ID: 929874162

View in Genome Browser
Species Human (GRCh38)
Location 2:45782597-45782619
Sequence GTACATTATCTTGGAAACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 141}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929874162_929874167 3 Left 929874162 2:45782597-45782619 CCAGTGTTTCCAAGATAATGTAC 0: 1
1: 0
2: 2
3: 9
4: 141
Right 929874167 2:45782623-45782645 TGTGTTTGACCCTCAGATTTGGG 0: 1
1: 0
2: 1
3: 11
4: 172
929874162_929874168 11 Left 929874162 2:45782597-45782619 CCAGTGTTTCCAAGATAATGTAC 0: 1
1: 0
2: 2
3: 9
4: 141
Right 929874168 2:45782631-45782653 ACCCTCAGATTTGGGAAAGATGG 0: 1
1: 0
2: 2
3: 8
4: 194
929874162_929874166 2 Left 929874162 2:45782597-45782619 CCAGTGTTTCCAAGATAATGTAC 0: 1
1: 0
2: 2
3: 9
4: 141
Right 929874166 2:45782622-45782644 TTGTGTTTGACCCTCAGATTTGG 0: 1
1: 0
2: 2
3: 6
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929874162 Original CRISPR GTACATTATCTTGGAAACAC TGG (reversed) Intronic
906843779 1:49168303-49168325 TGGCATTATCTTGTAAACACTGG - Intronic
906891729 1:49723638-49723660 GAAAATAATCTTGGAAAAACTGG - Intronic
906924883 1:50104590-50104612 CCACATTTTCTTGCAAACACAGG - Intronic
908589781 1:65618036-65618058 ATACATTAGCTTGTAATCACTGG - Exonic
908727317 1:67190527-67190549 TTTATTTATCTTGGAAACACTGG + Intronic
911571213 1:99519169-99519191 GTGCATTCTCTTTGATACACAGG - Intergenic
914756773 1:150566910-150566932 GTACACTGTCTTGCAAACATAGG + Intergenic
915067119 1:153234192-153234214 GTACATTGTCCTGGAAAGAGTGG + Intergenic
916512532 1:165485160-165485182 GTAGAGTATATTGGAACCACTGG - Intergenic
916663287 1:166942522-166942544 GTTCATTATTTTTAAAACACTGG + Intronic
918061605 1:181066297-181066319 GTACTTAATCTTGGGAACAAAGG + Intergenic
921609817 1:217198289-217198311 GTACATGCTGTTGGAAACAATGG + Intergenic
922624224 1:227021514-227021536 GTACATTGTCTTGGAACCAGAGG - Intronic
923371167 1:233314780-233314802 GAAAATTATCTTGGACAAACTGG - Intergenic
924092865 1:240520306-240520328 GTCCATTCTCTTTCAAACACAGG + Intronic
924456492 1:244222971-244222993 CTACTTTAACTTGGAAACAGTGG + Intergenic
1069213660 10:65792793-65792815 GTACATAAACTTGGACACAATGG + Intergenic
1070503509 10:77093324-77093346 GTACATTATCATGGCAACCTTGG + Intronic
1072159772 10:92755126-92755148 GTAATTTATTTTGGACACACAGG + Intergenic
1072595093 10:96864103-96864125 GTCCAATATCTTAGAAACTCCGG + Intronic
1072739899 10:97903025-97903047 ATACATTATCTCGGAAGCTCAGG - Intronic
1075276477 10:121097539-121097561 CTTCATTTTCTTGTAAACACGGG - Intergenic
1076473578 10:130736868-130736890 GTCTATTATCCTGGAAACACAGG + Intergenic
1076596961 10:131629348-131629370 GTACAAGAACTTGGGAACACAGG + Intergenic
1079406825 11:20155247-20155269 GTACACTATTTTGTACACACAGG - Intergenic
1081545964 11:44071864-44071886 ATACATTATCTTACAAACAAAGG - Intronic
1083700092 11:64470891-64470913 GTACATTATTTTGCATACATTGG + Intergenic
1085331556 11:75656181-75656203 GTGCAGTGTCTTTGAAACACTGG - Intronic
