ID: 929879845

View in Genome Browser
Species Human (GRCh38)
Location 2:45826071-45826093
Sequence AGTCAAAGTAGACCCCACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 84}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929879845 Original CRISPR AGTCAAAGTAGACCCCACCC AGG Intronic
900529342 1:3145080-3145102 AGCCCAAGTAGGCCCCACGCAGG + Intronic
916347219 1:163807252-163807274 AGTCAAATAACACCCAACCCAGG + Intergenic
921930161 1:220748412-220748434 AGTCAAAGTTGACCCAACTACGG - Exonic
923698187 1:236275515-236275537 AGTCAATGTATTCCCCAACCCGG + Intronic
1064470117 10:15627194-15627216 AGTGAAAGTAGGTCCCACCCAGG - Intronic
1067932719 10:50579416-50579438 AATGAAAATAGACCCCACCAAGG + Intronic
1069190903 10:65488296-65488318 AAACAAAGTAAACCCAACCCTGG + Intergenic
1069667609 10:70173995-70174017 AGTCAAGAAAGGCCCCACCCAGG + Intergenic
1072389822 10:94971735-94971757 AGGTAGAGTAGACCCCATCCTGG - Intronic
1074826759 10:117220368-117220390 AGTCTAGGCAGCCCCCACCCAGG + Intergenic
1081075847 11:38672655-38672677 AGTAAAACTGGCCCCCACCCAGG + Intergenic
1084437487 11:69152670-69152692 AGACAAAGTGAACCCCACTCGGG - Intergenic
1085715654 11:78870955-78870977 GGTCTTAGTAGAGCCCACCCGGG - Intronic
1085959125 11:81438723-81438745 AATCTAAGGAGACCTCACCCTGG - Intergenic
1097018482 12:56003878-56003900 AGACAAGGTAGCCCCCACCGTGG + Exonic
1102923629 12:116810737-116810759 AGCCAAAGTAGACACCTCCAAGG - Intronic
1104051365 12:125196030-125196052 AGTCAAAGCAGATCCCTCCTCGG - Intronic
1110045696 13:70827596-70827618 ACCCAAAGTTGACCCCACACTGG - Intergenic
1110794896 13:79624696-79624718 AGAAAAAGTAGATCCCAGCCTGG - Intergenic
1114815933 14:25958159-25958181 AGTCACAGTAGACCTCACTGAGG + Intergenic
1119446409 14:74667822-74667844 AGTCAGAGAAGACCTTACCCAGG - Intronic
1119514477 14:75237220-75237242 AGCCAAACTTGACCCCACACAGG + Intergenic
1121716404 14:96079063-96079085 AATCAAAAGAGACCCCACTCTGG + Intronic
1128556723 15:68636708-68636730 AGTCCCTGTACACCCCACCCAGG + Intronic
1128737073 15:70059326-70059348 AGACAGAATAGATCCCACCCTGG + Intronic
1130896655 15:88175311-88175333 AGACATAGTAGGCCCCACACAGG + Intronic
1138380708 16:56600409-56600431 AGTTAAAGAAGAACCCAACCAGG - Intergenic
1139209562 16:65064065-65064087 AGCCAAAGGTGACCCCTCCCTGG - Intronic
1143745419 17:8990564-8990586 AGTTCTAGTAGACTCCACCCTGG + Intergenic
1151837324 17:76590974-76590996 AGTGAAAGTGGACTCCAGCCTGG - Intergenic
1152192455 17:78897026-78897048 AGCCAAGGCAGACCTCACCCAGG + Intronic
1155638523 18:27984094-27984116 AGCCAAAGTAGTCTCCACACAGG + Intronic
1158636099 18:59159593-59159615 AGTCAGAGGAGACCCCTCCAAGG + Intergenic
1160942578 19:1627322-1627344 AATCAAAATACACCCCAGCCCGG + Intronic
1163574149 19:18100744-18100766 AGTCAAAAGAGACCCCAAACTGG - Intronic
1163594053 19:18210736-18210758 GGTCAGAGTGGACCCCAGCCAGG + Exonic
1167647549 19:50713866-50713888 AGTCAATGTGGGCCCCGCCCAGG + Exonic
1167937075 19:52918015-52918037 ATACAAAGGAGACCTCACCCTGG + Intergenic
1168639277 19:58020059-58020081 ATTCAATGCAGACCCCAGCCTGG + Intergenic
928372799 2:30753245-30753267 AGTCATAGGAACCCCCACCCTGG - Intronic
929879845 2:45826071-45826093 AGTCAAAGTAGACCCCACCCAGG + Intronic
948688320 2:239685684-239685706 AGTGCAAGGAGAACCCACCCAGG + Intergenic
