGAGTTGG + Intronic
1076310552 10:129503751-129503773 AAGCAGACTTGGAATTCTGTCGG + Intronic
1078292677 11:10028917-10028939 GAGCAGAGGTAGAAGAATGAAGG + Intronic
1078661135 11:13286900-13286922 GAGCAGAGCTGAAAGAGTGTGGG + Intronic
1078843578 11:15101624-15101646 GGGCAGAGATGGAAGAGTGGTGG + Intergenic
1079383535 11:19959266-19959288 GACAAGAGTTGGCAGGCTGTGGG - Intronic
1080540132 11:33257464-33257486 GAGCGGAGAAGGAAGACTGGCGG - Intronic
1081809867 11:45908720-45908742 GGGCAGAGGTGGAAGAATGGGGG - Intergenic
1083756349 11:64793679-64793701 GAGGAGAGTGGGAGGAATGTGGG - Intronic
1083829293 11:65221114-65221136 GAGCAGAGATGGCAAACTGCAGG - Intergenic
1084302086 11:68258585-68258607 GAGCAGAGTGGGCAGGCAGTTGG + Intergenic
1084870379 11:72094853-72094875 GGGCAGAGAAGGAAGAATGTGGG - Intronic
1084983392 11:72845775-72845797 GAGCAGACTTAGATTACTGTGGG + Intronic
1085344666 11:75760662-75760684 GAGAAGCGTTGGGAGACTGGAGG - Intronic
1086428565 11:86713080-86713102 GAAGAGAATTGGAAGAGTGTGGG + Intergenic
1087683881 11:101241874-101241896 GATCACAGTTTTAAGACTGTGGG + Intergenic
1088126769 11:106435658-106435680 GAGCAAAGTCTGAAGAGTGTTGG - Intergenic
1089124760 11:116169077-116169099 GAGCAGAGCTGGAAGAACTTTGG - Intergenic
1089396881 11:118141904-118141926 GTGGAGAGGAGGAAGACTGTGGG - Intronic
1089807716 11:121106375-121106397 AAGCAGAGTCGGAACACAGTAGG + Intronic
1091967640 12:4758715-4758737 GAGCAGAGTTTGAAAACTTTTGG + Intronic
1092836358 12:12492739-12492761 GAGCAGTTTTGGTAGAGTGTTGG - Intronic
1094451223 12:30584938-30584960 AAGGAGAGTTGGAATCCTGTGGG + Intergenic
1094769770 12:33641234-33641256 GGGCAGAGATAGAAGACTTTTGG - Intergenic
1097591894 12:61584837-61584859 GAGCAGGCTGGGAAGATTGTTGG + Intergenic
1098971613 12:76863156-76863178 GAGGTGAGTTGGGAGACCGTTGG - Exonic
1099219605 12:79897414-79897436 GGGAAGAGTTGAAAAACTGTTGG + Intronic
1099237491 12:80099112-80099134 GACTAGAGTTAGAAGACTGGGGG + Intergenic
1100057030 12:90524483-90524505 GAGCAGAATTGAAAGATTGCAGG + Intergenic
1100392892 12:94159472-94159494 GAGCAGTGCTGGCAGACTGGAGG + Intronic
1100985327 12:100198091-100198113 GAGCAGAGTAGGCAGGCTCTTGG - Intergenic
1106168407 13:27269238-27269260 GAGCAGAGTTCCAAGAGAGTGGG - Intergenic
1108804697 13:54140116-54140138 GTCCTGAGGTGGAAGACTGTTGG - Intergenic
1110422183 13:75324335-75324357 GTGAAGACTTGGAAGACTGGAGG + Exonic
1110577669 13:77078566-77078588 GAGTAGGGTAGGGAGACTGTAGG + Intronic
1110745374 13:79047381-79047403 GAGGAGAGTGGGGAAACTGTAGG - Intergenic
1111966018 13:94862568-94862590 CAGCAGAGTTGGGAGGCTCTAGG - Intergenic
1112063957 13:95771457-95771479 GAGCAGAGTTGGGGGTCAGTGGG + Intronic
1112921509 13:104618475-104618497 TAGCAGAGTTGGGAGACGGCAGG + Intergenic
1114813259 14:25926323-25926345 GAGTAGAGTTGGAAGGCAGTTGG + Intergenic
1115398795 14:32936817-32936839 GTGCTGAGGTGGCAGACTGTAGG - Intronic
1117460799 14:55942926-55942948 GAGCAGGGCTGGAAGGCTGGAGG - Intergenic
