ID: 929883365

View in Genome Browser
Species Human (GRCh38)
Location 2:45856684-45856706
Sequence CAGGGGGGATGGAGGGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1852
Summary {0: 1, 1: 2, 2: 7, 3: 125, 4: 1717}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929883365_929883374 1 Left 929883365 2:45856684-45856706 CCAACTTCCCTCCATCCCCCCTG 0: 1
1: 2
2: 7
3: 125
4: 1717
Right 929883374 2:45856708-45856730 CTTCTATTTTCCCCAGCCTCTGG 0: 1
1: 1
2: 9
3: 82
4: 684

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929883365 Original CRISPR CAGGGGGGATGGAGGGAAGT TGG (reversed) Intronic
900271210 1:1789910-1789932 CATGGAGGAAGGAGGGAAGCGGG + Intronic
900315782 1:2055704-2055726 CAGTGGGGATGGTGGGAAAGAGG + Intronic
900398061 1:2461373-2461395 CAGGGAGGAGGGAGGCATGTGGG + Intronic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
900993178 1:6107155-6107177 ATGGAGGGATGGAGGGAAGGTGG + Intronic
900993386 1:6107989-6108011 GATGGGGGATGGAGGGATGAAGG + Intronic
901419753 1:9143004-9143026 CAGGAGGGAGGGAGGGAAGAAGG - Intergenic
901429121 1:9201753-9201775 GAGGAGGGAAGGAGGGAAGGAGG - Intergenic
901519079 1:9768958-9768980 AAAGGGGGAAGGAGGGAAGAAGG + Intronic
901523776 1:9806219-9806241 CAGGGGGGGTGGAGGGGGGGAGG + Intronic
901739607 1:11333739-11333761 AGGGGGGCAGGGAGGGAAGTGGG + Intergenic
901855040 1:12039146-12039168 CAGGGAGGGAGGAGGGATGTGGG + Intergenic
901895793 1:12310864-12310886 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
901895796 1:12310872-12310894 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
901895799 1:12310880-12310902 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
901895802 1:12310888-12310910 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
902446757 1:16471287-16471309 CAGGGGTTAAGGAGGGAAGGAGG - Intergenic
902519854 1:17010088-17010110 CAGGGGGGAAGGGGGGAACGGGG - Intronic
902539711 1:17145540-17145562 CAGCGTGGCTGGAGAGAAGTGGG - Intergenic
902665632 1:17935753-17935775 AAGGTGGGAGGGAGGGAAGAAGG - Intergenic
902671748 1:17979561-17979583 GGGGTGGGATGGAGGGAAGTAGG - Intergenic
902688922 1:18097423-18097445 AAGGAGGGAGGGAGGGAAGAAGG - Intergenic
902699744 1:18163661-18163683 CAATGGGGTTGCAGGGAAGTTGG - Intronic
902800238 1:18825016-18825038 CCTGTGGGATGGAGTGAAGTGGG - Intergenic
902908894 1:19580446-19580468 CAGAGAGGATTGAGGGAAGATGG + Intergenic
902990563 1:20184782-20184804 GAGGGAGGAGGGAGGGAGGTGGG + Intergenic
903070419 1:20724396-20724418 CAGAGGGGCTGGTGGGCAGTGGG - Exonic
903074239 1:20750094-20750116 TAGGGTGGATGGAGGGTAGATGG - Intronic
903136585 1:21313358-21313380 CTGGGGGGATGGAGGGAGCCCGG + Intronic
903331712 1:22600058-22600080 AAGGGGGGATGGAGGGAGGAAGG + Intronic
903331738 1:22600139-22600161 GAGGAGGGAGGGAGGGAAGGAGG + Intronic
903353338 1:22731231-22731253 CGGGGGGAATGGAGGGCAGAGGG + Intronic
903406772 1:23103900-23103922 GAGGGGGGAAGGAGGGAGGGAGG + Intronic
903549661 1:24149181-24149203 GTGTGGGGATGGAGGGAGGTGGG + Intergenic
903670257 1:25031201-25031223 CTGGAGGGATGGAGGGATGGAGG + Intergenic
903817629 1:26076200-26076222 CAGGGCAAATGGAGGCAAGTAGG + Intergenic
903996482 1:27308065-27308087 CAGGGGGCAGGGAGGGAGGGTGG - Exonic
904416347 1:30363177-30363199 CACAGGAGATGGTGGGAAGTGGG + Intergenic
904727189 1:32558144-32558166 AAGGAGGGAAGTAGGGAAGTAGG + Intronic
904823452 1:33259356-33259378 CTTGGGGGGTGGAGGCAAGTTGG + Intronic
904876897 1:33662336-33662358 CAGGGAGCAAGGAGGGATGTGGG - Intronic
904894094 1:33801159-33801181 GAGGGGGCATGGAAGGAAGAGGG - Intronic
905094404 1:35456841-35456863 AAGGAGAGATGGAGGGAAGGAGG + Intronic
905105957 1:35563734-35563756 AAGGGGGGAAGGATGGAGGTAGG - Intronic
905188475 1:36214411-36214433 CAGTGGGGATGAAGAAAAGTGGG - Intergenic
905207749 1:36352619-36352641 CAGGGGGAAGGGAGGGAAACAGG - Intronic
905521759 1:38605777-38605799 CAGGGGGGCTGGAGAGGAGGTGG - Intergenic
905776382 1:40669985-40670007 CAAGAGGGATGGAGAGAAGTGGG - Intergenic
905913603 1:41670406-41670428 CAGGGGGGATGGAGGCACCTGGG - Intronic
906076835 1:43058216-43058238 TAGGGAGGGTGGTGGGAAGTCGG + Intergenic
906188687 1:43881540-43881562 GAGGAAGGAGGGAGGGAAGTGGG - Intronic
906315437 1:44784156-44784178 CGGGAGGGAAGGAGGGCAGTGGG + Exonic
906326594 1:44850041-44850063 CAGGGGTGGTGGAGGGAAGGTGG + Intergenic
906390131 1:45407958-45407980 CAGGAGAGATGTTGGGAAGTGGG - Intronic
906498449 1:46322304-46322326 CAGGAGGGATAGAGAGAAGGGGG + Intergenic
906558917 1:46739566-46739588 AAGGAGGGAAGGAGGGAAGAAGG - Intergenic
906558919 1:46739574-46739596 AAAGGGGGAAGGAGGGAAGGAGG - Intergenic
906580238 1:46930012-46930034 CAGGTGGGAAGAAGGGAAGGTGG + Exonic
906603487 1:47148878-47148900 CAGGTGGGAAGAAGGGAAGGTGG - Exonic
906679194 1:47713650-47713672 GAGGCAGGATGGAGGGAAGAGGG + Intergenic
906764785 1:48418798-48418820 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
906820958 1:48929415-48929437 AAGGGGGGCAGGAAGGAAGTTGG - Intronic
907014618 1:50999793-50999815 AGCGGGGGTTGGAGGGAAGTGGG + Intergenic
907085299 1:51666998-51667020 CAGAGAGGATGGAGACAAGTTGG + Intronic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907325901 1:53638532-53638554 CAGTGGGGTTGGGGGGCAGTGGG - Intronic
907437427 1:54458757-54458779 CAGGAGGGAGGGAAGGAAGGAGG + Intergenic
907437497 1:54458968-54458990 CAGGCGGGAAGGAGGGAGGGAGG + Intergenic
907600286 1:55761912-55761934 CAGGGAGAATGGAGTCAAGTTGG + Intergenic
908838852 1:68257684-68257706 CAGTGGAGATGAAGAGAAGTTGG - Intergenic
908969318 1:69807895-69807917 CAGGGAGAATGGAGCCAAGTTGG - Intronic
909314310 1:74196756-74196778 CAGTGGGAATGGTGAGAAGTTGG - Intronic
909393080 1:75136998-75137020 CAGGGGGAAGGGAGGGGAGGCGG + Intronic
909431062 1:75588260-75588282 GAGGGGGGAGGAAGGGAGGTGGG + Intronic
909434016 1:75619226-75619248 CAGGAGGGAGGGAGGGAGGAAGG + Intergenic
909472882 1:76049317-76049339 GAGGGGGGAGGGAGGGAAGAAGG - Intergenic
909845663 1:80390725-80390747 AAGGGGAGATAGAGAGAAGTTGG + Intergenic
909897716 1:81094010-81094032 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
909959566 1:81823355-81823377 GAGGGGGGAGGGAAGGAAGGAGG - Intronic
910004066 1:82373543-82373565 GAGGGGGGAGGGAGGGAGGGAGG - Intergenic
910521261 1:88124725-88124747 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
910611181 1:89144015-89144037 GAGGAGGCAGGGAGGGAAGTAGG - Intronic
910726438 1:90344835-90344857 TAGTGACGATGGAGGGAAGTGGG - Intergenic
910827668 1:91427042-91427064 CAGGGAGAATGGAATGAAGTTGG - Intergenic
911086512 1:93982232-93982254 GAGGGGGCAGGGAGGGAAGGGGG - Intergenic
911470561 1:98313007-98313029 CAAAAGGGATGGAGGAAAGTGGG + Intergenic
911667596 1:100571665-100571687 CAGGGGGGATGATGGAAAGAGGG + Intergenic
911688930 1:100809102-100809124 CAGTGGGGATGCAGAGCAGTGGG + Intergenic
911689948 1:100821483-100821505 CAGGGAGAATGGAAGCAAGTTGG + Intergenic
912204476 1:107494800-107494822 AAGGGGAGATGGAGTGAAGAGGG - Intergenic
912269360 1:108193327-108193349 AAGGGGGGAGGGAGGGAGGAGGG - Intronic
912308479 1:108595431-108595453 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
912330473 1:108815817-108815839 CAGTGAGGATGGAGGGAAACTGG - Intergenic
912483394 1:110003498-110003520 GAGTGGGGATGGAGGGTAGGGGG + Intronic
912699491 1:111866303-111866325 CAGGCTGGATGGAGCGCAGTGGG + Intronic
912772071 1:112473187-112473209 CAGGAGAGAGGGAGGGAAGGAGG + Intronic
913089412 1:115466357-115466379 CAGGGAGGAAGGAGGGCTGTGGG - Intergenic
913274636 1:117124879-117124901 CAGTGGGGATGGAAAGAAATCGG - Intergenic
913720984 1:121594326-121594348 GAGGGGGGGGGCAGGGAAGTGGG + Intergenic
914024888 1:143903918-143903940 TGGGAGGGATGGAGGGAAGGAGG - Intergenic
914353922 1:146865286-146865308 CAGGGGGGGTGGAGAGATGGTGG + Intergenic
914355954 1:146884827-146884849 CACTGGGGATGGTGGAAAGTGGG - Intergenic
914663317 1:149811638-149811660 TGGGAGGGATGGAGGGAAGGAGG - Intronic
914983675 1:152438727-152438749 GAGGGTGGATAGAGGGGAGTTGG + Intergenic
915100689 1:153497186-153497208 GAGGGAGGTTGGAGGGAAGCGGG - Intergenic
915311384 1:155007448-155007470 CAGGGGGAATGCCGGGAGGTTGG + Intronic
915528104 1:156488434-156488456 CAGGGAGGATGCAGGGCAGGAGG + Intronic
915556370 1:156663135-156663157 CAGGGAGGAGGGAGGAAAGTAGG + Intergenic
915566360 1:156715604-156715626 AAGTGGGGAAGGAGAGAAGTGGG - Intergenic
915602204 1:156929494-156929516 CAGAGGTGGTGGAGGGAAGAAGG + Intronic
915744994 1:158149186-158149208 CAGTGTGGATGGAGAAAAGTGGG + Intergenic
916275309 1:162987643-162987665 GAGGGGTGCTGCAGGGAAGTCGG - Intergenic
916512120 1:165481816-165481838 CAGGAGGGAGGGAGGGAGGAAGG + Intergenic
917029326 1:170671758-170671780 CAGGGTGGCAGGAGGGGAGTGGG + Intronic
917261037 1:173169753-173169775 CAGTGGGGATGAAGAGAGGTTGG + Intergenic
917320969 1:173781034-173781056 GAGGGAGGAGGGAGGGAGGTGGG + Intronic
917739725 1:177950930-177950952 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
917816285 1:178713199-178713221 GAGGGGGGAGGAAGGGAAGGAGG + Intergenic
917897226 1:179503684-179503706 CAGGGGGGAGGGATGGCATTAGG - Intronic
918018192 1:180659119-180659141 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
918343200 1:183584006-183584028 TAGTGGGGATGGAGAGAAATAGG + Intronic
918482925 1:184998754-184998776 AAGGAAGGAAGGAGGGAAGTAGG + Intergenic
918665566 1:187146704-187146726 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
918857754 1:189780666-189780688 AGGGAGGGATGGAGGGAAGAAGG + Intergenic
918895360 1:190336819-190336841 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
919221132 1:194629906-194629928 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
919509758 1:198447614-198447636 AAAGGGGGAGGGAGGGAAGGAGG - Intergenic
919595745 1:199559991-199560013 GTGGGGGGATGGAGAGAGGTTGG + Intergenic
919710308 1:200720983-200721005 AAGGGAGGAAGGAGGGAAGGAGG - Intergenic
919888880 1:201955594-201955616 CAAGGGAGAAGGAGGGCAGTGGG - Intronic
920154542 1:203937669-203937691 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
920274032 1:204790574-204790596 CAGTGGGGATGAAGGGAACTAGG - Intergenic
920547672 1:206832075-206832097 GGGGTGGGATGGAGGGAGGTGGG - Intronic
920634482 1:207686180-207686202 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
920684934 1:208102171-208102193 CTGGAGGGAGGGAGGGAAGCTGG - Intronic
920687964 1:208124217-208124239 GAGGGTGGAGGGAGGGAAGGGGG + Intronic
920748038 1:208647326-208647348 AAGGAGGGAGGGAGGGAAGGGGG - Intergenic
921030622 1:211332459-211332481 CCTGGAGGATGGAGGGAGGTGGG + Intronic
921063958 1:211609652-211609674 CAGGGGGCATGGAGGGCCGCAGG - Intergenic
921468064 1:215515220-215515242 CAGGGAGGATGAAGAGAGGTTGG + Intergenic
921602883 1:217125149-217125171 CACTGGGGAGGGAGGGCAGTGGG + Intronic
921984708 1:221299964-221299986 CAGGGGGAATGAAGAGAGGTGGG - Intergenic
922265588 1:223980773-223980795 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
