ID: 929881491

View in Genome Browser
Species Human (GRCh38)
Location 2:45840847-45840869
Sequence ATGGGGACATGTGGTGCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 178}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929881486_929881491 -3 Left 929881486 2:45840827-45840849 CCAGCTGGTCGCTTTGTCTCATG 0: 1
1: 0
2: 1
3: 28
4: 425
Right 929881491 2:45840847-45840869 ATGGGGACATGTGGTGCTCATGG 0: 1
1: 0
2: 1
3: 10
4: 178
929881485_929881491 2 Left 929881485 2:45840822-45840844 CCATTCCAGCTGGTCGCTTTGTC 0: 1
1: 0
2: 1
3: 4
4: 144
Right 929881491 2:45840847-45840869 ATGGGGACATGTGGTGCTCATGG 0: 1
1: 0
2: 1
3: 10
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929881491 Original CRISPR ATGGGGACATGTGGTGCTCA TGG Intronic
900243856 1:1628930-1628952 ATGGGGAGAGGTGGAGCTTAGGG + Intronic
900391829 1:2436977-2436999 ATGGGGACCTGAGGTGCTGCTGG + Intronic
901063224 1:6483310-6483332 GTGGGGGCACCTGGTGCTCAAGG - Intronic
904281942 1:29426775-29426797 ATGGGAGCATCTGGAGCTCAGGG + Intergenic
904987637 1:34565035-34565057 ATGGGGTGATGTTGTGCTCATGG + Intergenic
910308866 1:85800270-85800292 ATGGAGACATTTGGTTCTGAAGG - Intronic
911531329 1:99046612-99046634 ATGGTGGCATGTAGGGCTCAGGG - Intergenic
912506058 1:110157139-110157161 ATGAGGACGTGAGGTGCTGAAGG - Intronic
913158944 1:116128284-116128306 AGGAGGACATCTGGTGCCCAGGG + Exonic
916802663 1:168229456-168229478 TTGATGCCATGTGGTGCTCAGGG + Intronic
917962961 1:180158933-180158955 AGAGAGACATGTGGAGCTCACGG + Intronic
918854975 1:189740961-189740983 ATGTAGACATTTGGTGCTAAAGG + Intergenic
920007562 1:202844583-202844605 ATAGAGACATGTGGTGGTCGGGG + Intergenic
921919337 1:220648762-220648784 ATTGGTACATTTGGTGCCCATGG + Intronic
923097162 1:230784761-230784783 ATGGGGAAATGTGAGGTTCAAGG + Intronic
923108097 1:230869170-230869192 TTCGGGGCATCTGGTGCTCAAGG + Intronic
1063102384 10:2962050-2962072 GTGGGAACTTGTGGTGCACAGGG - Intergenic
1064773794 10:18753023-18753045 AAGGGGACATGTGGGGATTATGG + Intergenic
1065191787 10:23218372-23218394 AGGTGGATATGTTGTGCTCAGGG - Intronic
1067657384 10:48206497-48206519 ATGGGGATATGTGGAGGTCCAGG + Intronic
1069745274 10:70711014-70711036 CAGGGGACCTGTGTTGCTCAGGG + Intronic
1071348958 10:84720259-84720281 ATGAGGACAGGTGGAGCCCAAGG - Intergenic
1072772821 10:98156596-98156618 TTGGGGGAGTGTGGTGCTCAGGG + Intronic
1074254723 10:111789813-111789835 ATGGAGAGATGTTGTGTTCATGG - Intergenic
1076829154 10:132985665-132985687 ATGGGGACATGGGCGGCTCAAGG + Intergenic
1077310959 11:1888986-1889008 AAGGGCACATGGGGTGCTGAGGG - Intronic
1079293365 11:19209248-19209270 TTGGGGACTTGTGCTGCTCCAGG - Intronic
1080485700 11:32704583-32704605 ATGGTGACAGGAGGTGCTCCTGG + Intronic
1081630250 11:44684740-44684762 ATTGGGACCTGTGGATCTCAGGG + Intergenic