1122738530 14:103857438-103857460 GAGCAGAGTTGGGGCACTGCCGG - Intergenic
1124378393 15:29143419-29143441 GAGCAGAGTTGCCAGGCTGCAGG + Intronic
1126042672 15:44607952-44607974 GAGCAGAGTGGGAAGGGTGGAGG - Intronic
1126072336 15:44875903-44875925 GTCCAGAGTTGGTTGACTGTGGG + Intergenic
1127490027 15:59453779-59453801 GAGAAGAGCTGGAAGAGGGTAGG + Intronic
1130062342 15:80578987-80579009 GACCAGAGAGGGAGGACTGTGGG - Intronic
1132156759 15:99501284-99501306 AAGCCGAGTTGGAAGACGGTGGG + Intergenic
1132372012 15:101306034-101306056 GAGCTTAGGAGGAAGACTGTAGG + Intronic
1132983505 16:2751763-2751785 CAGCAGAGTTGTAAGACGCTGGG - Intergenic
1134885256 16:17785217-17785239 GAGTAGAGTTGGAAAAGTGAAGG - Intergenic
1137098243 16:36338583-36338605 GAGCAGATTTGAGACACTGTTGG + Intergenic
1137106142 16:36469364-36469386 GAGCAGATTTGAGACACTGTTGG + Intergenic
1137112605 16:36576708-36576730 GAGCAGATTTGAGACACTGTTGG + Intergenic
1137132006 16:36897833-36897855 GAGCAGATTTGAGACACTGTTGG + Intergenic
1137156374 16:37301002-37301024 GAGCAGATTTGAGACACTGTTGG + Intergenic
1137160228 16:37365199-37365221 GAGCAGATTTGAGACACTGTTGG + Intergenic
1137169988 16:37526591-37526613 GAGCAGATTTGAGACACTGTTGG + Intergenic
1137189626 16:37851655-37851677 GAGCAGATTTGAGACACTGTTGG + Intergenic
1137196970 16:37972893-37972915 GAGCAGATTTGAGACACTGTTGG + Intergenic
1137197179 16:37976287-37976309 GAGCAGATTTGAGACACTGTTGG + Intergenic
1137199486 16:38014328-38014350 GAGCAGATTTGAGACACTGTTGG + Intergenic
1137594176 16:49713066-49713088 GAGCAGATTTGTCAGACTGGAGG - Intronic
1138213863 16:55186058-55186080 GAGCAGAGTTGGAAGGCTGGTGG + Intergenic
1142111861 16:88336889-88336911 GAGCAGAGATGGTAGACTCGGGG - Intergenic
1143115992 17:4582186-4582208 GAGCAGAGCAGGACGACGGTGGG + Intergenic
1143250267 17:5518294-5518316 GAGCATGTTTGGAAGACAGTGGG - Intronic
1143583293 17:7838650-7838672 GAGCAGAGTGGGCAGACTTTAGG - Intergenic
1147014893 17:37483797-37483819 GAGCAGATGAGCAAGACTGTAGG + Intergenic
1148217075 17:45839129-45839151 CAGCTGAGTTGGAAGTCAGTTGG - Intergenic
1154370951 18:13762681-13762703 GAGCAGAGTTGGGAGTATATTGG + Exonic
1156570672 18:38249160-38249182 GGGGACAGTGGGAAGACTGTGGG - Intergenic
1157591731 18:48840275-48840297 GGGCAAGGTGGGAAGACTGTAGG + Intronic
1158603100 18:58871553-58871575 GAGCACAGTTGGTGGACTGAGGG + Intronic
1158885251 18:61820798-61820820 CAGCAGAGTGGGAAGACTGGAGG + Intronic
1159845947 18:73460175-73460197 GGGAAGAGTTGAAAAACTGTTGG - Intergenic
1159924813 18:74258740-74258762 GAGCAGAACCGGAAGAATGTGGG - Intronic
1160069360 18:75611821-75611843 GAGAAGAGTTGGCAGAGTGTCGG - Intergenic
1161107853 19:2453475-2453497 GAGCAGAGTTGGAAGCCTGCTGG - Intronic
1161415572 19:4144961-4144983 GAGGAGAGTTGGATGCCTGGAGG + Intergenic
1162273904 19:9638113-9638135 GAGTACAGTTGGAGGAGTGTGGG + Intronic
1162325377 19:9996127-9996149 GAGGAGAGATGGAGGAGTGTGGG + Intronic