922265595 1:223980789-223980811 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
922776408 1:228216084-228216106 GAGGGGGAAAGGAGGAAAGTGGG - Intronic
922974202 1:229770090-229770112 AAGGGGAGATGGAGGGAGGGAGG - Intergenic
923079838 1:230642599-230642621 CCGGCGGGATGGAGAAAAGTAGG + Exonic
923127730 1:231047188-231047210 AAGGGGTTATGGAGGGAAGGAGG - Intergenic
923129668 1:231064613-231064635 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923546514 1:234927479-234927501 CAGGCTGGGTGGAGGGCAGTGGG - Intergenic
923688786 1:236173420-236173442 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
923835762 1:237609335-237609357 AAGGGGGGAGGGAGGGATGGAGG - Intronic
924005138 1:239600732-239600754 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
924091605 1:240507312-240507334 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
924116522 1:240753161-240753183 AAGGAGGGATGGAGGGAGGGAGG - Intergenic
924116529 1:240753177-240753199 CAGAAGGGAGGGAGGGAAGGAGG - Intergenic
924496487 1:244595411-244595433 GAGGAGGGAAGGAGAGAAGTGGG + Intronic
924602573 1:245504375-245504397 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1062822980 10:548504-548526 CAGGAGGGAGGGAGGGAGGCAGG + Intronic
1062832729 10:616947-616969 CAGTGGGGATGGGGGGTGGTTGG - Intronic
1063156291 10:3382179-3382201 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1063156298 10:3382195-3382217 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1063193326 10:3718064-3718086 AGGGAGGGAAGGAGGGAAGTGGG + Intergenic
1063235998 10:4117299-4117321 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
1063497154 10:6520564-6520586 CAGGGAGGATGGAGTGAAACAGG - Intronic
1063576299 10:7265147-7265169 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
1063592380 10:7407389-7407411 GAGGGGGGATGGAGAGTGGTGGG + Intronic
1063689052 10:8266267-8266289 CGGAGGGGATGGAGAGAAGAGGG + Intergenic
1064183838 10:13143043-13143065 CAGGGGGTAGGGAAGGAAGATGG - Intergenic
1064405548 10:15059124-15059146 AAGGGGAGAGGGAGGGAAGGGGG - Intronic
1064533040 10:16329589-16329611 CGGGTGGGAAGGAGGGAAGGAGG + Intergenic
1064652094 10:17519636-17519658 AAGGGAGGAAGGAGGGAAGGAGG + Intergenic
1065077644 10:22097583-22097605 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1065177682 10:23095408-23095430 CAGGTGGGAAGGAGGGAAGGAGG + Intergenic
1065324459 10:24538539-24538561 TAGGAGGGATGGAGGGAGGGAGG + Intronic
1065874183 10:29982969-29982991 AAGGGGAGAGGGAGGGAAGGAGG + Intergenic
1065874328 10:29983844-29983866 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1065897280 10:30175111-30175133 AAGAGGGTATGAAGGGAAGTTGG - Intergenic
1065905627 10:30248535-30248557 GAGGGGGGAGGGAGGGAGGGAGG + Intergenic
1065926337 10:30436460-30436482 AAGGGGAGAGGGAGGGAAGCAGG - Intronic
1066066079 10:31761810-31761832 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1066236517 10:33490154-33490176 CAGGGTGGAGGGAGGGACGGAGG + Intergenic
1066367763 10:34793277-34793299 CAAGGGAGCTGGAGGGCAGTAGG + Intronic
1067005529 10:42657339-42657361 AAGGGGGGAGGGTGGGAAGGGGG - Intergenic
1067042710 10:42963510-42963532 GGGGAGGGAGGGAGGGAAGTGGG - Intergenic
1067563672 10:47321706-47321728 CAGCTGGGATGCAGGGATGTGGG + Intergenic
1067684061 10:48456820-48456842 CAGTGGGGAAGGAGGGAGGGAGG - Intronic
1067761969 10:49055191-49055213 CAGGGGGCCTGGAAGGATGTTGG - Intronic
1067827226 10:49585594-49585616 GTGGGGAGATGGAGAGAAGTTGG + Intergenic
1067914669 10:50384473-50384495 AAGCAGGGATGGAGGGAAGGAGG - Intronic
1068067872 10:52154791-52154813 CAGGGGAGAAGGGTGGAAGTGGG - Intronic
1068079525 10:52302707-52302729 CTAGGGGGATGGAGGGACGGAGG - Intergenic
1068250728 10:54436080-54436102 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1068381066 10:56254732-56254754 TAGGAGGGATGCAGGGAAATAGG - Intergenic
1068513683 10:57998912-57998934 CAGTTAGGATGGAGGGCAGTGGG - Intergenic
1068519887 10:58066467-58066489 CAGGTGGGATGAAGAGAAGTGGG - Intergenic
1068585426 10:58792841-58792863 CAGGGGAGGGGGAGGGAAGGGGG - Intronic
1068765354 10:60757389-60757411 GAGGGAAGATGAAGGGAAGTGGG - Intergenic
1068810273 10:61247874-61247896 ATGGATGGATGGAGGGAAGTTGG - Intergenic
1068880872 10:62047645-62047667 CAGGGTGGCTGGAAGGAGGTGGG + Intronic
1068922439 10:62498809-62498831 GTGGGGGGGTGGAGGGCAGTGGG + Intronic
1068983045 10:63081443-63081465 GAGGGGGGAGGGAGGGAGGGAGG + Intergenic
1069190414 10:65480211-65480233 AAGGGGGAAAAGAGGGAAGTAGG + Intergenic
1069360309 10:67633873-67633895 CAGGGAGGATGGAACCAAGTTGG + Intronic
1069414424 10:68185163-68185185 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1069414427 10:68185171-68185193 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1069583951 10:69584575-69584597 CAATGGGAATGGAGTGAAGTGGG + Intergenic
1069668717 10:70183477-70183499 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
1069674009 10:70234110-70234132 CAGGGGGGATGGAGGGGGCGGGG - Intergenic
1069785285 10:70983900-70983922 AAGCTGGGATGGACGGAAGTGGG + Intergenic
1069883152 10:71606739-71606761 CAGGGGTGAGGGTGGGAAGGTGG + Intronic
1069957228 10:72059678-72059700 CAGGCGGGCTGGAGTGAAGGGGG + Exonic
1070238483 10:74655067-74655089 CAGAGCGGATGAAGGGAAGGCGG - Intronic
1070485880 10:76930993-76931015 CAGGGGGAATGGGGAGATGTTGG + Intronic
1070577356 10:77689282-77689304 AAGGAGGGAGGGAGGGAGGTGGG - Intergenic
1071017484 10:81015070-81015092 CAGAGGGGAGGGAGGGAAGGAGG + Intergenic
1071275351 10:84049103-84049125 CAGTGGGGGTGGAGGGTAGAAGG + Intergenic
1071444772 10:85735806-85735828 AAGGAGGGATGGAGGGATGCAGG + Intronic
1071444827 10:85736008-85736030 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1071444829 10:85736016-85736038 AGGGAGGGAAGGAGGGAAGTAGG + Intronic
1071514972 10:86291281-86291303 CAGTGGGGATGGAGGTCAATGGG - Intronic
1072114529 10:92357508-92357530 CAGGGGGTGTGGGGAGAAGTGGG - Intergenic
1072341818 10:94459587-94459609 CAGGGGGGTTGGGGGGAGCTCGG + Intronic
1072764213 10:98082842-98082864 CAGGGGACATGGGGGGAAGCTGG + Intergenic
1072876346 10:99176666-99176688 CAGGGAGAATGGAGCCAAGTTGG + Intronic
1072905268 10:99447164-99447186 GCAGGGGGATGAAGGGAAGTTGG + Intergenic
1072975523 10:100054205-100054227 TGGGGGGGATGGAGGAAAGAAGG - Intronic
1073055517 10:100698295-100698317 ATCGGAGGATGGAGGGAAGTTGG - Intergenic
1073359856 10:102889664-102889686 CGGGGGGGGTGGAGGGAGGAAGG - Intronic
1073464886 10:103688842-103688864 AAGGAGGGAGGGAGGGAAGAAGG - Intronic
1073625343 10:105091074-105091096 CAGGAGGGAGGGAAGGAAGGAGG - Intronic
1073661317 10:105479606-105479628 CAGGGAGAATGGAAGCAAGTTGG - Intergenic
1073877194 10:107938547-107938569 CAGGGAGAAGGGAGGGAAGGGGG - Intergenic
1073900019 10:108209389-108209411 TAGGGGGATTGGGGGGAAGTTGG - Intergenic
1073993255 10:109287920-109287942 CAGGGAGGGTGGAGGAAAGTGGG - Intergenic
1074056494 10:109926854-109926876 AATGGGGAAAGGAGGGAAGTAGG - Intergenic
1074300904 10:112232577-112232599 CAGAGGGAATGGAGATAAGTAGG + Intergenic
1074326380 10:112455320-112455342 AAGGGGGGAAGGAGGGAAGGAGG - Intronic
1074326405 10:112455373-112455395 AAGGAGGGAAGGAGGGAAGAAGG - Intronic
1074326407 10:112455381-112455403 AAGGGGGGAAGGAGGGAAGGAGG - Intronic
1074326431 10:112455428-112455450 AAGGAGGGAAGGAGGGAAGAAGG - Intronic
1074326433 10:112455436-112455458 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1074326436 10:112455444-112455466 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1074326439 10:112455452-112455474 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1074401201 10:113142337-113142359 AAGGGGAGAGGGAGGGAAGGTGG + Intronic
1074440067 10:113470491-113470513 CAGGGAGGATGTGGGGAAGCAGG + Intergenic
1074449497 10:113547702-113547724 CATGGGGGAGGGAGGAAAGCAGG - Intergenic
1074544702 10:114393579-114393601 CTGGGGACAGGGAGGGAAGTTGG + Intronic
1074595282 10:114858730-114858752 GAGGAGGAATGGAGAGAAGTTGG + Intronic
1074695860 10:116049798-116049820 CGGGGGAGATGGAGGGATGGGGG + Intergenic
1074827994 10:117228483-117228505 AAGGAGGGAGGGAGGGAAGAAGG - Intergenic
1075122682 10:119675831-119675853 CAGGAAGGAAGGAGGGAAGGGGG - Intronic
1075180513 10:120206936-120206958 CAGTGGAGCTGGAGGGAAGGAGG - Intergenic
1075400480 10:122158014-122158036 TAGGAGGGAAGGAGGGAAGGAGG - Intronic
1075504295 10:123008800-123008822 CAGGGGGGCGGGAAGGGAGTCGG - Exonic
1075552501 10:123402426-123402448 GAGGGAGGAGGGAGGGAAGAGGG + Intergenic
1076091543 10:127690421-127690443 CATGGGGGAAGGTGGGAAGAAGG + Intergenic
1076109161 10:127848232-127848254 GAGGGGGGAGGGAGGGAGGGAGG + Intergenic
1076312494 10:129518475-129518497 CAGGGGGAAGGGAGGGGAGGAGG - Intronic
1076312507 10:129518500-129518522 CAGGGGGAAGGGAGGGGAGGAGG - Intronic
1076444504 10:130503250-130503272 AAGGGGAGAAGGAGGGAAGGGGG - Intergenic
1076903172 10:133349889-133349911 GAGGGGGGCTGGAGGCAGGTGGG + Intronic
1077020984 11:417107-417129 CTGGGGGAAGGGAGGAAAGTGGG - Intronic
1077044762 11:539860-539882 CTGTGGAGAAGGAGGGAAGTGGG + Intronic
1077216697 11:1398037-1398059 CAGCGGGGATGGCTGCAAGTCGG + Intronic
1077217470 11:1400938-1400960 CAGCAGGGATGGAAGGAAGGAGG - Intronic
1077287742 11:1775317-1775339 GAGGGGGGATGGAGAGGAGATGG + Intergenic
1077457966 11:2692291-2692313 CAATAGGGATGGAGGGAAGCAGG - Intronic
1077529339 11:3087870-3087892 CATGGGGGATGGATGGATTTAGG - Exonic
1077693426 11:4370454-4370476 CAGGAGGAAGGGAGGGAGGTGGG - Intergenic
1077779272 11:5307666-5307688 AAGGAGGGAAGGAGGGAAGGGGG - Intronic
1077787637 11:5401971-5401993 CAAGCGGGAGGGAGGGAAGGAGG - Intronic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1077990496 11:7406298-7406320 CAGGTGGGATATAGGGAAGTTGG - Intronic
1078064728 11:8070949-8070971 CAGGGGGGCTGGAGGGAAAGGGG + Intronic
1078416772 11:11172458-11172480 CAGTGGAGAAGGAGAGAAGTGGG + Intergenic
1078556318 11:12329467-12329489 GAGGTGGCATGGTGGGAAGTGGG + Intronic
1078689261 11:13562612-13562634 CAGTGGGGAAGTAGGGAAGTGGG - Intergenic
1078692642 11:13597435-13597457 CAGCGAGGAAGTAGGGAAGTGGG + Intergenic
1078715335 11:13834197-13834219 CAGAGGGGAAGAAGGGAATTGGG - Intergenic
1078813954 11:14800754-14800776 CAGGGGGAATGGAGCCAAGTTGG - Intronic
1079141586 11:17814059-17814081 AAGGAGGGAGGAAGGGAAGTTGG + Intronic
1079761600 11:24336021-24336043 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1079817191 11:25076549-25076571 GAGGAGGGAAGGAGGGAAGGAGG + Intronic
1079822527 11:25148423-25148445 TAGAGGGGAGGGAGGGAAGGAGG + Intergenic
1080117324 11:28635507-28635529 CAGGAGGGAGGGAGGGAGGAAGG + Intergenic
1080360499 11:31507667-31507689 CAGGGGGGATGGGGAGAATTTGG + Intronic
1080383354 11:31796467-31796489 CTGGGGGGATGGAGGGTGGATGG + Intronic
1080466710 11:32504136-32504158 CATGGGGGAGGGAGGGAGGGAGG + Intergenic
1080545098 11:33309269-33309291 AAGGAGGGAAGGAGGGAAGAAGG - Intronic
1080581994 11:33651778-33651800 CGGGAGGGAATGAGGGAAGTGGG - Intronic
