ID: 929873678

View in Genome Browser
Species Human (GRCh38)
Location 2:45778521-45778543
Sequence GGACGCTGAGTGAAAGTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 69}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929873678_929873692 29 Left 929873678 2:45778521-45778543 CCCACTACTTTCACTCAGCGTCC 0: 1
1: 0
2: 0
3: 5
4: 69
Right 929873692 2:45778573-45778595 AGACACTAAGGGCTCCTCATGGG 0: 1
1: 0
2: 0
3: 13
4: 116
929873678_929873691 28 Left 929873678 2:45778521-45778543 CCCACTACTTTCACTCAGCGTCC 0: 1
1: 0
2: 0
3: 5
4: 69
Right 929873691 2:45778572-45778594 CAGACACTAAGGGCTCCTCATGG 0: 1
1: 0
2: 1
3: 17
4: 198
929873678_929873688 18 Left 929873678 2:45778521-45778543 CCCACTACTTTCACTCAGCGTCC 0: 1
1: 0
2: 0
3: 5
4: 69
Right 929873688 2:45778562-45778584 CCCCTCTACACAGACACTAAGGG 0: 1
1: 0
2: 1
3: 8
4: 137
929873678_929873693 30 Left 929873678 2:45778521-45778543 CCCACTACTTTCACTCAGCGTCC 0: 1
1: 0
2: 0
3: 5
4: 69
Right 929873693 2:45778574-45778596 GACACTAAGGGCTCCTCATGGGG 0: 1
1: 0
2: 1
3: 15
4: 79
929873678_929873686 17 Left 929873678 2:45778521-45778543 CCCACTACTTTCACTCAGCGTCC 0: 1
1: 0
2: 0
3: 5
4: 69
Right 929873686 2:45778561-45778583 CCCCCTCTACACAGACACTAAGG 0: 1
1: 0
2: 0
3: 14
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929873678 Original CRISPR GGACGCTGAGTGAAAGTAGT GGG (reversed) Intronic