1164398773 19:27888553-27888575 GAGCAGTGTTGGCAGGCTGCTGG + Intergenic
1165445995 19:35856965-35856987 GAGCAGACTTGGAGGACTCCAGG + Exonic
1165541126 19:36492602-36492624 GAATACAGTTGGAACACTGTAGG + Intergenic
1165778871 19:38420639-38420661 GATCAGAGTTGGAGGTCTCTGGG + Intronic
1167515190 19:49919253-49919275 GAGCAGGGCTGGGAGGCTGTGGG - Intronic
1168561358 19:57386446-57386468 CAGCAGAGTTGAAAGACTGATGG + Intronic
925031742 2:655079-655101 GAGCAGAGGCGGAAGCCTGCTGG + Intergenic
925075244 2:1010895-1010917 GTCCAGAGTCGGAAGACTCTAGG - Intronic
925318528 2:2943097-2943119 GAGCAGAGTTGGTCAACCGTGGG - Intergenic
928009787 2:27596428-27596450 GACCAGAGTTGGGGGACTGGGGG - Intronic
928374398 2:30763302-30763324 CAGCAGAGTTGGAAGGCCATTGG + Intronic
929353330 2:40988086-40988108 GAGAAGAATTAGAAGAATGTAGG - Intergenic
929872852 2:45773184-45773206 GAGCAGAGTTGGAAGACTGTGGG - Intronic
931893183 2:66698317-66698339 GAGCAGAATTAGAAAACTTTGGG - Intergenic
933950939 2:87329050-87329072 TACCAGAGTTGGAAGAGTTTTGG + Intergenic
935255444 2:101306202-101306224 AAGTAGATTTGGAAAACTGTAGG + Intronic
935598722 2:104900525-104900547 GAGAAGAGTAGGAAGGCTGGGGG - Intergenic
936328837 2:111529528-111529550 TACCAGAGTTGGAAGAGTTTTGG - Intergenic
937669974 2:124528128-124528150 GAGCAGAACTGGAAGAATGAAGG - Intronic
938077581 2:128347965-128347987 GAGCAGAGAAAGAAGACTGCAGG - Intergenic
940455856 2:153899162-153899184 GAGCAGAGATTGAAAACTGGGGG - Intronic
940773995 2:157867751-157867773 GAGCAGAGGTTGAAAACTGGTGG - Intronic
941029974 2:160499881-160499903 GAGCAGAGTTGGAGGAGAGTTGG + Intergenic
942355002 2:175101296-175101318 GACCTGAGTTGGAAAAGTGTGGG + Intronic
942455977 2:176138699-176138721 GGGCAGATTTGGAAGACTTGAGG + Intergenic
943159124 2:184224176-184224198 GACTAGACTTGGAAGACTTTAGG + Intergenic
943442132 2:187938356-187938378 GTGCAGAGTTGGTAGCCTGGTGG - Intergenic
944289307 2:197987179-197987201 GATCAGAGCTGGCAAACTGTTGG + Intronic
946402851 2:219477581-219477603 GAGAAGAGGTGCAAGAATGTTGG - Intronic
946507800 2:220319898-220319920 GAAGAGAGTTGAGAGACTGTTGG - Intergenic
946861719 2:224006317-224006339 GAGAAGAGTTGGTAGATTTTTGG - Intronic
948026530 2:234782427-234782449 GAACGAAGTTGGCAGACTGTAGG - Intergenic
948839826 2:240643409-240643431 GGGCGGAGTGGGGAGACTGTGGG - Intergenic
948855781 2:240729953-240729975 GGGCAGAGTGGGAAGCCTCTGGG - Intronic
1169308487 20:4515439-4515461 GAGCAGAGTTAGAAGGCGATTGG + Intergenic
1169380192 20:5099676-5099698 CAGCTGAGTTGCAAGGCTGTGGG - Intronic
1169546874 20:6659530-6659552 GAGGAGAGTTGGATGAAAGTAGG + Intergenic
1170158561 20:13290195-13290217 GAGCTGAGTTGGAAGCCTGGTGG + Intronic
1170997161 20:21373485-21373507 GAGTGGAATTGCAAGACTGTAGG + Intronic
1173043819 20:39490721-39490743 GAAGAGAGTTGGCAGCCTGTTGG - Intergenic
1177325625 21:19584717-19584739 GAGCAGAGTGGGAAGAGTGAGGG - Intergenic
1178355658 21:31908790-31908812 GGGCAGAGTTGGAAGAGACTGGG + Intronic