1087250001 11:95888277-95888299 GTACAGTATGTTGGAAAAATGGG + Intronic
1087491984 11:98839301-98839323 GTACATGTTCTTGGAGACACTGG + Intergenic
1091661346 12:2385991-2386013 GTACATTATGTTAAAAACAAAGG + Intronic
1092713540 12:11364128-11364150 GTACTTGATCTTGGTGACACAGG + Intronic
1092801102 12:12167730-12167752 GTGCACTATCTGGTAAACACTGG + Intronic
1093094144 12:14953441-14953463 GTACAGTGTCTTGTAAACAGTGG - Intronic
1094072018 12:26427131-26427153 GGACATTATGTTAGAAACCCAGG + Intronic
1095179322 12:39128997-39129019 GTACATTAATTTAGAAAAACAGG - Intergenic
1096315490 12:50561072-50561094 GTAAATTATATTTGAATCACAGG + Intronic
1096469471 12:51867166-51867188 TTAAATTTTCTTGAAAACACTGG + Intergenic
1108866143 13:54925108-54925130 GTAAATGATCCTGGAAAAACTGG - Intergenic
1110378975 13:74827686-74827708 GTACATGACATTGGAAACATGGG - Intergenic
1110903589 13:80856726-80856748 GTTCCTCATCTTGGAAACAAGGG - Intergenic
1111476053 13:88749319-88749341 GAACAGAATCTTGGAAACAATGG - Intergenic
1111773625 13:92630347-92630369 GTACATTATCTTTTAAAGATAGG - Intronic
1112561866 13:100522323-100522345 GTACATTACCAGAGAAACACAGG - Intronic
1115489928 14:33949614-33949636 GTAATTTATCTTGGAAACACAGG - Intronic
1117785654 14:59281614-59281636 GGACTTTATCTTGGAAAGAATGG + Intronic
1118141605 14:63090071-63090093 GTACCTGACCTTGGGAACACAGG - Intronic
1121024171 14:90602219-90602241 TTACATTAGTTTGGGAACACTGG + Intronic
1121080009 14:91100167-91100189 GTACATTATCTTTGAAATCTGGG - Intronic
1126400631 15:48265922-48265944 TTACAATATTTTGGACACACTGG - Intronic
1127094655 15:55500435-55500457 TTACATTATCTTCTAAAGACAGG + Intronic
1128179726 15:65591273-65591295 TTACATTATCTAGGAATGACAGG + Intronic
1136663801 16:31790680-31790702 GAACATTATCTTAAAAACCCAGG - Intronic
1137656312 16:50161512-50161534 TTACATTAATTTGAAAACACAGG - Intronic
1138743882 16:59341023-59341045 GTACTTTATCATGGAAAAAAAGG + Intergenic
1140295281 16:73703727-73703749 GTACATTAAGGTGGACACACAGG + Intergenic
1143264015 17:5622171-5622193 GTACAGTATCCTGGATACTCTGG - Intergenic
1146112648 17:30104377-30104399 ATTCATTATGCTGGAAACACTGG - Intronic
1146235666 17:31159054-31159076 GTTGATTATATTGGATACACTGG + Exonic
1149823846 17:59808474-59808496 ATTTATTATTTTGGAAACACTGG - Intronic
1150469414 17:65424095-65424117 ATAAATTGTATTGGAAACACAGG + Intergenic
1153583101 18:6595068-6595090 GTATATTATTTTGGTATCACAGG + Intergenic
1153625897 18:7022199-7022221 GTACAGTGTCTGGGAAATACCGG + Intronic
1155242191 18:23874495-23874517 GAACATTATATTGGAAACTGTGG + Intronic
1155760315 18:29557192-29557214 GTAAATTATATTGGGAAAACTGG + Intergenic
1156023566 18:32626764-32626786 GTACATTTTCTTAAACACACAGG + Intergenic
1156356322 18:36344379-36344401 TTTCATTATGTTGGAAGCACAGG - Intronic
1166439419 19:42798428-42798450 GTCCATTATTCTGCAAACACAGG - Intronic
1167306612 19:48713568-48713590 GTACATGAGCTTGGAAAGTCAGG + Intronic