1083779471 11:64910492-64910514 ATGGAGAGATGTGGAGCACAGGG + Intronic
1084594833 11:70110751-70110773 ATGGGGCCCTTTGCTGCTCATGG - Intronic
1085188470 11:74596737-74596759 ATGGGGAGATGTGGGTCTAAAGG - Intronic
1086152989 11:83633435-83633457 ATGGGGAGATGTGCAACTCAAGG + Intronic
1086722198 11:90134593-90134615 CTGGGGACCTGTGGTCCCCAGGG - Exonic
1088583033 11:111333813-111333835 ATGGTGGCATTTGGTGATCAAGG + Intergenic
1091386882 12:101471-101493 TTGGGGACAGGAGGTGCTCCGGG + Intronic
1091878045 12:3952775-3952797 AGGGGGACTTTTGCTGCTCAGGG - Intergenic
1092734754 12:11569983-11570005 ATGAAGACATCTTGTGCTCATGG - Intergenic
1096561265 12:52437647-52437669 ATGGGGCCAGGTGGCGATCAGGG + Intergenic
1104913516 12:132251867-132251889 CTGGGGACATGTGTTCCTCCAGG - Intronic
1110154873 13:72304294-72304316 AAGGAGACATGTGTTGCTAATGG + Intergenic
1113607630 13:111621980-111622002 AGGGGGACACGTGGGGCTGATGG - Intronic
1115121417 14:29941949-29941971 AAGGGGAAATGTGGGGCTGAGGG + Intronic
1118616626 14:67578474-67578496 ATGAGGACAGGTGGTGCTGTAGG + Intronic
1125279101 15:38025724-38025746 ATGGGGACATGTGGAAATTATGG - Intergenic
1126692319 15:51297283-51297305 ATGGGGGCATGTGGAGATGAGGG - Intronic
1127198987 15:56622967-56622989 ATGCTGACATGTGGAGTTCAAGG - Intergenic
1128930230 15:71697591-71697613 GAGGGGACATGTGGTGATTATGG + Intronic
1129208196 15:74049784-74049806 AGGGGCACATTTGGTGCTTAAGG + Intergenic
1130816444 15:87440352-87440374 AAGGGGAAATGTTCTGCTCAAGG + Intergenic
1132761646 16:1511302-1511324 ATGGGGGAATGTGGTGATGAGGG + Intronic
1132804091 16:1767753-1767775 ATGGGGTGGTGGGGTGCTCAAGG + Intronic
1133897526 16:9943683-9943705 ATGGGGCCATGTAGATCTCAGGG - Intronic
1135003526 16:18798774-18798796 ATGGGGAGAAGTGATGCTGATGG - Exonic
1135227130 16:20670671-20670693 TTGGGAATATCTGGTGCTCAGGG - Intronic
1135313445 16:21423122-21423144 ATGAGGGCATGTGGGGCACAGGG + Intronic
1135366369 16:21855400-21855422 ATGAGGGCATGTGGGGCACAGGG + Intronic
1135445446 16:22515764-22515786 ATGAGGGCATGTGGGGCACAGGG - Intronic
1136152590 16:28360842-28360864 ATGAGGGCATGTGGGGCACAGGG + Intronic
1136194159 16:28640340-28640362 ATGAGGGCATGTGGGGCACAGGG - Intronic
1136210492 16:28754439-28754461 ATGAGGGCATGTGGGGCACAGGG - Intronic
1136310109 16:29401822-29401844 ATGAGGGCATGTGGGGCACAGGG + Intronic
1136323556 16:29503627-29503649 ATGAGGGCATGTGGGGCACAGGG + Intronic
1136438241 16:30243596-30243618 ATGAGGGCATGTGGGGCACAGGG + Intronic
1139002949 16:62536473-62536495 ATGGGTAGATGAGGTCCTCATGG + Intergenic
1139423553 16:66864484-66864506 GTGGGGACATGTGGGGCTTGGGG - Intronic
1139857796 16:69994226-69994248 ATGAGGGCATGTGGGGCACAGGG + Intergenic
1144997094 17:19277571-19277593 ATGGGGACCTGAGGTGTACAAGG + Intronic
1147920549 17:43913921-43913943 ATGGGGAGATGTGGAGCCCTGGG + Intergenic