1179642485 21:42756690-42756712 GTGCAGAGCTGGAAGGCTGCAGG + Intronic
1180000216 21:44992230-44992252 GAGCTGAGTGGGAAGATTTTTGG - Intergenic
1180002059 21:44999649-44999671 GAGCAGAGCTGGAAAACAGAGGG + Intergenic
1181589758 22:23876844-23876866 GAGTAGAGTTGGGATCCTGTTGG + Intronic
1182070647 22:27461458-27461480 GAGCAGGGTTCAAATACTGTTGG - Intergenic
1182301589 22:29340177-29340199 GAGGGGAGTGGGAAGACAGTAGG - Intronic
1184532037 22:45062224-45062246 GAGCAGAGCTGGCTGGCTGTGGG + Intergenic
1184952994 22:47858920-47858942 GAGGAGAGTGTGAAGATTGTGGG + Intergenic
1185396976 22:50597527-50597549 GAGCACAGATGGAAGATCGTCGG - Intronic
949707093 3:6830892-6830914 GAGCAGAGCAGGTAGACTGGGGG - Intronic
952225785 3:31374438-31374460 AAGCAGAAGTGGAAGCCTGTTGG + Intergenic
952666756 3:35916155-35916177 GGACAGAGTTGAAAAACTGTGGG - Intergenic
953993059 3:47498674-47498696 GAGCTAATTTTGAAGACTGTTGG - Intronic
955605690 3:60700826-60700848 GAGCAGAGTTGCATGTCTCTTGG + Intronic
955860407 3:63323618-63323640 GATCAGAGTTCAAAGACTGTAGG + Intronic
956732518 3:72209759-72209781 AAGGAGATTTGGAAGACTTTTGG - Intergenic
957142389 3:76377512-76377534 GTGCAGAGTTGTGATACTGTAGG + Intronic
959259731 3:104061535-104061557 GCACAGAGTTGGAATACAGTAGG + Intergenic
960184963 3:114627092-114627114 GAGTAGAGTTGGAAAAGAGTGGG - Intronic
962007704 3:131363915-131363937 GAGCAGGCATGGAGGACTGTGGG - Intergenic
963569894 3:146980392-146980414 GAACAGGATTGGAAGATTGTCGG - Intergenic
965355584 3:167669114-167669136 AAGCATACATGGAAGACTGTTGG + Intergenic
967262093 3:187652410-187652432 GATCAGAGTGGGAAGATCGTAGG - Intergenic
968506414 4:973250-973272 GAGCAGAGGTGGCAGAAGGTGGG + Exonic
969370162 4:6726940-6726962 GAGGAGAGAAGGAAGACTGGGGG + Intergenic
969386417 4:6852514-6852536 AAGCAGAGTTGGAAGATTAGTGG - Intronic
970665003 4:18326673-18326695 AAGAAGAGTTTTAAGACTGTGGG - Intergenic
971761277 4:30769194-30769216 TTGCAGAGTTGCAGGACTGTAGG + Intronic
973584470 4:52376772-52376794 GAGGAGAAGTGGAAGACTCTGGG + Intergenic
975952926 4:79796182-79796204 TAGCAGAAGTGGAAAACTGTTGG - Intergenic
975995361 4:80307912-80307934 GAGCAGAGCTGGCTGAGTGTTGG + Intronic
978104442 4:104884424-104884446 GAACAGAGTGGGAGGTCTGTGGG - Intergenic
979060799 4:116058572-116058594 GATAAGATTTGGGAGACTGTTGG - Intergenic
979756617 4:124348636-124348658 GAGCAGAGTTTGAAGCCTGCTGG + Intergenic
984130945 4:175875391-175875413 AGACAGAGTTGGAAGACTGATGG + Intronic
984225734 4:177032742-177032764 GAGCAGATTTTGGAGACTGGAGG + Intergenic
987048184 5:14126947-14126969 CAGCATTGGTGGAAGACTGTGGG + Intergenic
991460461 5:66852896-66852918 GAGCTGAGGAGGAAGACTGTAGG + Intronic
997104247 5:131000434-131000456 GAGCAGAGTTGAAACACTGTTGG - Intergenic
999374182 5:151075465-151075487 AGGCAGAGTTGAAAAACTGTTGG - Intronic
999565545 5:152856458-152856480 GATCAAAGTTGGAAAGCTGTGGG - Intergenic
1000927772 5:167214730-167214752 GAGCAGAGGAGGAAGACTAAGGG + Intergenic
