ID: 929873246

View in Genome Browser
Species Human (GRCh38)
Location 2:45775416-45775438
Sequence ATGAATAAGCTCTTGCTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 3, 3: 4, 4: 127}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929873246_929873250 -3 Left 929873246 2:45775416-45775438 CCCACCAGCAAGAGCTTATTCAT 0: 1
1: 0
2: 3
3: 4
4: 127
Right 929873250 2:45775436-45775458 CATACTGCCTTTGAATTTCTGGG 0: 1
1: 0
2: 5
3: 22
4: 319
929873246_929873251 -2 Left 929873246 2:45775416-45775438 CCCACCAGCAAGAGCTTATTCAT 0: 1
1: 0
2: 3
3: 4
4: 127
Right 929873251 2:45775437-45775459 ATACTGCCTTTGAATTTCTGGGG 0: 1
1: 0
2: 0
3: 39
4: 319
929873246_929873249 -4 Left 929873246 2:45775416-45775438 CCCACCAGCAAGAGCTTATTCAT 0: 1
1: 0
2: 3
3: 4
4: 127
Right 929873249 2:45775435-45775457 TCATACTGCCTTTGAATTTCTGG 0: 1
1: 0
2: 3
3: 20
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929873246 Original CRISPR ATGAATAAGCTCTTGCTGGT GGG (reversed) Intronic
900738508 1:4315737-4315759 ATAAATGAGCTCGTGCTGTTTGG + Intergenic
902571259 1:17348334-17348356 TTGAAGAAGCTCTTGCTGCAAGG + Intronic
903575062 1:24334593-24334615 ATGGCTAAGCTTCTGCTGGTAGG - Intronic
904805929 1:33132510-33132532 ATGACTAGGCACTTGCTGGAAGG - Intergenic
909486156 1:76176565-76176587 ATCTATAAGCTAATGCTGGTGGG - Intronic
909936217 1:81554389-81554411 CTGACTGAGCTCTTGCTGCTGGG + Intronic
916151346 1:161794740-161794762 AGGCATAAGTTGTTGCTGGTTGG - Intronic
917500622 1:175581851-175581873 ATGAATAAGCACAAGCTTGTCGG - Intronic
918533061 1:185544278-185544300 TTGTAAGAGCTCTTGCTGGTTGG + Intergenic
918719836 1:187839026-187839048 AGGAATAAGGTCGTGCTGCTGGG + Intergenic
919219772 1:194612150-194612172 ATGAATAGGTTCTTGAGGGTTGG - Intergenic
920262105 1:204695580-204695602 GTTAAGAAGCTCTAGCTGGTAGG + Intergenic
1063612501 10:7574934-7574956 CTGAATAAGATCTTGATGCTAGG - Intronic
1068993592 10:63177663-63177685 ATGAATAAGTCCTTGCTTGAGGG + Intronic
1073953405 10:108838218-108838240 AACAAGAGGCTCTTGCTGGTAGG - Intergenic
1074690369 10:115998884-115998906 ATGTATAAGGACTTGGTGGTTGG + Intergenic
1078643830 11:13119919-13119941 ATGAATTTACTATTGCTGGTTGG - Intergenic
1080938631 11:36888761-36888783 TTGAACAAGCACTTCCTGGTGGG + Intergenic
1080993330 11:37568977-37568999 ATGCATCAGTTCTTGCTGGTTGG - Intergenic
1087202818 11:95363375-95363397 ATGAGTAAGCTTTTGTTGGATGG + Intergenic
1089056048 11:115585760-115585782 ATGAGTGAGCTCTGGCTGGGTGG + Intergenic
1091080569 11:132663638-132663660 ATCATTCAGCTTTTGCTGGTAGG - Intronic
1091420394 12:334402-334424 AGGAATATGCACTTTCTGGTTGG - Exonic