1080828390 11:35867456-35867478 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
1081012690 11:37834994-37835016 GAGTGAGGAAGGAGGGAAGTGGG - Intergenic
1081477508 11:43449002-43449024 CAATGGGGATGGAGAAAAGTAGG - Intronic
1081752795 11:45524097-45524119 CCGGGGTGATGGGGGGAGGTTGG - Intergenic
1081997863 11:47376651-47376673 CAGGGAGGAGGGAGGAAGGTGGG - Intronic
1082112659 11:48293964-48293986 CAGGGAGAATGGAAGCAAGTTGG + Intergenic
1082311149 11:50649948-50649970 GAGGGGGGAGGGAGGGCATTAGG + Intergenic
1082800456 11:57410336-57410358 CAGTGGGGTTGGAGAGAAGTGGG - Intronic
1082824402 11:57567509-57567531 CGGAGGGGATGGAGGGAGGAGGG + Intronic
1082938397 11:58678074-58678096 AATGGGGGAGGGAGGGGAGTAGG - Intronic
1083034958 11:59628514-59628536 CAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1083078230 11:60063861-60063883 CAGGGGGAAAGGTGGGAAGGAGG + Intronic
1083201990 11:61126226-61126248 CAGAGGTGATGCAGGGAGGTCGG - Intronic
1083301664 11:61742787-61742809 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
1083577288 11:63801234-63801256 AAGGAGGGAGGGAGGGAGGTTGG + Intergenic
1083651596 11:64207704-64207726 CAGAAGGGAGGGAGGGAAGAGGG - Intronic
1083691558 11:64412029-64412051 CAGGTGGGATGTATGGGAGTGGG + Intergenic
1083737114 11:64687651-64687673 GAGGAGGGAAGGAGGGAGGTGGG + Intronic
1083847480 11:65344442-65344464 CAGGGTGGAGGGACAGAAGTGGG - Intronic
1083853006 11:65378807-65378829 AGGGGTGGATGGAGGGAAGAGGG - Intronic
1083932366 11:65853003-65853025 CCTGGGGGAGGGAGGGAGGTGGG - Intronic
1084032704 11:66490467-66490489 GAGGGGAGCTGGAGTGAAGTTGG - Intronic
1084421847 11:69064272-69064294 TAGGGAGGGGGGAGGGAAGTGGG - Intronic
1084472795 11:69373020-69373042 CAGGGGAGAGGGTGGGCAGTGGG + Intergenic
1084704180 11:70806371-70806393 AAGTAGGGTTGGAGGGAAGTTGG - Intronic
1084928662 11:72535898-72535920 AAGGAGGGATGGAGGGAGGGAGG + Intergenic
1084949727 11:72657967-72657989 GAGGAGGGGTGGAGGGAAGAGGG + Intronic
1085004619 11:73074929-73074951 CAGTGGGGAGGGAGGGAGGCAGG + Intronic
1085134683 11:74075367-74075389 GGGGGGGGGTGGGGGGAAGTAGG + Intronic
1085142565 11:74160598-74160620 GAGGGAGGATGGAGAGAGGTTGG + Intronic
1085143619 11:74171861-74171883 CAGGGAAGGTGGAGGGAAGTGGG + Intronic
1085314672 11:75537287-75537309 CAGTGGGGCTAGAGGGCAGTGGG + Intergenic
1085329698 11:75637814-75637836 AGGGAGGGAGGGAGGGAAGTAGG + Intronic
1085391692 11:76185459-76185481 CAGGGAGGCAGGAGGGAGGTCGG - Intergenic
1085407617 11:76272719-76272741 CAGGTGTGATGGAGAGAGGTGGG - Intergenic
1085414876 11:76313234-76313256 ATGGGGGGTTGGAGGGATGTGGG + Intergenic
1085446354 11:76603639-76603661 AAGGAGGGATGGAGGGAGGGAGG + Intergenic
1085472393 11:76766700-76766722 CAGGGAGGATGGAGAGGAGACGG - Intergenic
1085658982 11:78345031-78345053 CAGGAGGGAGGGAGGGAGGCGGG + Intronic
1086209187 11:84297721-84297743 CTGGGGGCATGGAAGGAAGTCGG - Intronic
1086393269 11:86388169-86388191 AAGGAGGGAGGGAGGGAGGTTGG - Intronic
1086393278 11:86388193-86388215 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1086567385 11:88242006-88242028 CAGGGAGAATGGAAGCAAGTTGG + Intergenic
1086646751 11:89231642-89231664 GGGGTGGGTTGGAGGGAAGTTGG + Intronic
1087175018 11:95088739-95088761 CGTGGGGGATGATGGGAAGTGGG - Intergenic
1087237172 11:95733044-95733066 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1087353702 11:97066517-97066539 GAGGGAGGATGGAGCGAAGTGGG + Intergenic
1087400480 11:97659337-97659359 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1087513650 11:99129506-99129528 CAGGGAGAATGGAAGCAAGTTGG + Intronic
1087701415 11:101440513-101440535 GAGGGGCGTTGGAGGGAAGGAGG - Intergenic
1087906094 11:103699691-103699713 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1087955564 11:104282785-104282807 CAGGGGTAATGGAGGGAATAAGG - Intergenic
1088116035 11:106315916-106315938 CAGAGAGGAAGGAGGGGAGTTGG - Intergenic
1088550730 11:111009958-111009980 CAGGGTGGATTGAGGGATGGGGG + Intergenic
1088868045 11:113867800-113867822 AAGGGGGGAGGGAGGGAGGGAGG + Intronic
1089007122 11:115101524-115101546 TAGGGAGGATGCAGGGCAGTTGG - Intergenic
1089011086 11:115132391-115132413 CTTGGGGGATGGAGGGAGTTGGG + Intergenic
1089303506 11:117512816-117512838 CCAGGGAGAGGGAGGGAAGTGGG - Intronic
1089387765 11:118079316-118079338 CTGTGGGGATGGAAGGAGGTAGG - Intronic
1089662685 11:119995914-119995936 CATGGGGGATGGAGTGGAGGGGG - Intergenic
1090029548 11:123195335-123195357 CGGGAGGGAGGGAGGGAAGGAGG - Intergenic
1090089430 11:123681772-123681794 CAGGAAGGAGGGAGGGAAGAAGG + Intergenic
1090134522 11:124183539-124183561 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1090306204 11:125693367-125693389 AAGGAGGGATGGAGTGAGGTGGG - Intergenic
1090386363 11:126359732-126359754 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1090386366 11:126359740-126359762 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1090396661 11:126423865-126423887 CTGGGGGGAGGGAGGGAGGAGGG - Exonic
1090580390 11:128152852-128152874 AAGGGAGGAAGGAGGGAAGGAGG + Intergenic
1090580407 11:128152896-128152918 GAGGGAGGAAGGAGGGAAGGAGG + Intergenic
1090634636 11:128683352-128683374 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1091007396 11:131965920-131965942 AAGGAGGGAGGGAGGGAAGGGGG + Intronic
1091252913 11:134158802-134158824 GAAGGGGGATGAAGAGAAGTTGG - Intronic
1091259268 11:134221519-134221541 AAGGGGGGATGGAGGGATAGGGG - Intronic
1091303527 11:134523105-134523127 GAGTGGGGATGGAAGGAAGGTGG + Intergenic
1091335129 11:134760957-134760979 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1091349702 11:134883093-134883115 CAGGGGATGTGAAGGGAAGTCGG + Intergenic
1091568406 12:1663737-1663759 AAGGAAGGATGGAGGGAAGGAGG + Intergenic
1091666747 12:2424353-2424375 CAAGGGGGAGGGAGGGAAAACGG + Intronic
1091744360 12:2981774-2981796 CAGGGGTGCTGGAGGGTAGTGGG + Intronic
1091755879 12:3051198-3051220 GAGGGAGGAAGGAGGGAAGGAGG - Intergenic
1091788810 12:3259408-3259430 AAGGAGGGATGGAGGGAGGGAGG - Intronic
1091809323 12:3381854-3381876 TAGGGAGGTGGGAGGGAAGTGGG - Intronic
1092095842 12:5841311-5841333 CAGGTGGGGTGGAGGGGAATGGG - Intronic
1092566604 12:9672659-9672681 CAGGGAGGATGGAACCAAGTTGG - Intronic
1092753202 12:11738233-11738255 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1092885772 12:12923350-12923372 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1093141620 12:15516538-15516560 AAGGAGGGAGGGAGGGAAGAAGG + Intronic
1093163236 12:15774316-15774338 CAGGGGGGGTGGGGTGAAGGAGG - Intronic
1093344617 12:18025307-18025329 CAGGGAGAATGGAGCAAAGTTGG + Intergenic
1094615076 12:32029232-32029254 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1094668613 12:32546646-32546668 CATAGAGCATGGAGGGAAGTAGG + Intronic
1095654007 12:44648281-44648303 GAGGGAGGAAGAAGGGAAGTAGG - Intronic
1095752762 12:45729585-45729607 CAGGGGGAGAGGAGGGAAGGAGG - Intergenic
1095791234 12:46169575-46169597 CTGAGGGGAGGGAGGGAAATGGG + Intergenic
1096003331 12:48147746-48147768 AAGGGGGGTTGGAGAAAAGTAGG + Intergenic
1096250393 12:50028258-50028280 CAGGGGTGAGGGAGAGAAGCAGG + Intronic
1096263774 12:50108437-50108459 TAGGGGTGATGGACAGAAGTGGG - Intronic
1096398002 12:51281308-51281330 CGGGAGGGATGGAGGGAGGCAGG - Exonic
1096429716 12:51532735-51532757 CTGGGGGGTTGGAGGGAGGCAGG + Intergenic
1096445229 12:51683993-51684015 CAGGGCAGAGGGAGGGAGGTGGG + Intronic
1096548320 12:52356357-52356379 CAGGGGTGAAGGAGGGCAGCCGG + Intergenic
1096625488 12:52892880-52892902 AAGGCAGGGTGGAGGGAAGTGGG + Intergenic
1096638619 12:52976789-52976811 GAGGGGGGATGGAAAGAACTGGG + Intergenic
1096781504 12:53994812-53994834 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1096861564 12:54532430-54532452 GTAGGGGGATGGAGAGAAGTGGG + Intronic
1096943190 12:55372469-55372491 AAGGAGGGAAGGAGGGAAGCAGG + Intergenic
1096944176 12:55385965-55385987 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1097024131 12:56041705-56041727 CAGGGGGGAAGGGGGGGAGGGGG + Intergenic
1097097773 12:56563356-56563378 CAGTGGGGATGGAAGAAAGTGGG + Intronic
1097156637 12:57016613-57016635 CAGGGTGGCTGGAGGGGAGGCGG + Intronic
1097269597 12:57765908-57765930 CTGGGGGCATGGTGGGAGGTCGG - Intronic
1097288390 12:57894849-57894871 CAGGTGGGACAGAGTGAAGTGGG + Intergenic
1097608433 12:61785098-61785120 CAGGAGGGAAGGAGGGAATAGGG - Intronic
1097721044 12:63021757-63021779 GAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1097733183 12:63151896-63151918 CAGCGGGGATGGCGGAAATTTGG + Intergenic
1097967344 12:65595348-65595370 GTGGGGGGATGGGGAGAAGTAGG - Intergenic
1098386264 12:69922041-69922063 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1098567922 12:71956472-71956494 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1098567935 12:71956508-71956530 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1098567944 12:71956536-71956558 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1099115389 12:78617768-78617790 AAGGGGGGAGGGAGCGAAGGGGG + Intergenic
1100209018 12:92381914-92381936 GAGGGGGGATGGAGGGAGGGAGG + Intergenic
1100209030 12:92381941-92381963 GAGGGGGGATGGAGGGAGGAAGG + Intergenic
1100370803 12:93967042-93967064 CGGGAGGGATGGAGGGAGGGAGG - Intergenic
1100370820 12:93967098-93967120 AGGGAGGGATGGAGGGAAGGGGG - Intergenic
1100421837 12:94442360-94442382 CTGGGGGGAAGGAGGGAGGGGGG + Intronic
1101148185 12:101861521-101861543 AGGGGGGGAGGGAGGGAAGGAGG - Intergenic
1101206440 12:102492992-102493014 CAGGGAGAATGGAAGCAAGTTGG - Intergenic
1101212741 12:102551012-102551034 AAGGAAGGAGGGAGGGAAGTGGG - Intergenic
1101348191 12:103905355-103905377 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1101348198 12:103905371-103905393 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1101348205 12:103905387-103905409 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1101348232 12:103905469-103905491 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1101348239 12:103905485-103905507 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1101348246 12:103905501-103905523 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1101348253 12:103905517-103905539 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1101544070 12:105694170-105694192 CAGGGGGAAGGGTGAGAAGTGGG - Intergenic
1101649143 12:106659040-106659062 CAGGGGTCAGGGAAGGAAGTGGG - Intronic
1101783497 12:107860907-107860929 CAGGGAGAATGGAGCCAAGTTGG + Intergenic
1101952413 12:109187058-109187080 AAAGGGGGATGGAGGGAGGGAGG + Intronic
1102390174 12:112543307-112543329 GAGGGGGGAGGGAGGGAGGGAGG - Intergenic
1102459084 12:113089203-113089225 CAGGGTGGCTGGAGTGGAGTGGG + Intronic
1102503145 12:113366771-113366793 GAGGAGGGAAGGAGGGGAGTGGG - Intronic
1102516085 12:113447819-113447841 CAGGGTGGCTGCAGGGAAGAGGG + Intergenic
1102544157 12:113642646-113642668 AAGGAGGGATGGAGGGGAGAAGG - Intergenic