1149753835 17:59171447-59171469 ATGGTTACATGTGCTGCTGAAGG - Intronic
1150233989 17:63577755-63577777 CTGAGGACATTTGGTGCTCAGGG - Intronic
1151694077 17:75705240-75705262 CAGGGAACAAGTGGTGCTCAGGG - Intronic
1152434325 17:80265967-80265989 ATGGGGACATGGGAAGCCCATGG + Intronic
1153831299 18:8925555-8925577 ATTGAGACATGTTGTGTTCATGG - Intergenic
1154119242 18:11637479-11637501 ATGAGGGCATGTGGGGCACAGGG + Intergenic
1154906391 18:20578247-20578269 ATGTGGACACTTGGTGCGCATGG - Intergenic
1156775299 18:40780325-40780347 ATGGGGAAATGTGTGGGTCAAGG + Intergenic
1157809105 18:50680561-50680583 GTGGGGACAGGTGATGCTGAAGG - Intronic
1158266902 18:55669262-55669284 ATGGGGAGATGTTGTGCAAAGGG + Intergenic
1159558754 18:69972651-69972673 ATGGAGACATGTCATGTTCATGG + Intergenic
1160495446 18:79371704-79371726 ATGGTGACAGGCTGTGCTCAGGG - Intronic
1161407576 19:4099087-4099109 AGGGGGACAGGTGGTGCGCCAGG + Intronic
1161505836 19:4642926-4642948 ATGGGGATAGATGGTGCTGAGGG + Intronic
1163076363 19:14895586-14895608 ATAGGGACACGATGTGCTCAAGG - Intergenic
1164460190 19:28440368-28440390 AGGGTGACCTCTGGTGCTCAAGG + Intergenic
1167953406 19:53045673-53045695 GTGGGGGCATATGGTGTTCAGGG - Intronic
925316813 2:2932849-2932871 ATGTGGACATGTGAAGCTCAGGG - Intergenic
927812627 2:26188403-26188425 ATGTGGAAATGTGGTCCTCTGGG + Exonic
928809688 2:35207690-35207712 GTGAGGACATGTGGAACTCAGGG + Intergenic
929881491 2:45840847-45840869 ATGGGGACATGTGGTGCTCATGG + Intronic
930337000 2:50060668-50060690 ATGGGGACAGGTTTTTCTCATGG + Intronic
930613553 2:53570108-53570130 ACGGGGACATTTAGTGCTGATGG - Intronic
931190094 2:59991961-59991983 ATGGAGACATCTGGTGCTCAAGG + Intergenic
931208933 2:60174178-60174200 ATGATGATATGAGGTGCTCAAGG - Intergenic
931801421 2:65761827-65761849 ATGGTGAAATGTTTTGCTCAAGG + Intergenic
936074381 2:109392447-109392469 ATGGGCACATGTGGGGATGAAGG + Intronic
939185057 2:138850800-138850822 ATGGAGAAATATGGAGCTCAGGG - Intergenic
944594329 2:201247421-201247443 CTGGGGAAATGTGGAGCTGAGGG - Intronic
1170835266 20:19878442-19878464 ATGGGGACATGGGGTGACCCTGG - Intergenic
1172440870 20:34965635-34965657 ATGGGGACATGTGATACAGAGGG + Intergenic
1172590434 20:36113778-36113800 GTGGGGAGATGCGGAGCTCAAGG + Intronic
1175480219 20:59305333-59305355 AAGGGGACAGGTGGTGAACAAGG + Intronic
1178128141 21:29538424-29538446 ATGGGGGCAGTTGCTGCTCAAGG + Intronic
1178874112 21:36399787-36399809 ATGGGGACATCTGGAGACCAGGG + Intronic
1180011513 21:45054424-45054446 ATGGGGACATGGGGAGGCCAAGG + Intergenic
1180161363 21:45999979-46000001 AGGGGGACATGTGAGGATCATGG + Intronic
1181584580 22:23846037-23846059 ATGGGCCCGTGTGCTGCTCATGG + Intergenic
1182304705 22:29359780-29359802 GTGGGGACATTGGGTGCTTAAGG - Intronic
1182752635 22:32654069-32654091 CTGGGGGCCTGTGGTGCCCAAGG + Intronic
1184913152 22:47549470-47549492 ATGGGGATGGGTGGAGCTCAAGG - Intergenic