1170379636 20:15743048-15743070 ATTCAAAGTAGCCCTCACCCCGG + Intronic
1172926638 20:38542996-38543018 ACTCAAAGAACACCCCATCCAGG - Intronic
1175312394 20:58020808-58020830 AGGCAAAGCAAACCCCACGCAGG + Intergenic
1175804899 20:61821690-61821712 ATCCAAAGTAGACCCCCCCAAGG - Intronic
1175985005 20:62760325-62760347 AGACAGAGCAGCCCCCACCCGGG + Exonic
1176124773 20:63470601-63470623 ACTCAAAGCAGAACCAACCCTGG + Intronic
1177344368 21:19850817-19850839 AGTCAATGTAGACCCCTCTTGGG + Intergenic
1179490074 21:41735442-41735464 AGTCACAGAAGTCCCCACCCAGG - Intergenic
1180341212 22:11620739-11620761 AGTCAAGGGAGACGCAACCCCGG - Intergenic
950017743 3:9766066-9766088 AGTCAAAGTAGTCTCTCCCCTGG + Exonic
954256703 3:49412302-49412324 ACGCGAAGTAGGCCCCACCCTGG + Exonic
961008583 3:123421511-123421533 GGTCATAGTGGACCACACCCAGG - Intronic
967361143 3:188633242-188633264 AGTCTAAACAGAACCCACCCGGG + Intronic
968544812 4:1193415-1193437 AGTCTCAGTGGGCCCCACCCTGG + Intronic
975698026 4:77033533-77033555 AGGCAAAGTAGAACTAACCCTGG + Intronic
984094946 4:175423565-175423587 AGACAAAGTAGACCATACCAAGG + Intergenic
984645764 4:182218160-182218182 AGTCAAAATATACCTGACCCCGG + Intronic
989712424 5:44415533-44415555 AGTCAAACTGCACCCCAACCTGG - Intergenic
991277551 5:64867744-64867766 AGACATAGCAGACCCCACCTAGG + Intronic
993698435 5:91090439-91090461 ATTCAAAGTAGACCTGACACTGG + Intronic
997470948 5:134116312-134116334 TCTCTAAGAAGACCCCACCCTGG - Intronic
1003051515 6:2785018-2785040 TGGCAAAGTAGACCACACACTGG - Exonic
1006121768 6:31811264-31811286 TGTCAAAGTCCTCCCCACCCAGG + Exonic
1006122627 6:31816437-31816459 TGTCAAAGTCCTCCCCACCCAGG - Exonic
1006124490 6:31828631-31828653 TGTCAAAGTCCTCCCCACCCAGG - Exonic
1007480876 6:42149017-42149039 AGTCAACCTAGTCCCCACCCTGG + Intergenic
1008140454 6:47825821-47825843 AGTCAAAGGAGAACCCAACTGGG - Intronic
1009435286 6:63610689-63610711 AGAAAAAGTAAACCCCAGCCGGG + Intergenic
1009600118 6:65787850-65787872 AGTCGCTGTGGACCCCACCCAGG + Intergenic
1018476656 6:164149382-164149404 AATCAATGCAGACCTCACCCAGG + Intergenic
1018934471 6:168264771-168264793 AGTCAAAATAGACAACACGCAGG - Intergenic
1021397906 7:20172941-20172963 AGTCCAGGAAGACCCCAACCTGG - Intronic
1022113661 7:27245761-27245783 AGCCAAAGCAGACACCAGCCGGG - Intronic
1026178733 7:68020370-68020392 ACTCAAAGCATGCCCCACCCAGG + Intergenic
1037582676 8:20254884-20254906 GGTCAAAGTCCACCCCAGCCTGG + Exonic
1037894150 8:22640760-22640782 AGTCCAAGCAGTCCCCAGCCAGG - Intronic
1038756909 8:30350332-30350354 AGTCACAGTCAACCCCACCATGG - Intergenic
1044903843 8:96978503-96978525 TGCAAAAGTAGACACCACCCAGG + Intronic
1048319164 8:133385281-133385303 AGGAGAAGGAGACCCCACCCAGG + Intergenic
1052316139 9:27118066-27118088 AGCCAAAGGGGACTCCACCCTGG + Intronic
1055309643 9:74964982-74965004 AGTGACAGCATACCCCACCCGGG + Intergenic
1056666662 9:88586698-88586720 AGAAACAGTAGGCCCCACCCAGG - Intergenic
1058413432 9:104760573-104760595 AGGCAAAGAAGACCCAACACTGG + Intergenic
1186208644 X:7226748-7226770 AGGCAAATTAGCCACCACCCTGG - Intronic
1189182278 X:39015682-39015704 GGACAAACTAGAACCCACCCTGG - Intergenic
1194895674 X:99436311-99436333 AGGAAAAGAAGACCCCAGCCTGG - Intergenic
1196007432 X:110851368-110851390 AATCAAATTTTACCCCACCCTGG + Intergenic