1102691631 12:114765923-114765945 AAGGGCGGCAGGAGGGAAGTGGG - Intergenic
1102728262 12:115084913-115084935 CTGGGGGGAGGGAGGGAAAAGGG + Intergenic
1102736504 12:115165608-115165630 CAGGGGAGATAGAGAGAGGTTGG - Intergenic
1102992137 12:117322814-117322836 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1102995074 12:117342853-117342875 AAGGGAGGAAGGAAGGAAGTGGG + Intronic
1103132639 12:118482460-118482482 CAGGTGAGGTGAAGGGAAGTGGG + Intergenic
1103254263 12:119527263-119527285 GAGGGGGGATGGTGGGAGGAGGG + Intronic
1103562809 12:121800887-121800909 CCGGGGGGACGGAGGAAAGGAGG + Intronic
1103602661 12:122064022-122064044 GAGGAGCGATAGAGGGAAGTTGG - Intergenic
1103939845 12:124495693-124495715 CGGGGGCCATGGAGTGAAGTTGG - Intronic
1104013657 12:124948897-124948919 CAGGGTGGATGGGAGGAGGTGGG - Intronic
1104191105 12:126482510-126482532 GAGGGGGGAAGGAGGGAGGGAGG - Intergenic
1104420671 12:128631987-128632009 GAGTGGGGATGGGGGGAAGGGGG + Intronic
1104437488 12:128767385-128767407 CAGGGGGGAGGGAGGGAGGAAGG + Intergenic
1104481848 12:129114401-129114423 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1104481851 12:129114409-129114431 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1104481854 12:129114417-129114439 GAGGGAGGAAGGAGGGAAGGAGG - Intronic
1104546069 12:129714057-129714079 CAGTGTGGTTGGAGGGAGGTAGG - Intronic
1105070403 12:133231134-133231156 CAGTGGAGATGGAGGGCAGGTGG - Intronic
1105209122 13:18247515-18247537 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1105370128 13:19794919-19794941 CAGTGGGGAGGTAGGCAAGTGGG + Intergenic
1106117035 13:26826602-26826624 CAGGGAGGATGAAGAGAAGCAGG - Intergenic
1106349065 13:28910158-28910180 CGGGTGGGATGGAGGGAAATGGG - Intronic
1106388499 13:29312044-29312066 CAGTGGGGTTGGAGGGATGTGGG - Intronic
1106547522 13:30743511-30743533 GAGGGGGAATGGAGGGCACTGGG - Intronic
1106660114 13:31790747-31790769 GAGGTGGGGTGGATGGAAGTTGG + Intronic
1107007510 13:35630936-35630958 AGGGGGGAATGGTGGGAAGTGGG - Intronic
1107462401 13:40616739-40616761 CAAGGGGTGTGGAGGGAAGAAGG + Intronic
1107917663 13:45168967-45168989 GAGGGAGGAAGGAGGGAAGGAGG - Intronic
1108243649 13:48493373-48493395 GAGGAGGGAGGGAGGGAGGTAGG - Intronic
1108822334 13:54368646-54368668 AAGGAGGGAAGGAGGGAAGAAGG + Intergenic
1108822342 13:54368670-54368692 AAGGAGGGAAGGAGGGAAGAAGG + Intergenic
1108955986 13:56157425-56157447 CAGGGAGGATGGAGGGAGGGGGG + Intergenic
1109103760 13:58222171-58222193 CATGGGGGATGGGGTGACGTGGG - Intergenic
1109308448 13:60664481-60664503 CATGGGGGATGGAGAGAGGGAGG + Intergenic
1110229474 13:73153368-73153390 AAGGAGGGAGGGAGGGAAGTAGG - Intergenic
1110252968 13:73401517-73401539 CAAAGGGGATGGAGTGAAATGGG - Intergenic
1110270580 13:73585099-73585121 CAGTGGGGATGGTGAGAAGTGGG + Intergenic
1110552906 13:76828024-76828046 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1110641526 13:77830203-77830225 AGGGGGGGAGGGAGGGAAGAAGG - Intergenic
1111084157 13:83351884-83351906 GAGGGAGGAAGGAGGGAAGGAGG + Intergenic
1111166584 13:84465129-84465151 CATGGAGGATGGAGTGAAGCAGG + Intergenic
1111363632 13:87210839-87210861 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1111792024 13:92869549-92869571 GAGGGAGGAGGGAGGGAAGGAGG + Intronic
1111908942 13:94288417-94288439 CTGGGGACATGGAGGGAGGTGGG - Intronic
1112109996 13:96285922-96285944 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
1112304304 13:98259806-98259828 CAGGTCGGATGAAGGGAAGGTGG + Intronic
1112386076 13:98940834-98940856 GAGGGATGATGGAGGGAAGGTGG - Intronic
1112472935 13:99705745-99705767 CTGGGGGGAAGGAGGGAATGGGG + Intronic
1112566800 13:100558836-100558858 GAGAGGGGATGGAGAGAGGTTGG + Intronic
1113674115 13:112196354-112196376 CAGGGAGGAGGGAGGGAGGGAGG - Intergenic
1114260215 14:21031193-21031215 CAATGGGGATTTAGGGAAGTAGG - Intronic
1114563960 14:23614546-23614568 GACAGGGGATGGTGGGAAGTGGG + Intergenic
1114866020 14:26597200-26597222 CGGGAGGGAGGGAGGGAAGGAGG + Intronic
1115054669 14:29108822-29108844 AAAGAGGGAGGGAGGGAAGTAGG + Intergenic
1115351911 14:32404920-32404942 CAGGAGGGAGGGAGGGAGGGTGG + Intronic
1115356566 14:32454664-32454686 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1115356590 14:32454728-32454750 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
1115356609 14:32454772-32454794 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
1115658638 14:35468093-35468115 CAGTGGGGGTGGGGGGGAGTGGG + Intergenic
1115886425 14:37976679-37976701 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1116292274 14:43059371-43059393 CAGAGGGGTTGGAGGGCAGCAGG + Intergenic
1116330575 14:43592489-43592511 GTGGGGGGAGGGTGGGAAGTGGG - Intergenic
1116548476 14:46202712-46202734 CAAGAGGGATGAAGAGAAGTTGG + Intergenic
1116659585 14:47692081-47692103 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1117473206 14:56067552-56067574 AAGTGGGGATGGAGAGAACTGGG + Intergenic
1117612229 14:57496247-57496269 CAGAGGAGATGGAGAGAAGCAGG + Intergenic
1117812456 14:59562597-59562619 CAGGCTGGATTGTGGGAAGTGGG + Intronic
1117830109 14:59741713-59741735 CAGGGGAGGAAGAGGGAAGTGGG - Intronic
1117971342 14:61253959-61253981 GAGGAGGGAGGGAGGGAAGAAGG - Intronic
1118057741 14:62099318-62099340 CACTGGGGATGGAAAGAAGTGGG + Intronic
1118372328 14:65147818-65147840 GAGGGAGGATGAAGAGAAGTGGG + Intergenic
1118687535 14:68306046-68306068 CAGAGGGGAGGGACGGATGTGGG - Intronic
1118888970 14:69891544-69891566 CAGGGGGTAGGGAGGGAAGAGGG - Intronic
1118906165 14:70024972-70024994 TAAGGGGAATGGAGAGAAGTGGG + Intronic
1119002631 14:70896679-70896701 AAGGGGGGAAGGAAGGAAGAGGG + Intergenic
1119184777 14:72632632-72632654 CAGGAGGAAGGGAGGGAAGGAGG + Intronic
1119261608 14:73241085-73241107 CAGGCAGGATGGATGGCAGTGGG + Intronic
1119298602 14:73552919-73552941 CATGGGGGATGGAAGGGAGCTGG - Intronic
1119302896 14:73585095-73585117 CATGGGGGATGGAAGGGAGCTGG - Intergenic
1119425300 14:74531155-74531177 CAGGCGGCAGGGAGGGAAGGAGG + Intronic
1119994649 14:79240009-79240031 TAGGGGGAATGGAGAGATGTTGG + Intronic
1120360185 14:83490609-83490631 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1120544360 14:85792400-85792422 GAAGGGGGAGGGAGGGAAGTGGG + Intergenic
1120944814 14:89984241-89984263 GAGGGAGCATGGAGGGATGTGGG + Intronic
1121133504 14:91472502-91472524 CAGGCTGGATGGAGTGCAGTGGG + Intronic
1121525153 14:94614356-94614378 CAGGCTGGGTGGAGGGCAGTGGG + Exonic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121612845 14:95293253-95293275 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
1121612864 14:95293305-95293327 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
1121765873 14:96484935-96484957 AAGGAGGGATGGAGGGAGGGAGG + Intronic
1121769112 14:96516389-96516411 CAGGAGGGAGGGAGGGAGGGAGG - Intronic
1121917043 14:97844717-97844739 AAGGAAGGAAGGAGGGAAGTAGG + Intergenic
1122112260 14:99510674-99510696 CAGGGGGGACGGCAGGAGGTGGG - Exonic
1122149104 14:99715008-99715030 GTGGGGGGATGAAGAGAAGTTGG + Intronic
1122270283 14:100565933-100565955 CAGGGGAGTGGAAGGGAAGTTGG - Intronic
1122403765 14:101484238-101484260 CAGGAGGGAGGGAGAGAAGTTGG + Intergenic
1122412952 14:101535235-101535257 CAGTGGGGATGGAGGGGACCCGG - Intergenic
1122612450 14:102994821-102994843 CAAGGGGAACGGATGGAAGTGGG - Intronic
1122874102 14:104655274-104655296 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1122874105 14:104655282-104655304 AAGGAGGGAAGGAGGGAAGGTGG + Intergenic
1122981534 14:105194359-105194381 CTTGGGGGATGGAAGGAAGAGGG - Intergenic
1123121454 14:105918826-105918848 CAGCTGGGAGGAAGGGAAGTGGG + Intronic
1123174156 14:106401433-106401455 CGCGGGGGATGGCGGGACGTCGG - Intergenic
1123182364 14:106482366-106482388 CGCGGGGGATGGCGGGACGTCGG - Intergenic
1202944539 14_KI270726v1_random:14364-14386 CGCGGGGGATGGCGGGACGTCGG + Intergenic
1123404167 15:20010491-20010513 CAGCTGGGAGGAAGGGAAGTGGG + Intergenic
1123513506 15:21017137-21017159 CAGCTGGGAGGAAGGGAAGTGGG + Intergenic
1123541126 15:21292741-21292763 AAGGGGGAAAGGAGGGAAGAAGG + Intergenic
1123811427 15:23930177-23930199 CATGGGGAATGGAGGTCAGTGGG + Intergenic
1124172398 15:27387901-27387923 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1124439161 15:29674703-29674725 CCGGGGGGGCGGAGGGAAGGAGG + Intergenic
1124598422 15:31110906-31110928 CAGAAGGGAGGGAGGGAAGGGGG - Intronic
1124803680 15:32860097-32860119 CAGGAGGGAGGGAGGAAAGAAGG + Intronic
1124850727 15:33336503-33336525 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1124850730 15:33336511-33336533 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1124850733 15:33336519-33336541 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1124850736 15:33336527-33336549 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1125277472 15:38008380-38008402 CAGGGATGATAGAGGGAAGGGGG + Intergenic
1125445214 15:39747004-39747026 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1125445217 15:39747012-39747034 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1125445220 15:39747020-39747042 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1126326469 15:47483124-47483146 TTGGGGGCATGGAGGGAATTTGG + Intronic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1126929889 15:53635687-53635709 TGGGGGGGATGGAGGGAGATGGG + Intronic
1127634753 15:60858573-60858595 CAGCGGGGATGGGGTGAAGCAGG + Intronic
1127660745 15:61098096-61098118 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
1127907584 15:63387674-63387696 GAGGGAGGAAGGAGGGAAGAAGG + Intergenic
1128037887 15:64542750-64542772 AAGTGGGGATGGAGAGAAGGAGG - Intronic
1128153041 15:65375414-65375436 AAGGGGAGATGGAAGGAAATAGG + Intronic
1128285641 15:66434851-66434873 CCGGGTGGCTGGAGTGAAGTGGG + Intronic
1128473810 15:67979730-67979752 CAGAGGTGATGGAAGAAAGTTGG - Intergenic
1128536114 15:68491851-68491873 CAGGGGGGCTGGAAGGAAGAGGG + Intergenic
1128538878 15:68511243-68511265 CAGGGAAGATGGAGGCAAGCAGG + Intergenic
1128603825 15:69019284-69019306 AAGGGGGCAGGGAGGGATGTAGG + Intronic
1128701949 15:69811135-69811157 GAAGGGGCCTGGAGGGAAGTGGG - Intergenic
1128793522 15:70449539-70449561 ATGGGTGGATGGAGGGAAGGAGG + Intergenic
1128990773 15:72258210-72258232 CTGGGAGGATGGAGGGTAGTTGG - Intronic
1129180967 15:73875290-73875312 AAGGAGGGAAGGAGGGAAGAAGG + Intronic
1129246403 15:74281647-74281669 CAGGAGGGTGGGAGGGAGGTGGG - Intronic
1129258071 15:74345475-74345497 CAGAGGGAGTGGAGGGGAGTTGG - Intronic
1129300202 15:74621053-74621075 CAGGAGGGAGGCAGGGAAGAGGG - Intronic
1129383753 15:75184381-75184403 AAGAGGGGATGAAGGGAACTGGG + Intergenic
1129574321 15:76724524-76724546 CAGGGAGAATGGAAGCAAGTTGG - Intronic
1129604452 15:77018030-77018052 CAGGGGAGATGGAGGCAGGAGGG + Intronic
1129849521 15:78784404-78784426 GAGGGGGGAGGGAGGGAGGGAGG + Intronic
1130000481 15:80042228-80042250 AAAGAGGGAGGGAGGGAAGTAGG - Intergenic