927052193 2:19341351-19341373 GTACATTAGAGTGGAAACCCAGG + Intergenic
928057985 2:28077799-28077821 TGACAATATCTTGGAAAGACAGG + Intronic
929282787 2:40100613-40100635 GTACACAATGGTGGAAACACAGG + Intronic
929874162 2:45782597-45782619 GTACATTATCTTGGAAACACTGG - Intronic
934495751 2:94796208-94796230 ATAAATTACCTTAGAAACACAGG - Intergenic
940718240 2:157253266-157253288 GTACAGAATCTTAGAAACACCGG - Intergenic
941073252 2:160978543-160978565 TTAGATTATCTTTGAAACATAGG + Intergenic
944526982 2:200629471-200629493 GGAGAAAATCTTGGAAACACTGG - Intronic
944719501 2:202408792-202408814 TTGAACTATCTTGGAAACACAGG + Intronic
946985902 2:225272636-225272658 GTAGATTTTCTTAAAAACACTGG + Intergenic
1177548579 21:22592241-22592263 GTACATTGTCATAGAAACAAAGG + Intergenic
1180029777 21:45199084-45199106 TTACATTTTCTTTTAAACACAGG - Intronic
949644048 3:6072531-6072553 TTACATTATTTTGTAAAGACAGG - Intergenic
950941080 3:16892219-16892241 GTACATAATTTTGAAAACAAAGG + Intronic
950986071 3:17368378-17368400 ATATATTCTCTTGGAAAAACTGG + Intronic
952329308 3:32349450-32349472 GAACATTATAGTGGAAACAAAGG - Intronic
954351473 3:50047758-50047780 GAAAATTTTCTTTGAAACACTGG - Intronic
955788051 3:62560620-62560642 GTACCTTCTCATGGAATCACAGG + Intronic
958041605 3:88232544-88232566 GTATATTATTTTGAAAAAACAGG - Intergenic
959557648 3:107740321-107740343 TTAACTTACCTTGGAAACACAGG + Intronic
960645611 3:119878961-119878983 GTTCATTATCTTGGTTTCACGGG + Intronic
960714992 3:120566298-120566320 GTACAAAATGTAGGAAACACAGG + Intergenic
964099712 3:152974189-152974211 GTTCATTATCTTAGAGACACGGG + Intergenic
968123869 3:196144336-196144358 GTGCTTTATCTTGGAGGCACTGG - Intergenic
970166112 4:13240254-13240276 GTACTTTGTCATGGCAACACAGG + Intergenic
971083150 4:23239076-23239098 TTAAATTAACTTGGAAACAATGG + Intergenic
972851285 4:43053576-43053598 GTCCCATATCTTGGACACACTGG - Intergenic
973553605 4:52059615-52059637 GTCCATTGTCTTGGAAAGTCTGG - Intronic
977350100 4:95873277-95873299 TTTCATAATCTTTGAAACACTGG + Intergenic
978006621 4:103625345-103625367 GTACATAATCTTTGTAACAAGGG - Intronic
983035213 4:162855967-162855989 GAACATTATCCTGAAAACAATGG + Intergenic
983836794 4:172397390-172397412 GTGCATAATCATTGAAACACTGG + Intronic
983842060 4:172469247-172469269 GTAGATTATCTTGGAAAGTCAGG + Intronic
985145093 4:186888466-186888488 GCACATTATGTTGGAAGAACAGG + Intergenic
985268955 4:188176507-188176529 TTACATTTTCTTGCAAACAAAGG - Intergenic
987567925 5:19617379-19617401 GTAAATTATTTTGCAAATACTGG - Intronic
991089673 5:62682074-62682096 CTACATTTTCTTGTAAAAACAGG - Intergenic
992666553 5:79015167-79015189 GTGGATTAACTAGGAAACACAGG - Intronic
993502223 5:88676897-88676919 ATACATTATCTCGAAAGCACTGG - Intergenic
993561103 5:89410473-89410495 ATACATTATCTTAAAAACATGGG + Intergenic
993769662 5:91910487-91910509 GTACATTATTTGGGACACATGGG + Intergenic
994402911 5:99304827-99304849 CTTCATTATCTTGGACATACTGG + Intergenic