1185415358 22:50706321-50706343 ATGGGGAAATTTGGTGCTTGTGG + Intergenic
949879089 3:8647868-8647890 ATGGAGACCAGTGGTGCCCATGG + Intronic
952112583 3:30141138-30141160 ATGGGGAAATGTGGGGAACAGGG + Intergenic
954793668 3:53150429-53150451 GTGGGGACATTTTGTGCTCCTGG + Intergenic
956465017 3:69511500-69511522 GTGGGCACATGTGGTGGCCATGG + Intronic
959640959 3:108634184-108634206 CTGGTGAGATGTAGTGCTCAGGG + Intronic
964167447 3:153725636-153725658 ATGGGGACATGCGGGTCTGATGG - Intergenic
966592909 3:181701100-181701122 ATTGCGACATGTGGTGGTCAGGG + Intergenic
967426980 3:189338580-189338602 ATGGAAACATGCCGTGCTCAAGG + Intergenic
967570499 3:191022524-191022546 ATGGGGACATGTGGGTGTAAAGG + Intergenic
969518808 4:7663980-7664002 ATGGGGGCGGGTGGGGCTCAAGG - Intronic
970441238 4:16082933-16082955 ATGGAGAACTGGGGTGCTCAAGG - Intronic
971342666 4:25784957-25784979 CTGGGGAGATGGTGTGCTCAAGG + Intronic
973809254 4:54554053-54554075 ATGGGGGCTTGTGGAGCTAAAGG + Intergenic
978966386 4:114747073-114747095 ATTGGGTCATGTGATGCTTATGG - Intergenic
981014111 4:139955679-139955701 ATGGGGATTTCTGGAGCTCATGG + Intronic
982375921 4:154690339-154690361 ATGGAGACCTGTTTTGCTCACGG - Intronic
982383096 4:154770771-154770793 ATGGGTACATGTAGTCCTAATGG + Intergenic
982433060 4:155345584-155345606 ATGGGGAAATGTAGGGCTCATGG + Exonic
985495016 5:199477-199499 ATGGGGCCGTGTGGGGCTGATGG - Exonic
986524729 5:8661864-8661886 TTGTGGACAGGTGGTGCTCCAGG - Intergenic
987464086 5:18251840-18251862 ATGGGGGCATGTCTTTCTCATGG + Intergenic
987712490 5:21520433-21520455 ATGGGGAGATGTTGTTCACAGGG - Intergenic
988301933 5:29440362-29440384 ATGGGGAGATGTTGTTCACAGGG + Intergenic
991762851 5:69939584-69939606 ATGGGGAGATGTTGTTCACAGGG - Intergenic
991784477 5:70178541-70178563 ATGGGGAGATGTTGTTCACAGGG + Intergenic
991842077 5:70814624-70814646 ATGGGGAGATGTTGTTCACAGGG - Intergenic
991876923 5:71178929-71178951 ATGGGGAGATGTTGTTCACAGGG + Intergenic
994168838 5:96637356-96637378 ATGGTTACATATGGTGCTCTGGG - Intronic
996847197 5:127912936-127912958 ATGGGACCATGTGTTGGTCAGGG - Intergenic
997002599 5:129780327-129780349 ATCTGGACATCCGGTGCTCAAGG - Intergenic
997574455 5:134963303-134963325 CTGTGGACATGTGGTGTGCAGGG + Intronic
1000172171 5:158712915-158712937 ATGAGGAGATGGGGTGCTTAAGG + Intronic
1002533330 5:179862499-179862521 ATGAAGACCTGTGGAGCTCAGGG + Exonic
1003171986 6:3727190-3727212 ATGGGGACATGTTTGCCTCAAGG - Intronic
1003501811 6:6709335-6709357 ATGGTGAGATGTGTTGCTCGGGG + Intergenic
1003730333 6:8814769-8814791 TTTGGGACATGTTGTTCTCATGG - Intergenic
1004407987 6:15352446-15352468 ATGTGGTCATGTGGTCCTCTGGG - Intronic
1004851350 6:19702842-19702864 ATGGGGACAGGTGGTGTTATAGG + Intergenic
1005003294 6:21263952-21263974 ATGGGCAGATGTGGTTCGCAAGG + Intergenic