1130377652 15:83343942-83343964 AAGAGGGGAGGTAGGGAAGTGGG + Intergenic
1130539494 15:84811941-84811963 CTGTGGGGAAGGAGGGAAGGAGG + Intergenic
1130839216 15:87682050-87682072 AGGGAGGGATGGAGGGAAGAAGG + Intergenic
1130847158 15:87758177-87758199 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1130849630 15:87780442-87780464 GAGGGGCCATGCAGGGAAGTTGG - Intergenic
1130924669 15:88375941-88375963 AAGGAGGGATGGAGAGAAGGAGG - Intergenic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1130951743 15:88596245-88596267 AAGGGAGGAGGGAGGGAAGGAGG - Intergenic
1131032722 15:89199943-89199965 CAGAGGGGAAGGAAGGAAGCAGG - Exonic
1131074054 15:89483831-89483853 CAGGGAGGATGGAGGCAAAGGGG + Intronic
1131360686 15:91788194-91788216 TTCGGGGGGTGGAGGGAAGTGGG - Intergenic
1131361181 15:91792068-91792090 CAAAGGGGATGGAGGGAGGAGGG - Intergenic
1131449318 15:92525987-92526009 AAGGAGGGATGGAGGGAAAAAGG - Intergenic
1131737070 15:95344936-95344958 AAGGAGGGATGGAGGGAGGGAGG + Intergenic
1131857194 15:96609926-96609948 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1132344040 15:101096852-101096874 GAGGGAGGATGGGGAGAAGTTGG + Intergenic
1202949439 15_KI270727v1_random:19882-19904 AAGGGGGAAAGGAGGGAAGAAGG + Intergenic
1132618247 16:852751-852773 CAGGGGGCATGGAGGGCTGTTGG + Intergenic
1132715848 16:1289448-1289470 GAGGGGGGAGGGAGGGAGGGAGG + Intergenic
1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG + Intergenic
1133219940 16:4315720-4315742 GAGGGGTGAGGGAGGGAAGTGGG - Intronic
1133402662 16:5500117-5500139 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1133402665 16:5500125-5500147 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1133489912 16:6257565-6257587 CAGGGTGGAGGATGGGAAGTGGG - Intronic
1133559895 16:6941283-6941305 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
1133601153 16:7341759-7341781 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
1133647148 16:7775132-7775154 AAGGAGGGAGGGAAGGAAGTAGG + Intergenic
1133789713 16:9000098-9000120 CTGGGGGGGTGGTGGGGAGTTGG + Intergenic
1133866532 16:9649135-9649157 CAGGAGGGATGAAGAGAAATTGG + Intergenic
1133966784 16:10537514-10537536 CAGTGGGGCTGGAGTGCAGTGGG - Intronic
1134017051 16:10895931-10895953 GAGGGGAGATGGAGGCCAGTGGG + Intronic
1134291744 16:12907154-12907176 GAAGGGGGATGGAGGGAAGGAGG - Intronic
1134351827 16:13444796-13444818 AAGGGAAGATGGAGGGAAGAGGG - Intergenic
1134991255 16:18701566-18701588 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
1135191501 16:20358238-20358260 CAGTGGAGATGAAGGGAAGTGGG + Intergenic
1135640238 16:24113517-24113539 AAGGGGGGAGGGAGGGAGGAAGG - Intronic
1135927702 16:26709857-26709879 GAGGGGGGAGGGAGGGAGGGAGG + Intergenic
1136070672 16:27785141-27785163 CCCCGGGAATGGAGGGAAGTGGG - Intergenic
1136107219 16:28038499-28038521 GAGCTGGGGTGGAGGGAAGTGGG + Intronic
1136235297 16:28910198-28910220 CAGGAGGGTAGGAGGGCAGTAGG - Intronic
1136268021 16:29132155-29132177 GAGGGAGGATGGAGGGAGGGAGG + Intergenic
1136333473 16:29596343-29596365 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1136467619 16:30455874-30455896 GAGGGAGAATGGAGGGATGTGGG + Intergenic
1136543755 16:30943852-30943874 GAGGGGGCATGGTGGGAAGAAGG - Intronic
1136647451 16:31634466-31634488 CAGGGAGAATGGAAGCAAGTTGG - Intergenic
1136913890 16:34163542-34163564 CCGGGGGGAGGAAGGCAAGTAGG + Intergenic
1137533748 16:49301360-49301382 GAGGGGGGACCAAGGGAAGTGGG - Intergenic
1137679967 16:50332981-50333003 AAGGGGGCAGGGAGGGAAGGGGG + Intronic
1137693135 16:50442865-50442887 GTGGGGGGGTGGGGGGAAGTGGG + Intergenic
1137758773 16:50923844-50923866 AAGGAGGGATGGAGGGAGGAAGG + Intergenic
1137801025 16:51262163-51262185 AAGGAGGGAAGGAGGGAAGGGGG - Intergenic
1137801030 16:51262171-51262193 CGGGGGAGAAGGAGGGAAGGAGG - Intergenic
1138034810 16:53593616-53593638 CATGGGTGATGGAGGGATTTGGG + Intergenic
1138088103 16:54152425-54152447 CAGGTGGCTTGGAGGAAAGTGGG - Intergenic
1138264154 16:55647420-55647442 AAGGAGGGAAGGAGGGAAGACGG + Intergenic
1138309297 16:56009499-56009521 CAGGGAGAATGGTGGGCAGTAGG + Intergenic
1138498449 16:57423216-57423238 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1138546293 16:57721879-57721901 AAGGGGGGAGGGAGGGAGGGAGG - Intronic
1138588360 16:57985805-57985827 CAGGAGGGATGGCGGGGAGAGGG + Intronic
1138647658 16:58436880-58436902 AAGGAGGGATGGATGGAAGAGGG - Intergenic
1138697769 16:58831786-58831808 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1138697772 16:58831794-58831816 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1138697775 16:58831802-58831824 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1138697778 16:58831810-58831832 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1138697781 16:58831818-58831840 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1138697784 16:58831826-58831848 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1138697787 16:58831834-58831856 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1138697790 16:58831842-58831864 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1138697793 16:58831850-58831872 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1138927732 16:61612228-61612250 AAGGGGGGAAGGGGGGAAGGGGG + Intergenic
1138946154 16:61852775-61852797 CAGGGAGGATAAAGGGAAGGAGG - Intronic
1139028403 16:62848381-62848403 TTTGGGGGATGGAGGGAAGAGGG - Intergenic
1139094989 16:63694617-63694639 GAGGAGGGAGGGAGGGCAGTAGG + Intergenic
1139258205 16:65563736-65563758 GAGGGAGGATGAAGAGAAGTGGG - Intergenic
1139471957 16:67183223-67183245 AAGGGGAGATGGAGGGGACTGGG - Intronic
1139662436 16:68430205-68430227 GAGGGGGCATAGAGGGAAGAGGG - Intronic
1139689563 16:68631578-68631600 CAGGGGGGCTGGAGGGTTGGTGG + Intergenic
1139960517 16:70714931-70714953 CCAGTGGGACGGAGGGAAGTGGG - Intronic
1139978062 16:70830634-70830656 CACTGGGGATGGTGGAAAGTGGG + Intronic
1140110069 16:71996583-71996605 CATGGGGGCAGGAAGGAAGTAGG - Intronic
1140257524 16:73349796-73349818 AAGGAGGGAGGGAGGGAAGAGGG - Intergenic
1140286704 16:73609658-73609680 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
1140814010 16:78604669-78604691 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814018 16:78604684-78604706 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814026 16:78604699-78604721 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814034 16:78604714-78604736 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814042 16:78604729-78604751 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814050 16:78604744-78604766 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814058 16:78604759-78604781 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814066 16:78604774-78604796 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814090 16:78604824-78604846 GAGGGGGGAAGGAGGGAGGGAGG - Intronic
1140914673 16:79483104-79483126 GGGAGGGGAGGGAGGGAAGTAGG - Intergenic
1141090848 16:81129364-81129386 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1141303187 16:82837147-82837169 GAGGGTGAATGGTGGGAAGTGGG + Intronic
1141421582 16:83921221-83921243 GAGGGTGGATGGAAGGAAGATGG + Exonic
1141421621 16:83921397-83921419 GAGGGTGGATGGAAGGAAGGAGG + Exonic
1141427099 16:83951765-83951787 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
1141732844 16:85834157-85834179 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1141732863 16:85834200-85834222 GAGGGAGGAGGGAGGGAAGGAGG + Intergenic
1141756782 16:85996746-85996768 AAGGAGGGATGGAGGGAAAGAGG + Intergenic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1142591710 17:1009170-1009192 CAGTGGGGATGGACAGCAGTGGG - Intronic
1142612436 17:1116666-1116688 CAGTTGGGAAGGAGGTAAGTCGG - Intronic
1142683255 17:1562384-1562406 CAGCGGGGATGGAGGGGATCCGG - Intronic
1142769309 17:2085258-2085280 CAGGAGGGAGGGAGGGAACAAGG + Intronic
1142809495 17:2388648-2388670 CAGGGAGTCTGGAGGGGAGTGGG - Intronic
1142810373 17:2393166-2393188 CGTAGGGGATGGAGGGACGTGGG - Intronic
1142836873 17:2593895-2593917 AAGGAGGGAGGGAGGGAAGGAGG - Exonic
1143128977 17:4664152-4664174 GAGGGGAGATGGAGGCAAGAGGG + Intergenic
1143645759 17:8228954-8228976 CAGCGGGGAGGGAGGCATGTTGG - Intronic
1143673726 17:8415107-8415129 CAGGAGGGAGGGAGGGAGGGAGG - Intronic
1143737356 17:8922134-8922156 AAGGAGGGAAGGAGGGAAGGTGG + Intronic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144092667 17:11871962-11871984 CAGGTGGCCTGGAGGGCAGTGGG - Intronic
1144247757 17:13384356-13384378 AAGGGGGGAGAGAGGGAAGGAGG + Intergenic
1144380179 17:14687190-14687212 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
1144489994 17:15700212-15700234 CAGGAGGGAAGGCAGGAAGTGGG + Exonic
1144727036 17:17507207-17507229 CAGGGAGGAGGGAGGGAGGGAGG + Intronic
1144754235 17:17669714-17669736 AAGGGAGGATGGAGGGAGGAGGG - Intergenic
1144910967 17:18681747-18681769 CAGGAGGGAAGGCAGGAAGTGGG - Exonic
1145065651 17:19759740-19759762 CAGGGGGCAGGGAGGGCAGAGGG - Intergenic
1145318655 17:21750007-21750029 CAAGGGGGATGGTGGGCAGGAGG + Intergenic
1145352606 17:22098843-22098865 CAGAAGGGCTGGAGGGAATTAGG + Intergenic
1146100698 17:29978950-29978972 CAGGGGGGATGGGGGGAGTGGGG + Intronic
1146210500 17:30938776-30938798 AAGGGAGGATGAAGAGAAGTGGG + Intronic
1146441295 17:32897326-32897348 GAGAGGGGAGGGAGGGAAGAAGG - Intergenic
1146621383 17:34401251-34401273 CAGGGAGGATGGGGCGGAGTGGG - Intergenic
1146700980 17:34960079-34960101 CAGTGGAGATGGAGAGAAGGTGG - Intronic
1146822555 17:35996057-35996079 CAGGAGGGAGGGAGGGAAGGGGG + Intronic
1146925030 17:36738563-36738585 CAGGGAGGAAGGAGGGAGGGAGG + Intergenic
1147184363 17:38705552-38705574 CAGGGGGGAGGGAGGGAGCGGGG - Exonic
1147266397 17:39237315-39237337 GAGGAGGGAGGGAGGGCAGTGGG + Intergenic
1147388863 17:40097264-40097286 AGTGGGGGATGGTGGGAAGTAGG + Exonic
1147484628 17:40800777-40800799 CAGTGGGGATGCAGAGAAGATGG + Intergenic
1147545954 17:41402027-41402049 CAGGGGACATGGTGGGGAGTGGG + Intergenic
1147742081 17:42675499-42675521 GAGGGGGGAGGGAGGGAAGCAGG - Intronic
1147765708 17:42834107-42834129 CAGGAGGAAGGGAGGGAAGGGGG + Intronic
1147793817 17:43028810-43028832 CAGGGGAGCTGGAGGGCAGAAGG + Exonic
1148210642 17:45806539-45806561 CTGGAGGAAGGGAGGGAAGTGGG + Intronic
1148231943 17:45941631-45941653 AAGGGGGGAAGGAGGGAAAGAGG - Intronic
1148533109 17:48414308-48414330 CTGGGGGAAAGGTGGGAAGTTGG + Intronic
1148712090 17:49689365-49689387 CAGTGGAGATGGAAGGAAGTAGG - Intergenic
1148737813 17:49874632-49874654 CAGGGGCCATGGTGGGAAGGGGG - Intergenic
1148787167 17:50151021-50151043 CGGGGGGGAGGGAGGGAGGGAGG - Intergenic
1148871672 17:50662118-50662140 CAGGGTGGCTGGATGGAAGTGGG + Intronic
1148896554 17:50842380-50842402 GATGGGGGAGGGAGGGAGGTGGG + Intergenic
1148950461 17:51306490-51306512 CGGGGGGAATGGAGCCAAGTTGG + Intergenic