1003151059 6:3549216-3549238 CAGCAGAGTTGGAGGATGGTGGG + Intergenic
1007348042 6:41247892-41247914 GTGCAGAGTTGGGTGACTTTGGG - Intergenic
1010472485 6:76245088-76245110 GAGGATAGTGGGAGGACTGTAGG - Intergenic
1011185827 6:84674422-84674444 GGGAAAAGGTGGAAGACTGTGGG + Intergenic
1011718980 6:90135611-90135633 GAGCTGAGTAGGAGGACTGCTGG + Intronic
1015705482 6:136083193-136083215 GAGAACAGTCGGAAGACTGAGGG + Intronic
1017074687 6:150606891-150606913 TAGCAGAGTTGGGAGAGGGTGGG - Intronic
1017575577 6:155798696-155798718 GAGCATAGTGGAAAGGCTGTGGG + Intergenic
1019925647 7:4190569-4190591 GTGCAGAGTGGAGAGACTGTGGG + Intronic
1020679702 7:11221168-11221190 GAGCAGGTTGGGAAGACTGTAGG + Intergenic
1023023449 7:36030984-36031006 AAGCAGAGAAGGAAGACAGTAGG - Intergenic
1024280778 7:47717790-47717812 GGGCAGAGTTGTTAGGCTGTAGG - Intronic
1024752770 7:52487587-52487609 GAGCAGACAGGGAAGGCTGTGGG - Intergenic
1025162621 7:56676680-56676702 CAGCCGTGTTGGTAGACTGTTGG + Intergenic
1028492461 7:91427328-91427350 GAGCACTGATGGAAGACTGCTGG - Intergenic
1028498607 7:91491248-91491270 GTGCAGAACTGGAACACTGTGGG - Intergenic
1030527185 7:110668365-110668387 CAGCAGAGTTGGAAAACAGCTGG + Intronic
1031838164 7:126704073-126704095 GATCAGAGTTGAAAGAATATAGG - Intronic
1032187807 7:129742428-129742450 GGGCAGAGTCGGAAGACTGCTGG - Intronic
1032578060 7:133076612-133076634 GAGATGAGTGGGAAGACTGTAGG - Intronic
1033527425 7:142230422-142230444 GATGAGATTTGGAAAACTGTTGG - Intergenic
1033870200 7:145744857-145744879 GAGCAGAGGTGGAAGCCAATGGG - Intergenic
1036548170 8:9792156-9792178 GAACACAGTTGGAGGACTGGAGG + Intergenic
1040679548 8:49792210-49792232 GAGCAGGGGTGGAATGCTGTTGG - Intergenic
1046194818 8:110847907-110847929 GAGCATAGTAGTAATACTGTTGG - Intergenic
1047828857 8:128609937-128609959 CAGGAGATTTAGAAGACTGTGGG - Intergenic
1048563815 8:135572210-135572232 AATCAGAATTGGAAGACAGTGGG + Intronic
1049257818 8:141623273-141623295 GAGCAAAGATGGAACAATGTTGG - Intergenic
1050799231 9:9588228-9588250 CAGCAGAATTGGAAGACAGAAGG + Intronic
1055427410 9:76210640-76210662 GAGCAGCGTTGCAAGATTTTAGG + Intronic
1056223112 9:84469182-84469204 GACTGGAGTTGGAACACTGTGGG - Intergenic
1057307605 9:93921244-93921266 GAGCAGAGTAGCAGGAGTGTGGG - Intergenic
1059439254 9:114295498-114295520 GAGCAAAGTTGGCAGACTAATGG + Intronic
1059970139 9:119658874-119658896 GAGCAGATTTGGTGGACTGTTGG + Intergenic
1187612430 X:20956870-20956892 GGGCAGACTTGGAAGTCTGAAGG + Intergenic
1192634397 X:72804131-72804153 GAGAACAGTCGGAAGACTGCTGG - Intronic
1192647313 X:72916670-72916692 GAGAACAGTCGGAAGACTGCTGG + Intronic
1192845679 X:74904887-74904909 GAGCAAAATTGGAAGTCTCTAGG - Intronic
1195476149 X:105288052-105288074 GGGCAGAGTTGCAGAACTGTGGG + Intronic
1199574706 X:149302353-149302375 TAGCAGAGGTGGCAGAATGTGGG + Intergenic
1199876610 X:151934811-151934833 AAGCAGGATTGGAAGACTATGGG + Intergenic