1005397425 6:25397451-25397473 ATGGGGACATCTGGTGCATAGGG + Intronic
1006503258 6:34471543-34471565 AAAGGGAGATGTGGTGATCAAGG + Intronic
1007418931 6:41707664-41707686 ATGGGAACAGGTGGAGCCCAGGG + Intronic
1008252474 6:49257190-49257212 AACGGGACATGTGGTTCTTAAGG + Intergenic
1008796170 6:55305550-55305572 ATAGGGACATGTACTGCTGAGGG - Intergenic
1009005164 6:57775937-57775959 ATGGGGAGATGTTGTTCACAGGG + Intergenic
1009625388 6:66133989-66134011 ATGCTGAAATGTGGTCCTCAGGG - Intergenic
1018188808 6:161290939-161290961 ATGGGGACAGATGTTCCTCATGG - Intergenic
1019887450 7:3917902-3917924 ATGGGAAGATTTGGGGCTCAGGG + Intronic
1020503286 7:8951259-8951281 GTGGGGAAATGGGGTGCTCTGGG + Intergenic
1022443202 7:30450330-30450352 ATGGGGACATGGGGTGCAGGGGG - Intronic
1024784248 7:52887616-52887638 TTTGGGCCATGTGGTCCTCATGG - Intergenic
1027718701 7:81710057-81710079 ATGGACACATGTGGTCCTGAAGG - Intronic
1028513148 7:91647138-91647160 ATGGGGACTTGTGAAGCACATGG + Intergenic
1029004862 7:97198592-97198614 ATGGGGACATGGGGTCTTCTCGG + Intergenic
1032097703 7:128947677-128947699 ATGGGGAGGCGTGGGGCTCAAGG + Intronic
1033225002 7:139554418-139554440 GTGGGGGCAGGTGGCGCTCATGG + Intergenic
1035523245 8:292060-292082 CTGAGGGCAAGTGGTGCTCACGG - Intergenic
1035797842 8:2375851-2375873 ACGGGGACATGGGCTGCTCAAGG + Intergenic
1036147782 8:6270519-6270541 ATGGGGCCATGTGGATGTCAAGG + Intergenic
1037247579 8:16854030-16854052 ATTGAGACATGTTGTGTTCATGG + Intergenic
1037300059 8:17442191-17442213 AAGGGGCCATGTGGAGCTGAGGG + Intergenic
1037890076 8:22619395-22619417 CTGGGGACTTTTGGAGCTCAGGG - Intronic
1039917483 8:41870829-41870851 ATGTGGACACGTGGTGCTGCTGG + Intronic
1040580707 8:48696378-48696400 GTGGGGACATGGGGTCCTGACGG + Intergenic
1042561501 8:70075219-70075241 ATGAGGACAAGTGGTACTCCAGG + Intergenic
1045255873 8:100520476-100520498 CTGGGGTCATGTAGTGCTCAAGG + Intronic
1048496267 8:134938732-134938754 ATGGGGACATGTTGTTCAAAGGG - Intergenic
1049818606 8:144620738-144620760 ATGGGCACAGGCGGTGCTCAGGG - Intergenic
1053902678 9:42810718-42810740 ATGGGGCCATGTGGTGACCTTGG - Intergenic
1056455448 9:86755159-86755181 ATTGGCACATGTGGTGCCCTTGG - Intergenic
1056941490 9:90960351-90960373 ATGGGGACCTCTGGGGCCCAAGG + Intergenic
1057763226 9:97892882-97892904 ATGGAAACATGGGGTGCTGAGGG - Intergenic
1058562853 9:106248147-106248169 ATAGGGAAATGTATTGCTCAAGG + Intergenic
1061875538 9:133541739-133541761 AAGGGGACAGGTGCTGCCCAAGG - Intronic
1187598191 X:20798074-20798096 ATGGGTCCAAGTGATGCTCAGGG - Intergenic
1187895544 X:23976735-23976757 ATGGGGACAGGTGTTTCCCATGG - Intergenic
1190916597 X:54815709-54815731 GTGGGGACATCTGGGGCTTATGG + Intronic
1192183511 X:68930732-68930754 ATGTGGACATGTGGAGGGCAGGG + Intergenic
1196603745 X:117631596-117631618 ATGAGGACATGTTTTTCTCATGG - Intergenic