1148998988 17:51737754-51737776 AAGGGGGGCTGTAGGGAAGCAGG - Intronic
1149279375 17:55085219-55085241 GAGGGGGGAGGGATGGCAGTGGG + Intronic
1149302537 17:55318336-55318358 CAGGTGGGAGGGAGGGGAGCTGG - Intronic
1149306084 17:55347726-55347748 CTGGGGGGCTGGAGAGGAGTGGG - Intergenic
1149422864 17:56527926-56527948 CTGGGGGGAGGGAGGGATGGAGG + Intergenic
1149513017 17:57258038-57258060 CAGGGAGGGTGGAGGTAACTTGG - Intronic
1149637218 17:58180747-58180769 CAGGGTGCAGGGAGGGAAGGGGG - Intergenic
1150293246 17:63993477-63993499 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1150634610 17:66904076-66904098 CAGAGGGGAGGGATGCAAGTCGG + Intergenic
1150636972 17:66919828-66919850 CAGGAGGAATGAAGGGATGTGGG - Intergenic
1150645730 17:66976456-66976478 CTGGAAGGAGGGAGGGAAGTTGG - Intronic
1150775122 17:68075125-68075147 AGGGAGGGATGGAGGGAAGCAGG - Intergenic
1150859447 17:68786326-68786348 AAGGAGGGAGGGAGGGAAGAGGG - Intergenic
1151050916 17:70978240-70978262 AAGGAGAGATGGAGGGAAGAAGG + Intergenic
1151050972 17:70978465-70978487 GAGGGTGGAAGGAGGGAAGAAGG + Intergenic
1151383932 17:73743824-73743846 AAGGGGGGAGGGAAGGAAGAGGG - Intergenic
1151512709 17:74571059-74571081 CAGTGGGGAGGGAAGAAAGTGGG - Intergenic
1151540000 17:74759958-74759980 CAGGGACGGTGGAGGGAGGTTGG + Intronic
1151558125 17:74857168-74857190 CTGGGGAGTTTGAGGGAAGTAGG - Intronic
1151606806 17:75142642-75142664 AGGGGGGGATGGAGGGAAGGGGG + Intronic
1152089573 17:78239260-78239282 CAGGTGGGAGGGAGGTAAGAGGG + Exonic
1152204546 17:78967556-78967578 CCGTGTGGATGGAGGGAAGCCGG + Intergenic
1152277038 17:79363911-79363933 CAGGGTGGCTGGAGTGGAGTGGG - Intronic
1152423249 17:80205239-80205261 GAGGAGGGAGGGAGGGAAGGTGG - Intronic
1152472090 17:80495215-80495237 CAGGGGGAAGGAAGGAAAGTGGG + Intergenic
1152542248 17:80982227-80982249 TAGTGGGGAGGGAGGGAAGGTGG - Intergenic
1152923847 17:83079002-83079024 CCGGGAGGAGGGAGGGAAGCCGG + Intergenic
1153299805 18:3582829-3582851 GAGGGGGGAGGGAGGAAAGAAGG - Intronic
1153359511 18:4177608-4177630 GAGGGTGGATGGAGGGAGGAAGG - Intronic
1153675308 18:7451794-7451816 GAGGGGGGAAGGAGGGAGGGAGG - Intergenic
1153802037 18:8679844-8679866 AAGGGGGCAGGGAGTGAAGTAGG + Intergenic
1153870628 18:9316174-9316196 GAGGGGGGAAGGAGGGAGGGAGG + Intergenic
1153997394 18:10454412-10454434 GAGAGGGGAAGGAGGGAAGCGGG + Intergenic
1154035801 18:10800541-10800563 TAGGGTGGAGGAAGGGAAGTGGG - Intronic
1154154728 18:11934964-11934986 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1154408074 18:14114662-14114684 GTGGGGGGTTGGTGGGAAGTGGG + Intronic
1155078074 18:22380527-22380549 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1155103547 18:22638500-22638522 GAGAGGGGAAGGAGGGAAGGAGG + Intergenic
1155188785 18:23411153-23411175 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1155578645 18:27277917-27277939 CTGTGGGGATGGAGAAAAGTTGG - Intergenic
1155627100 18:27846905-27846927 CAGTGGTGATGGACAGAAGTGGG - Intergenic
1155878665 18:31117507-31117529 AAGGAGGGAGGGAGGGAAGAAGG - Intergenic
1155968538 18:32058758-32058780 TAGTGGGGATTGGGGGAAGTGGG - Intronic
1156368538 18:36451736-36451758 GAGGTGGGAGGGAGGGAAGCAGG + Intronic
1156452697 18:37275423-37275445 GAGGGGCGAGGGAGAGAAGTAGG + Intronic
1156483451 18:37450404-37450426 CAGGGGAGAGGGAGGGAGGGAGG - Intronic
1156494335 18:37516181-37516203 CAGGGGGCAGGAAGGGATGTTGG - Intronic
1156683914 18:39621542-39621564 GAGAGGGAATGGAGGGCAGTTGG - Intergenic
1157213487 18:45763301-45763323 CAGAGAGAATGGAGGGAAGAGGG + Intergenic
1157396550 18:47346265-47346287 CAGCAGGGATGGAGGGCTGTTGG + Intergenic
1157529366 18:48408918-48408940 GAGGAGGGAGGGAGGGAAGGAGG - Intronic
1157558915 18:48632541-48632563 CAGGGGGGAAGTGGGGAAGGAGG - Intronic
1157595576 18:48861644-48861666 CAGGGAGGAGGCAGGGGAGTGGG + Exonic
1157989669 18:52479567-52479589 GGGGGGGGGTGGAGGGAGGTAGG - Intronic
1158103838 18:53861523-53861545 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1158103848 18:53861546-53861568 GAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1158321129 18:56265834-56265856 CAGGTGGGCTGGAAGAAAGTAGG + Intergenic
1158551810 18:58442560-58442582 CAGTGGGGCTGGAAGGAAGCTGG - Intergenic
1158775535 18:60574096-60574118 CAGGGGGTAGGAAGGGTAGTGGG + Intergenic
1159106150 18:64003326-64003348 CAGGTGGGAAAGAGTGAAGTGGG + Intronic
1159134305 18:64318989-64319011 AAGGAGGGATGGAGGGAGGGAGG - Intergenic
1159231519 18:65613319-65613341 CAGGGAGGAGGGAAGGAAGAAGG + Intergenic
1159626383 18:70700149-70700171 AAGGGGAGATGGAGAGAAGCTGG - Intergenic
1160194123 18:76738964-76738986 CAGGAGGGAGGGAGGGAGGGAGG - Intergenic
1160194143 18:76739016-76739038 CAGGAGGGAGGGAGGGAGGGAGG - Intergenic
1160194160 18:76739056-76739078 CAGGAGGGAGGGAGGGAGGGAGG - Intergenic
1160367450 18:78339587-78339609 AAGGAGGGATGGAGAGAATTTGG - Intergenic
1160468871 18:79108187-79108209 CAGGGATGCTGGAGGGAAGGAGG + Intronic
1160545019 18:79647327-79647349 AAGGGGGGAGGGAGGGAGGGAGG + Intergenic
1160545041 18:79647380-79647402 AAGGGGGGAGGGAGGGAGGGAGG + Intergenic
1160756627 19:760708-760730 CAGGAGGGAGGGAGGGATGGAGG + Intronic
1160847561 19:1173296-1173318 CAGGCGGGAGGGAGGGTAGCGGG - Intronic
1160888178 19:1362036-1362058 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1160888181 19:1362044-1362066 CAAGAGGGAAGGAGGGAAGGAGG - Intronic
1161208287 19:3053607-3053629 CAGGGGAGGAGGAGGGAAGCCGG + Exonic
1161233769 19:3188180-3188202 CCGGGGGGCTGGAGGGAGGCCGG - Intronic
1161329232 19:3678477-3678499 GAGGAGGGATGGAGGCAAGGAGG + Intronic
1161329302 19:3678704-3678726 CGGGAGGGATGGAGGGATGGCGG + Intronic
1161400987 19:4066194-4066216 CATGGGGGATGGGGGGGAGGGGG - Intronic
1161612557 19:5251262-5251284 GAGGCGGGAGGGAGGGAAGGAGG - Intronic
1161638081 19:5401835-5401857 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1161827849 19:6581046-6581068 AAGGAGGGAAGGAGGGAAGAAGG - Intergenic
1161977591 19:7615104-7615126 CAGGCTGGGTGGAGGGAAGATGG + Intronic
1161994235 19:7702661-7702683 TAGGAGGGAAGGAGGGAAGCGGG + Intergenic
1162080458 19:8214874-8214896 CAGAGGAGATGAAGGGCAGTGGG + Intronic
1162310075 19:9900996-9901018 GAGGGGGGAGGGAGGGAAGGAGG + Intronic
1162451605 19:10758422-10758444 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
1162541105 19:11296487-11296509 CAGGAGGGATGTAGGGCAGACGG + Intronic
1162570057 19:11466414-11466436 CAGGAGCGATGGAGGCAGGTGGG - Intronic
1162697362 19:12486467-12486489 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1162697365 19:12486475-12486497 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1162697368 19:12486483-12486505 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1162697371 19:12486491-12486513 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1162818140 19:13208244-13208266 CAGGGAGGAGGGAGGGGAGGAGG + Intronic
1162826516 19:13255732-13255754 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
1162967610 19:14163496-14163518 GAGGGGGGAGAGAGGCAAGTTGG + Intronic
1163020255 19:14477819-14477841 CAGGAGGGAGGGAGGGACGATGG - Exonic
1163207212 19:15812491-15812513 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1163689527 19:18730962-18730984 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1163699557 19:18780564-18780586 CAGGAGGGATGGATGGACATGGG - Exonic
1163763568 19:19150117-19150139 AAGGAGGGATGGAAGGAAGGAGG + Intronic
1163763583 19:19150153-19150175 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1163796110 19:19338947-19338969 CAGGAGGGAAGGAGGGGAGTGGG - Intronic
1164423023 19:28113937-28113959 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1164609130 19:29620488-29620510 CAGGGAGGCAGGAGGAAAGTTGG - Intergenic
1164686216 19:30168392-30168414 CAGGGGGCGTGTAGGGAAGAGGG - Intergenic
1164751589 19:30659293-30659315 CAGGAGGAAAGGAGGGAGGTGGG + Intronic
1164757386 19:30700328-30700350 GAGGGGGGAGGGAGGGAGGAAGG - Intronic
1164966194 19:32486904-32486926 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1165149701 19:33753562-33753584 GAGGGGGGATGGTGTGAGGTTGG - Intronic
1165149728 19:33753632-33753654 GAGGGGGGATGGTGGGTGGTGGG - Intronic
1165527942 19:36371977-36371999 AAGGAGGGATGGAGGGAGGGAGG + Intronic
1166062434 19:40334999-40335021 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1166828595 19:45624962-45624984 CAGGCCGGATGGAGGCAGGTGGG - Intronic
1166887540 19:45971399-45971421 CAGGAAGGAGGGAAGGAAGTCGG + Intronic
1166981604 19:46634930-46634952 GAGGGGCGAGGGAGGGAAGGAGG + Intergenic
1167079135 19:47267317-47267339 CAGGCTGGATGGAGTGCAGTGGG + Intronic
1167087749 19:47321877-47321899 GTGTGGGGGTGGAGGGAAGTGGG - Exonic
1167161282 19:47768880-47768902 CAGGAGGGACTGAGGGTAGTAGG + Intergenic
1167195180 19:48023409-48023431 GAGGAGGGAGGGAGGGAAGGAGG + Intronic
1167283631 19:48586330-48586352 CAGGAAGGGTGGAAGGAAGTTGG + Intronic
1167303989 19:48696467-48696489 CAGGGTGGAGGCAGGAAAGTCGG - Intronic
1167322470 19:48805636-48805658 CAGGGGGGATGGCGGGAGAGGGG - Intronic
1167422382 19:49411897-49411919 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1167638743 19:50668843-50668865 CAGGCGGGGTGGAGGGTCGTCGG + Exonic
1167668985 19:50838959-50838981 CTGGGGGGTTTGAGGGAGGTAGG + Intergenic
1167748136 19:51364761-51364783 CAGGGGGCATTGAGGGAGATGGG + Intronic
1168109079 19:54181732-54181754 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1168109099 19:54181784-54181806 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1168109119 19:54181836-54181858 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1168109130 19:54181864-54181886 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1168109141 19:54181892-54181914 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1168109179 19:54181988-54182010 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1168143943 19:54408651-54408673 AAGGGGGGAGGGAGGGAGGGAGG + Intergenic
1168143955 19:54408674-54408696 AAGGGGGGAGGGAGGGAGGGAGG + Intergenic
1168165467 19:54544207-54544229 CAGGGGGTATGGAGAGCATTAGG - Intronic
1168220365 19:54956141-54956163 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1168433914 19:56302707-56302729 GAGGTGGGAGGGAGGGAAGAAGG - Intronic
1168470747 19:56638760-56638782 CAATGGGGATGGAGAGCAGTGGG - Intergenic
1168472685 19:56652243-56652265 CAGCGGGGAGTGAGGGAAGCTGG + Intronic
924963619 2:56925-56947 CAGGGGCTGTGGTGGGAAGTGGG + Intergenic
924998496 2:385445-385467 CAGGGGGGACGGAGGGTGGTAGG - Intergenic
925171016 2:1750565-1750587 GAGGGGGGAGGGAGGGAGGGAGG - Intergenic
925171031 2:1750592-1750614 GAGGGGGGAGGGAGGGAGGGAGG - Intergenic
925171048 2:1750623-1750645 GAGGGGGGAGGGAGGGAGGGAGG - Intergenic
925212457 2:2061561-2061583 CCAGAGGGATGGAGGGAAGAGGG + Intronic
925299480 2:2800293-2800315 AAGGAGGGATGGAGGGAGGGAGG + Intergenic
926104377 2:10141313-10141335 GGGAGGGGATGGAGGGAAGATGG - Intergenic