1096038611 12:48494611-48494633 AGGAAAAAGCTCTTGTTGGGTGG - Intronic
1097631119 12:62063393-62063415 ATGAATAAGAATTTGATGGTAGG - Intronic
1097804619 12:63951792-63951814 ATTTAAAAGCTCTTGCTGTTAGG + Intronic
1098157153 12:67611251-67611273 AAGAATGAGCTCTTGCTGCATGG - Intergenic
1098209069 12:68143465-68143487 CTGAAGAAGGTCCTGCTGGTTGG + Intergenic
1098327871 12:69321701-69321723 ATGGATAATCTCTTTATGGTAGG + Intergenic
1101940294 12:109094840-109094862 GTGAAAACCCTCTTGCTGGTGGG - Intergenic
1104263030 12:127202843-127202865 ATGATTAAGTTCTTGCAAGTAGG + Intergenic
1104830354 12:131746806-131746828 ATGGAGAAGCTCATGCTGGCCGG + Intronic
1111052053 13:82897465-82897487 ATGAATAAGATCAAGTTGGTTGG + Intergenic
1111134678 13:84025622-84025644 AAGGAAAAGCTTTTGCTGGTGGG + Intergenic
1113291320 13:108909995-108910017 ATGTATAAATTCTGGCTGGTTGG - Exonic
1113679414 13:112232782-112232804 ATAGATAATCTTTTGCTGGTTGG + Intergenic
1114058165 14:18993358-18993380 ATGAAGCAGCTGTTGCTGCTTGG + Intronic
1114104382 14:19408396-19408418 ATGAAGCAGCTGTTGCTGCTTGG - Intronic
1121865771 14:97361044-97361066 ATTAATAATATCTTGTTGGTGGG - Intergenic
1130773890 15:86955903-86955925 ATGGAGAAACTCCTGCTGGTGGG + Intronic
1131795812 15:96015721-96015743 AAAAAGAAGCTCTTGCTGTTGGG - Intergenic
1133382189 16:5340612-5340634 ATGAACTGGCTTTTGCTGGTAGG + Intergenic
1133660948 16:7916985-7917007 AAGAAATAACTCTTGCTGGTTGG + Intergenic
1137582925 16:49645032-49645054 ATGAAGATGGTCTTGATGGTTGG - Intronic
1138964143 16:62063638-62063660 GTGAATATTCTCCTGCTGGTTGG + Intergenic
1140049942 16:71471740-71471762 TGGAACAAGCTCTTGATGGTTGG + Intronic
1144342960 17:14325476-14325498 ACAAATAAGTTCTTTCTGGTGGG - Intronic
1146304896 17:31723387-31723409 ATGAATGAGCTGGTGCCGGTTGG - Intergenic
1149008196 17:51827640-51827662 ATGATTAATCTCTTGCTGGCAGG + Intronic
1151252503 17:72847432-72847454 ATGAATAAGCTTTTTTTAGTTGG - Intronic
1151452822 17:74209425-74209447 AAGAATCTGCTCTTGCTGTTGGG + Intronic
1153493946 18:5678286-5678308 ATGAAGAAGCTCATGCTGAGTGG + Intergenic
1153564729 18:6408368-6408390 ATTTATAAGCTCTTGCTGGTGGG - Intronic
1159294791 18:66470848-66470870 ATGTATTAGCTCTTGGTTGTGGG - Intergenic
1160667647 19:340358-340380 ATTAATAGCCTCCTGCTGGTCGG + Intronic
1160889002 19:1367035-1367057 ATAAATAAGCTGGGGCTGGTGGG + Intronic
1161656316 19:5517659-5517681 ATGATGACGCTATTGCTGGTTGG - Intergenic
925887814 2:8408367-8408389 AAGAATAACTTTTTGCTGGTCGG - Intergenic
928476964 2:31637447-31637469 ATTTATAAACTGTTGCTGGTGGG - Intergenic
929372153 2:41238737-41238759 ATGTGTAATCTGTTGCTGGTTGG + Intergenic