999742037 5:154563277-154563299 GTAGATTCTATTGGAAAAACTGG - Intergenic
1000280454 5:159777301-159777323 GTTCTTTATCACGGAAACACTGG + Intergenic
1001234649 5:170019485-170019507 CTACATTATCTAGAAAACGCCGG + Intronic
1003684568 6:8288531-8288553 GTACAGTCTTTTGGAAACACTGG - Intergenic
1004810995 6:19262983-19263005 GTGCATCATCTTGAAAAAACTGG - Intergenic
1009270856 6:61611860-61611882 GGACATAAACATGGAAACACTGG - Intergenic
1012670353 6:102037578-102037600 GTACATAATATTGGAATAACAGG - Intronic
1013164595 6:107578382-107578404 GTACAATAACTTGAAAATACTGG - Intronic
1014920212 6:127205673-127205695 GTACATTATATTGGAGAAATTGG - Intergenic
1016017705 6:139203529-139203551 GTACATTGTCATGGAAACCAAGG - Intergenic
1016467013 6:144335803-144335825 TTATATCATCTTGGAAACCCTGG + Intronic
1016491727 6:144612140-144612162 ATGCATTATGTTGGAAAAACTGG + Intronic
1020848684 7:13320934-13320956 GTACATTATCATGGCTATACGGG + Intergenic
1021209565 7:17830534-17830556 GTAGATTATCTTGAAAACACTGG + Intronic
1022763887 7:33388214-33388236 GTACCTTATCTTGGATATTCTGG - Intronic
1023567870 7:41541279-41541301 CTAAATTTTCTTGAAAACACAGG + Intergenic
1027758496 7:82247611-82247633 GTGCTTTATCATGAAAACACAGG + Intronic
1029335710 7:99897680-99897702 ATTCATTATTTTGGAAATACAGG - Intronic
1033514535 7:142093215-142093237 GAACTTGATGTTGGAAACACTGG + Intronic
1034195549 7:149244266-149244288 GGATATTATATTGGAAGCACAGG + Intronic
1034279141 7:149839289-149839311 GCACATTAGCTTGGAGACAGTGG + Intronic
1038722789 8:30052509-30052531 GTACATTTTCATGGAAACCCAGG - Intergenic
1041645323 8:60245840-60245862 GTGCATTGCCTTGTAAACACAGG - Intronic
1042277037 8:67016346-67016368 CTAAATTTTCTTGGAAACACAGG - Intronic
1043334088 8:79151482-79151504 GTTCTTTATCCTGGGAACACTGG - Intergenic
1044760379 8:95511376-95511398 GTATGTTAATTTGGAAACACTGG - Intergenic
1044934036 8:97276920-97276942 GCACCTTATTTTGGAAATACGGG + Exonic
1045762052 8:105620990-105621012 GCAGATTATCTTGGAAATGCGGG + Intronic
1045953091 8:107873914-107873936 GTAAATGGTCCTGGAAACACTGG - Intergenic
1046245353 8:111553091-111553113 ATACATGATCCTGGAGACACAGG - Intergenic
1048775944 8:137946687-137946709 GCTCATTATCTGTGAAACACTGG - Intergenic
1052102633 9:24468597-24468619 GTAAAATATCTTCAAAACACTGG - Intergenic
1056137246 9:83642446-83642468 GTATATTATATTAGAAACCCAGG - Intronic
1059747575 9:117217951-117217973 CTACATTAAGTTGGAAACTCAGG + Intronic
1059990341 9:119859374-119859396 TTACATTATCTGGGAAGCAGGGG - Intergenic
1186356161 X:8792841-8792863 GTACATTATTTAGGTAACAATGG - Intronic
1189502611 X:41577494-41577516 GTTCATTATCTTAAAAACAATGG - Intronic
1191883916 X:65870193-65870215 GTAGATAATGTTGGAAAAACTGG + Intergenic
1192725431 X:73746250-73746272 GTAGATTATCTTCAAAAGACAGG - Intergenic
1193600467 X:83504053-83504075 GTACATTTTCTTTTTAACACCGG - Intergenic
1197059827 X:122164267-122164289 GTAAATGATATTGGGAACACTGG + Intergenic
1200952406 Y:8912351-8912373 GGGAATTATCTTGCAAACACAGG - Intergenic