926191577 2:10732206-10732228 AGGGAGGGATGGAGGGAAGAAGG - Intronic
926269474 2:11354345-11354367 GAGGGGGGAGGGAGGGAGGGAGG + Intergenic
926314711 2:11700839-11700861 CTGGGGAGGTGGAGGGATGTGGG - Intronic
926447810 2:12965556-12965578 CAGGGTAGCTGGAGGGAAGATGG - Intergenic
926711094 2:15881436-15881458 CGGGGAGGGTGGAGGGAGGTGGG + Intergenic
926947699 2:18206163-18206185 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
927182955 2:20460154-20460176 CAGGGAGAATGGAGCCAAGTTGG + Intergenic
927295853 2:21452384-21452406 CAGGGTGAATACAGGGAAGTGGG - Intergenic
927315847 2:21681040-21681062 GAGGTGGGAGGGAGGGAAGGAGG + Intergenic
927356279 2:22177385-22177407 CAGGGGTGTTGAAGGGCAGTAGG + Intergenic
927464292 2:23325441-23325463 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
927672247 2:25078578-25078600 CAGCAGGGCTGGAGGGAAGCTGG - Intronic
927940394 2:27099804-27099826 CAGGCTGGATGGAGGGGAGAAGG - Exonic
928199764 2:29240097-29240119 CAGGGAGGAGGGAGGGAAGAAGG + Intronic
928354099 2:30593040-30593062 CGGGAGGGATGTAGAGAAGTTGG - Intronic
928602335 2:32915877-32915899 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
928785875 2:34885487-34885509 TAGAGGGAATGGAGGAAAGTGGG - Intergenic
928814007 2:35267545-35267567 CAGGGGAAAGGGAGAGAAGTTGG - Intergenic
929217019 2:39425100-39425122 CTGGGGGGGTGGTGGGGAGTGGG - Intronic
929551423 2:42895499-42895521 CATGGGGGAGGGAGGGATGCAGG + Intergenic
929562210 2:42963014-42963036 CAGGGAGGGAGGAGGGAAGAGGG - Intergenic
929592206 2:43154700-43154722 GAGTGGGGATGGATGGAGGTTGG + Intergenic
929635973 2:43521166-43521188 AAGGAGGGAGGGAGGGAAGAAGG + Intronic
929814865 2:45222648-45222670 CAGGGGAGAAGGAGGGATGGGGG + Intergenic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
930406267 2:50960326-50960348 AAGGAGGGAAGGAGGGAAGAAGG - Intronic
931088174 2:58857148-58857170 CAGGAGGGATGGAGAGATGAAGG + Intergenic
931160054 2:59679583-59679605 AAGTGGGGATGGTGGGAAGATGG - Intergenic
931316609 2:61139040-61139062 GAGGGAGGAGGGAGGGAAGGAGG - Intergenic
931409845 2:62019018-62019040 AGGGAGGGAGGGAGGGAAGTTGG - Intronic
931421104 2:62128596-62128618 AAGGAGGGAGGGAGGGAGGTAGG - Intronic
932111485 2:69005442-69005464 CAGGGGGGAAGGATAGCAGTGGG + Intergenic
932220688 2:69996770-69996792 CATGGGGGCTGCAGGGATGTCGG + Intergenic
932421602 2:71604523-71604545 CAGGGGGCAGTGAGGGAAGATGG + Intronic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
933234511 2:79850283-79850305 GAGGGGGGAGGGAGGGAGGAAGG - Intronic
933350026 2:81142083-81142105 GAGAGGGGATGAAGAGAAGTTGG - Intergenic
933946237 2:87288525-87288547 GAGGGAGGAAGGAGGGAAGGAGG - Intergenic
934543388 2:95194743-95194765 GTGGGGGGTGGGAGGGAAGTGGG + Intergenic
934554758 2:95281428-95281450 CAGGAGGGTTGGGGGAAAGTGGG + Intronic
934760995 2:96857151-96857173 TAGGAGGGGCGGAGGGAAGTAGG + Intronic
934851208 2:97702368-97702390 CAAGGGGCATGGAGGGAAAATGG - Intergenic
934880456 2:97972469-97972491 CGGGCGGGAGGGAGGGAAGGCGG + Intronic
934954455 2:98605934-98605956 CAGTGGGGCTGGAGGAAAGCAGG - Intronic
934971953 2:98770934-98770956 CCGGGAAGATGGACGGAAGTGGG - Intergenic
935182114 2:100700747-100700769 CTGGGGTGATGGAGGGACATCGG - Intergenic
935210861 2:100938554-100938576 AAGGGGGGAGGGAGGGAAGGAGG - Intronic
935332727 2:101988803-101988825 GAGGGGGGTTGGAGGGAAAGTGG + Intergenic
935422773 2:102887028-102887050 GAGGGGGGAGGGAGGGGAGGGGG - Intergenic
935706496 2:105861916-105861938 CAGGAGGGAGGGAGGGAGGGAGG - Intronic
935786825 2:106557125-106557147 CAGGGAGGAGGGGGTGAAGTTGG + Intergenic
936288540 2:111200220-111200242 TAGGGGGCAGGGAGGGGAGTGGG - Intergenic
936333978 2:111573058-111573080 GAGGGAGGAAGGAGGGAAGGAGG + Intergenic
936416705 2:112322108-112322130 AAGGAGGGAAGGAGGGAAGACGG - Intronic
936416707 2:112322116-112322138 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
936416710 2:112322124-112322146 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
936574419 2:113641530-113641552 CAGGTGTGATGGAGAGAACTGGG + Intronic
936749076 2:115618938-115618960 CAGGGAGGAGGAAGGGAATTAGG - Intronic
936766872 2:115861534-115861556 CAGTGGAGATGGAGAGAAGTAGG + Intergenic
936768865 2:115887559-115887581 AAGGAGGGAGGGAGGGAAGAAGG - Intergenic
936812006 2:116413636-116413658 CAGGGAGGTTGCAGGGAGGTTGG - Intergenic
936923433 2:117712496-117712518 CATGGGGGATGAAGGAGAGTGGG - Intergenic
937239392 2:120450592-120450614 CAGGTGGGAGGGAGGGAAGATGG - Intergenic
937239711 2:120452219-120452241 CAGTGGGGATGGAGTGAAAGTGG - Intergenic
937334946 2:121056486-121056508 CAGTGGGGATGGAGAGAGGATGG + Intergenic
937358124 2:121211240-121211262 CAGGAGGAAGGGAGGGAAGTTGG + Intergenic
937615844 2:123921397-123921419 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
937615851 2:123921413-123921435 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
937683881 2:124674352-124674374 AAGGAGGGAGGGAGGGAAGAAGG - Intronic
937737277 2:125307234-125307256 AGGGAGGGAGGGAGGGAAGTGGG + Intergenic
937778124 2:125805383-125805405 AGGGAGGGAGGGAGGGAAGTAGG + Intergenic
937890491 2:126934896-126934918 CAGGTGGGGTGGAGTGAAGCAGG + Intergenic
938264947 2:129921992-129922014 CAGGGGGGGTGGGGGGCAGCAGG + Intergenic
938665053 2:133526246-133526268 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
938665060 2:133526262-133526284 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
938665067 2:133526278-133526300 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
938665074 2:133526294-133526316 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
938665081 2:133526310-133526332 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
938708790 2:133957274-133957296 AAAGGGGGATGTAGGGCAGTAGG + Intergenic
939176898 2:138759494-138759516 CAGGTGGGAAGGTGGGAAATGGG + Intronic
939244517 2:139606454-139606476 CATGGGGGGTGGAGGGAGGGGGG + Intergenic
939280475 2:140057922-140057944 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
939815412 2:146890187-146890209 CATGGGGGATGGAGGGATTCCGG - Intergenic
939875044 2:147568279-147568301 ATGGGTGGATGGAGGGAAGGAGG + Intergenic
940030393 2:149256237-149256259 CAGGGAGAATGGAAGCAAGTTGG - Intergenic
940143315 2:150519676-150519698 CAGGATGGATGGAGGGAGTTAGG + Intronic
940159552 2:150696840-150696862 CAGGAGGGAGGGAGGAAAGAAGG + Intergenic
941114323 2:161454277-161454299 TGGGAGGGATGGAGGGAAGAAGG - Intronic
941201225 2:162513270-162513292 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
941282273 2:163567886-163567908 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
941541396 2:166790142-166790164 GAGGGGGGAAGGTGGGAAGAGGG - Intergenic
941633298 2:167908014-167908036 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
942183394 2:173402143-173402165 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
942211756 2:173678243-173678265 CAAGAGGGAGGGAGGGAAGAAGG + Intergenic
942462449 2:176177913-176177935 CGAGGGGGATTGAGGGAAGATGG - Intergenic
942663849 2:178295557-178295579 GATGGGGGATGGAGGGTAGGTGG - Intronic
943046460 2:182867000-182867022 CAGAGGGGTTGGGGGGAAGGAGG + Exonic
943060944 2:183040759-183040781 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
943232227 2:185268871-185268893 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
943409955 2:187534112-187534134 CAGGGAGAATGGAAAGAAGTTGG + Intronic
943430075 2:187788647-187788669 AAGGTGGGGTGGAGGGGAGTGGG + Intergenic
943499210 2:188666064-188666086 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
943555040 2:189392653-189392675 CAGGGAGGAGGTAGGGAAGATGG + Intergenic
943595329 2:189848637-189848659 CATGGTGGATTGAGGGAATTTGG + Intronic
943662923 2:190578327-190578349 GAGGGAGGATGGAAGGAAGCTGG - Intergenic
943860627 2:192857754-192857776 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
944277195 2:197852247-197852269 CAGGGAGGATGGTGGGGAGATGG + Intronic
944651118 2:201831224-201831246 CAGGGGGGATGGAAGGACTCAGG + Intronic
944689560 2:202147362-202147384 CAGAGGGGAGGCAGGGAATTTGG + Intronic
944775578 2:202960774-202960796 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
944824839 2:203472045-203472067 CAAGGAGGAGGGAGGGAATTGGG + Intronic
945143888 2:206715754-206715776 CAAGGGGGCTGTAGGCAAGTTGG + Intronic
945218094 2:207455803-207455825 AAGGGGGCTTGTAGGGAAGTGGG + Intergenic
945519966 2:210814211-210814233 CAGGAGCAATGGAGAGAAGTAGG + Intergenic
945581563 2:211601806-211601828 GAGGTGGGATGGAGGGAGGGAGG + Intronic
945604417 2:211910574-211910596 CAGGGTGGAGGGTGGGAAGATGG + Intronic
945876085 2:215279773-215279795 AAGGAGGGACGGAGGGAAGGAGG + Intergenic
945958226 2:216105963-216105985 CAAGAGGGAGGGAGGGAAGGAGG + Intergenic
946048768 2:216843289-216843311 CAGGGGGCCTGGAAGGAAGGGGG + Intergenic
946057846 2:216917221-216917243 CAGGGAGGAAGAAGGGAAGAGGG + Intergenic
946184787 2:217974378-217974400 CTGAGGGGATGGAGGAAAGCAGG - Intronic
946552980 2:220823529-220823551 GAAGAGGGATGGAGGGAGGTAGG - Intergenic
946865002 2:224034790-224034812 CAGGGGGGCTGCGAGGAAGTGGG + Intronic
947030074 2:225783092-225783114 AAGGGGGGAAGGAAGAAAGTGGG - Intergenic
947077714 2:226363911-226363933 GAGGGAGGAAGGAGGGAAGGAGG + Intergenic
947179421 2:227399014-227399036 GAGGGAGGAGGGAGGGAAGAAGG + Intergenic
947305330 2:228740285-228740307 AAGGAGGGAGGGAGGGAAGAAGG - Intergenic
947811875 2:233009874-233009896 CAGGTGGAGTGGAGGGAAGGTGG - Intronic
948230942 2:236348990-236349012 CAGGATGGAGGGAGGGAAGGTGG - Intronic
948280068 2:236740297-236740319 CAGTGTGGCTGGAGAGAAGTGGG + Intergenic
948408829 2:237743287-237743309 CAGAGGGGAGGGAGGGAGGGTGG + Intronic
948458421 2:238117946-238117968 GAGGGTGGATGGAGGGGAGGTGG + Intronic
948563279 2:238867830-238867852 AAGGCGGGAGGGAGAGAAGTGGG + Intronic
948756493 2:240162577-240162599 CAGGGCGGGTGGAGGGAGGCGGG + Intergenic
949033825 2:241807601-241807623 GAGGGGGGAGGGAGGGAAGGTGG - Intergenic
949033842 2:241807644-241807666 GAGGGGGGAGGGAGGGAGGGTGG - Intergenic
949033941 2:241807882-241807904 GAGGGGGGAGGGAGGGAAGGTGG - Intergenic
949033958 2:241807925-241807947 GAGGGGGGAGGGAGGGAGGGTGG - Intergenic
949034023 2:241808089-241808111 GAGGGGGGAGGGAGGGAGGGAGG - Intergenic
949075760 2:242056763-242056785 CAGGGGGACTGGAGGGCCGTGGG + Intergenic
1169766738 20:9154888-9154910 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1170034719 20:11978421-11978443 AAGGCGGGAGGGAGGGAAGAAGG - Intergenic
1170177673 20:13490665-13490687 GAGGGGTGAGGGAGGGAAGGAGG - Intronic
1170240234 20:14157528-14157550 GAGGGGGGATGAAGAGAGGTTGG - Intronic
1170687689 20:18584345-18584367 CAGGAGGGATGGAGAGAAGAGGG + Intronic
1170859195 20:20086977-20086999 GAGGTGGGAAGGAGGGAAGATGG + Intronic
1170881006 20:20296371-20296393 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
1170923349 20:20700301-20700323 GAGGGGGGATGGAGGGAGTGGGG + Intronic