929873246 2:45775416-45775438 ATGAATAAGCTCTTGCTGGTGGG - Intronic
930825573 2:55693595-55693617 ATGAATACGCTCAAGCTGGCTGG + Intronic
933269515 2:80218059-80218081 ATAAATAACCTCTAGCTGATTGG - Intronic
933902385 2:86859324-86859346 ATGAATAAGCCCCTGCTTGCCGG - Intronic
935189491 2:100765560-100765582 CAGAATAAGCTCTTGCTGTCTGG + Intergenic
935778161 2:106489944-106489966 ATGAATAAGCCCCTGCTTGCCGG + Intergenic
937732692 2:125253760-125253782 ATTAATAAGCTGTTGCTTGAGGG - Intergenic
939631987 2:144536771-144536793 ATGAACAAGCTCTTGCTGGATGG - Intergenic
942058584 2:172207285-172207307 CTGACTAAGATCTTGCTTGTGGG + Intergenic
943887582 2:193241587-193241609 ATGAAAAAGCTTCTGCTTGTAGG - Intergenic
944036472 2:195300467-195300489 ATGAATAAACTCTTGGAGGAAGG + Intergenic
945890356 2:215424373-215424395 ATAAATAAGCAGCTGCTGGTGGG - Intronic
946429755 2:219619012-219619034 ATCAATAAGCACTTGCTGGAGGG - Intergenic
1172138280 20:32702989-32703011 ATAAACAAGCTCTTGCTTTTTGG + Exonic
1174233687 20:49069514-49069536 ATGAATAAACTCATAGTGGTAGG + Intronic
1174272650 20:49380794-49380816 AAGAAAAAGTTCTTGCAGGTGGG - Intronic
1174960991 20:55156622-55156644 ATGAATCACCCATTGCTGGTGGG - Intergenic
1176043233 20:63078183-63078205 ATGTGTAAGCTGTTGCTGTTGGG + Intergenic
1178672306 21:34602708-34602730 AAGGAAAAGCTTTTGCTGGTAGG - Intronic
1180476652 22:15715974-15715996 ATGAAGCAGCTGTTGCTGCTTGG + Intronic
1183262282 22:36803485-36803507 ATAAATAAGCTCTGGGTGGATGG + Intronic
1184151947 22:42644487-42644509 ATGAATAGGAGTTTGCTGGTTGG - Exonic
949722115 3:7001395-7001417 GTGAATATGCTCTAGTTGGTGGG + Intronic
953138832 3:40208757-40208779 ATAAATAAGCACTTGATGGGAGG - Intronic
959636491 3:108578266-108578288 CTGAATAAGCACTATCTGGTGGG + Intronic
973584229 4:52375144-52375166 ATGGACTCGCTCTTGCTGGTAGG + Intergenic
979742375 4:124167744-124167766 ATGACTAAGCTCCTGAGGGTAGG + Intergenic
980764219 4:137278393-137278415 ATGAATAATAGGTTGCTGGTGGG + Intergenic
982088658 4:151861741-151861763 ATCAATCAGCTCTTGCTGCATGG - Intergenic
983886555 4:172986845-172986867 AGGAATAAGCTTTAGCTTGTAGG + Intronic
983895106 4:173072867-173072889 ATTAATAAGCTATTGTGGGTGGG + Intergenic
986514412 5:8546181-8546203 AGGAAGAAACTCTTGCTGCTTGG + Intergenic
986831773 5:11588266-11588288 ATGAATAATTTCTTTCTGGATGG + Intronic
987354667 5:17052786-17052808 ATGAATAAGCTCTTGCATGTGGG - Intergenic
991163866 5:63538981-63539003 ATTAATCAGCTTTTGTTGGTGGG + Intergenic
992933341 5:81674453-81674475 TTGAATAAGCTTTGACTGGTAGG - Intronic
993147611 5:84115199-84115221 AAGAATCAGCTCTTGGAGGTAGG + Intronic
995061189 5:107813384-107813406 AAGAAGAAGCTCTAGCTGATAGG + Intergenic
998805768 5:145916500-145916522 ATGAAAAAGCTCTTGAAGGAAGG + Intergenic
1004446074 6:15699933-15699955 AAGAAGAAGCTGTTGCAGGTGGG + Intergenic
1004873624 6:19933230-19933252 ATGAATGAGGGCTTGCCGGTAGG - Intergenic
1008919697 6:56829048-56829070 TTGAACAAGCTATTTCTGGTTGG - Intronic
1015120224 6:129692924-129692946 ATGAATGAGGGCTGGCTGGTGGG - Intronic
1016810482 6:148256213-148256235 ATGATTAAGGTCTTGCTATTTGG - Intergenic
1017515809 6:155154782-155154804 AGGAGGAAGCACTTGCTGGTAGG + Intronic
1017825465 6:158078452-158078474 ATTAATTAGTTCTTGGTGGTGGG - Intronic
1021587616 7:22226535-22226557 ATGAAAAAGCTCTCCCTGTTAGG + Intronic
1022162108 7:27721482-27721504 ATGAACAGGCTAGTGCTGGTTGG + Intergenic
1022463503 7:30634605-30634627 ATCATTAAGCTCTTGATGCTAGG + Intergenic
1023033079 7:36107992-36108014 ATGAAAATGCTCCTGGTGGTGGG - Intergenic
1027894852 7:84027461-84027483 AAGAATAAACTAGTGCTGGTTGG - Intronic
1028956678 7:96701316-96701338 TTGAATGAGGTCTTGCGGGTAGG + Intronic
1030568704 7:111193665-111193687 ATGAAGAGGCTCTTTCTGATTGG - Intronic
1032908335 7:136399577-136399599 ATGATTCACCTCTTGCTGATGGG - Intergenic
1034263283 7:149770203-149770225 AGGATTAAGCTCTTGAAGGTAGG + Intronic
1034512885 7:151550752-151550774 AGGAAGAAGCACTTGGTGGTTGG + Intergenic
1034712219 7:153203693-153203715 TTAAGTAAGCTCTTGCTGGAGGG + Intergenic
1038735076 8:30161412-30161434 ATGAAGAAGTACTTGGTGGTGGG - Intronic
1040555056 8:48471000-48471022 ATGAATAAACTCTTCATGGGGGG - Intergenic
1040774252 8:51020232-51020254 ATAAATAAGCTATTGCTTATAGG - Intergenic
1044576246 8:93772772-93772794 AAGAATAAACTCTTTCTTGTGGG + Intronic
1047182953 8:122606427-122606449 ATGATTAGGCTCCTGCTGGCTGG + Intergenic
1052027955 9:23595509-23595531 ATGAAGAAGGTTTTCCTGGTGGG - Intergenic
1055143976 9:72910396-72910418 ATGTATAAGCTCTTGCAGTAAGG - Intronic
1055479044 9:76691977-76691999 AAGACTAATCTCTTGCTGCTGGG - Intronic
1056080204 9:83085335-83085357 ATAAAAAAGATGTTGCTGGTGGG + Intergenic
1058537994 9:105981976-105981998 ATGAATAAGCTCTGACTCGGAGG - Intergenic
1060349053 9:122841679-122841701 CTGAATAAGCTCTGGATTGTAGG + Intergenic
1186212294 X:7262209-7262231 ATGCAAAATCTATTGCTGGTTGG + Intronic
1189441963 X:41045357-41045379 ATGAATAACCTCCAGCTGGCCGG + Intergenic
1190375186 X:49782365-49782387 GTGAAGATGGTCTTGCTGGTGGG + Intergenic
1191766988 X:64708867-64708889 ATTAATAAGCACTTGTTGGTTGG + Intergenic
1195864481 X:109414480-109414502 ATGAATAAAATATTGCTAGTGGG - Intronic
1196065381 X:111458585-111458607 ATGATTAAGCTATTGCCAGTGGG + Intergenic
1196458647 X:115907405-115907427 ATGAGTAAAGTCTTGATGGTGGG - Intergenic