1171290295 20:23979230-23979252 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1171412944 20:24958736-24958758 CACGGGGCAGGGAGGGGAGTGGG + Intronic
1171456659 20:25276289-25276311 CAGAGGGTAAGGAGGGAGGTGGG + Intronic
1171770708 20:29320266-29320288 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
1171779097 20:29402529-29402551 GAGGGGGGAAGGTGGGAAGAGGG + Intergenic
1172178697 20:32987636-32987658 CAGGGGGGATGGCGGGAGATGGG - Intronic
1172292147 20:33784164-33784186 GAGGGGGGAGGGAGAGGAGTAGG - Intronic
1172350545 20:34235962-34235984 AAGGAGGGAGGGAGGGAAGAAGG + Intronic
1172619034 20:36307424-36307446 CCGGAGGGATGGAGGGATGGAGG - Intronic
1172858744 20:38030248-38030270 AAGGAGGGAGGGAGGGAAGCAGG + Intronic
1172933514 20:38602090-38602112 CACGGGAGCGGGAGGGAAGTTGG + Intronic
1173089010 20:39952457-39952479 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1173230945 20:41197073-41197095 CAGGGCTGATGGAGAGAAGAAGG + Intronic
1173573537 20:44094624-44094646 CTTGGGGGATGGAGGGATATTGG - Intergenic
1173575874 20:44112775-44112797 CAGGGGGCAGGGTGGGAAGAGGG - Exonic
1173800917 20:45893893-45893915 CAGGGAGGTTGGTGGGAGGTGGG + Intronic
1173868970 20:46330151-46330173 CAGGGGAGCTGGAGGCAGGTGGG + Intergenic
1173997942 20:47353800-47353822 AAGGGGGGTTGGGGGGAAGCAGG + Intronic
1174090055 20:48039580-48039602 AAGGGGGGTTGGGTGGAAGTGGG + Intergenic
1174164547 20:48575614-48575636 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1174469345 20:50744636-50744658 CAGGAGGGAGGGAGGGAGGGAGG - Intronic
1174507952 20:51029047-51029069 GAGGAGGGATGGAGGGAGATGGG - Intergenic
1174692080 20:52516082-52516104 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1174793697 20:53503811-53503833 CAGGGAGGAAGGAGGGAGGAAGG + Intergenic
1174795847 20:53522041-53522063 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1174795850 20:53522049-53522071 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1174819110 20:53712155-53712177 AAGGAAGGAGGGAGGGAAGTAGG - Intergenic
1174832699 20:53827727-53827749 AAGGAGGGAGGGAGGGAAGAGGG - Intergenic
1174926547 20:54766754-54766776 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1174926550 20:54766762-54766784 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1174926553 20:54766770-54766792 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1175164455 20:57033403-57033425 CAGTGGGGCTGGAGAGAAGGGGG + Intergenic
1175216891 20:57395902-57395924 CTGAGGGCATGGAGGGAGGTGGG + Intronic
1175254037 20:57628132-57628154 GAGGGGGCAGGAAGGGAAGTGGG + Intergenic
1175388509 20:58612146-58612168 AAGGGGGGAAGGAGGGAGGGAGG - Intergenic
1175449061 20:59047064-59047086 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1175499865 20:59442110-59442132 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1175605776 20:60311248-60311270 AAGGAGGGAGGGAGGGAAGGTGG - Intergenic
1175816207 20:61884482-61884504 CAGGAGGGAGGGAGGGAAGATGG + Intronic
1175984037 20:62755364-62755386 GAGGGTGGATGGAGGGATGAAGG - Intronic
1176954921 21:15091193-15091215 CAGGGGGGAAGGTAGGAAGGTGG + Intergenic
1177046895 21:16182539-16182561 AAGGAGGGATGGAGGGAGGCAGG - Intergenic
1177149516 21:17440897-17440919 CTGGGGTGCTGGAGAGAAGTAGG - Intronic
1177430667 21:20988574-20988596 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
1177694735 21:24556366-24556388 CAGGGAGAATGGAACGAAGTTGG + Intergenic
1177957232 21:27613931-27613953 GAGGGTGGAAGGAGGGAAGAGGG - Intergenic
1178163931 21:29950241-29950263 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1178319878 21:31597234-31597256 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1178516080 21:33248375-33248397 TAGGGGGGAGGGAGGGAGGGGGG + Intronic
1178669109 21:34575317-34575339 AAGGAGGAAAGGAGGGAAGTGGG - Intronic
1179179868 21:39036061-39036083 CAGGAGGCATGGATGGAAGAGGG - Intergenic
1179296850 21:40070342-40070364 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1179388962 21:40970004-40970026 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
1179714525 21:43280399-43280421 GAGGGGAGGTGGAGGGGAGTTGG + Intergenic
1179714546 21:43280449-43280471 GAGGGGAGGTGGAGGGGAGTTGG + Intergenic
1179973202 21:44847685-44847707 CAGGACAGATGGAGGGGAGTGGG - Intergenic
1180156115 21:45978014-45978036 GAGGGGGAAAGGAGGGAAGGGGG + Intergenic
1180629219 22:17215808-17215830 CATGGGGGATGAAGAGAAGTTGG + Intronic
1180767133 22:18351782-18351804 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1180779178 22:18510597-18510619 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180811897 22:18767917-18767939 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181000809 22:19987057-19987079 CAGACAGGTTGGAGGGAAGTTGG - Intronic
1181111346 22:20604798-20604820 CTGGCGGGAGGGAGGGAGGTTGG - Intergenic
1181151688 22:20888458-20888480 ATGGGGGGCTGGAGGGAAGCGGG - Exonic
1181198052 22:21202161-21202183 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181401693 22:22653643-22653665 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181528266 22:23502256-23502278 GATGGGGGATGGAGGGATGGGGG - Intergenic
1181528526 22:23502978-23503000 GATGGGGGATGGAGGGATGGAGG - Intergenic
1181647857 22:24243457-24243479 ATGGGGGAATGGAGGGAAGAAGG + Intronic
1181703651 22:24634736-24634758 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181969467 22:26679454-26679476 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1182050698 22:27310593-27310615 GAGGGGGGAGGGAGGGAAGGAGG + Intergenic
1182050708 22:27310612-27310634 GAGGGGGGAGGGAGGGAAGGAGG + Intergenic
1182098924 22:27644603-27644625 CTGAGTGGATGGACGGAAGTAGG + Intergenic
1182201351 22:28573832-28573854 TAGTGGGGGTGGGGGGAAGTGGG - Intronic
1182318912 22:29465830-29465852 TAGGGGTGATGGAGGAATGTGGG - Intergenic
1182439464 22:30354284-30354306 CAGATGGGAGGCAGGGAAGTGGG - Intronic
1182868384 22:33624868-33624890 CAGTGGGGATGGAGAGAACGGGG + Intronic
1182989182 22:34750714-34750736 CAGCAGGGTTGGAGGAAAGTGGG + Intergenic
1183084457 22:35478056-35478078 GAGAGGAGAAGGAGGGAAGTGGG - Intergenic
1183095257 22:35548104-35548126 CAGGGAGGTTGGGGGGAAGAAGG + Intronic
1183109230 22:35636825-35636847 CAGCTGGGAGGGAGGGAAGAGGG - Intronic
1183209736 22:36443425-36443447 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1183287603 22:36977274-36977296 CACGGGGGATGGAGGCTAGTGGG + Intergenic
1183509570 22:38227011-38227033 CGGAGGGGATGGAGGGACGAAGG + Intronic
1183606279 22:38868290-38868312 CAGGGAGGACGGTGGGCAGTGGG + Intronic
1183698845 22:39438299-39438321 GAGGGGAGAGGGAGGGAAGGAGG - Intergenic
1183729962 22:39612845-39612867 GTGGAGGGATGGAGGGAAGGAGG - Intronic
1183733486 22:39630970-39630992 CAGGGAGGATGGAGGGAGGTGGG + Intronic
1183853982 22:40617159-40617181 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1183853985 22:40617167-40617189 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1183858807 22:40654103-40654125 CACGGGGTATGGGGGGAAGCAGG + Intergenic
1184147015 22:42617706-42617728 CAGTGTGGCTGGAGGGGAGTGGG - Intergenic
1184319591 22:43730228-43730250 CAGGAGGGAAGGATGGAAGGAGG + Intronic
1184402196 22:44280677-44280699 CATGGGGGAGGGAGGGAGGTGGG + Intronic
1184642384 22:45879461-45879483 GAAGGGGGAGGGAGGGAAGGAGG - Intergenic
1184642397 22:45879488-45879510 TAGGGAGGAGGGAGGGAAGCAGG - Intergenic
1184730377 22:46368312-46368334 CAGAGGGGATGGAGTGAATCCGG + Intronic
1203228755 22_KI270731v1_random:92676-92698 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
949325516 3:2859043-2859065 CAGGGAGGTTGGAGGAATGTTGG - Intronic
950007632 3:9701705-9701727 CAGGTGGTATGGAGGGAGGGAGG + Intronic
950230913 3:11275061-11275083 CAGTGGAGATGGAGAGGAGTGGG + Intronic
950526863 3:13529348-13529370 CAGGAGGGATGGAGGGAAAAGGG - Intergenic
950579709 3:13854159-13854181 AAGGAGGGACGGAGGGAAGGAGG + Intronic
950728948 3:14939414-14939436 CAGGCAGGATGGAGGGAGGTAGG + Intergenic
950925070 3:16732212-16732234 CAGGGAGAATGGAGCCAAGTTGG + Intergenic
951071058 3:18329881-18329903 CAGGGGGAATGGAACCAAGTTGG - Intronic
951214917 3:20014740-20014762 CACTGGGGATGGAGACAAGTGGG - Intergenic
951498952 3:23362488-23362510 CAGCAGGGATGGAGGGAGGAGGG - Intronic
952083997 3:29795711-29795733 CTGGGAGGAAGGAGGGAAGAGGG + Intronic
952102668 3:30032950-30032972 CTGAGGGGATGGAGGTAAGAGGG + Intergenic
952164620 3:30733636-30733658 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
952306177 3:32148412-32148434 CATGGGGGATGCAGGGAGGTGGG + Intronic
952307268 3:32157335-32157357 CAGAGGGGATGGAGTGAACCTGG - Intronic
952901383 3:38114178-38114200 GAGTGGAGATGGCGGGAAGTGGG + Intronic
953038935 3:39237796-39237818 CCGGAGGGAGGGAGGGAAGCAGG - Intergenic
953047388 3:39306073-39306095 CAGGGAGAATGGAACGAAGTTGG + Intergenic
953104017 3:39857240-39857262 CAGGAGGGAGGGAGGGAGGAAGG + Intronic
953191377 3:40691082-40691104 GAGCGGGGATGGAAGGAGGTGGG - Intergenic
953796663 3:45991456-45991478 CAGAGGGGAAGAAGGGAAGGAGG - Intronic
954111410 3:48435421-48435443 CCTGGAGGATGTAGGGAAGTGGG - Intronic
954317955 3:49811520-49811542 CAGGGTGGATGGAGGGTGGCTGG - Intronic
954361825 3:50126237-50126259 CAGAAGGGATGGTGGGAAGAGGG + Intergenic
954578826 3:51692025-51692047 CTGGGGGAAGGGAGGGAGGTGGG - Intronic
954672877 3:52299884-52299906 CAGGGAGGGAGGAGAGAAGTGGG + Intergenic
954763800 3:52896900-52896922 CACTGGGGATTGAGGGATGTGGG + Intronic
954787413 3:53104105-53104127 CAGGGAAGAGGGAAGGAAGTTGG + Intronic
955168543 3:56540114-56540136 GAGGGAGGATGGATGGAGGTAGG - Intergenic
955675535 3:61444356-61444378 CAGGGTGGAGGGAGGGAGGGAGG - Intergenic
955711067 3:61779537-61779559 CAGTGAAGATGGAGGGATGTAGG + Intronic
955852491 3:63235648-63235670 CATGGGGGAAGGAGAGAGGTAGG - Intronic
955990714 3:64624069-64624091 GAGGGGGGATGGGGAGATGTTGG + Intronic
956057843 3:65319318-65319340 TTGGGGGGTGGGAGGGAAGTAGG + Intergenic
956220242 3:66894573-66894595 CAGGGAGAATGGAGCCAAGTTGG + Intergenic
956329285 3:68087551-68087573 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
956349660 3:68320848-68320870 CAGGGGAGAAGGAGGTAAGCAGG - Intronic
956388978 3:68751409-68751431 CAGTGGGGATGGAGAAAAGTGGG + Intronic
956643673 3:71435969-71435991 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
956675229 3:71725904-71725926 AAGGAGGGATGGAGGGCAGATGG + Intronic
956754085 3:72368374-72368396 CAGGGGGAAGAGAGGGAAGGTGG - Intergenic
956783705 3:72624803-72624825 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
956990496 3:74757420-74757442 GGGCTGGGATGGAGGGAAGTGGG - Intergenic
957146613 3:76432918-76432940 GAGGAGGGAGGGAGGGAAGGAGG + Intronic
957220842 3:77380676-77380698 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
957467081 3:80608087-80608109 GAGGGGGAAGGGAGGGAAGGAGG + Intergenic
957856032 3:85879995-85880017 CAGGGGCGATGGAGAGTAGAGGG - Intronic
957941370 3:87008921-87008943 GAGGGGTGATGAAGAGAAGTTGG - Intergenic
957979849 3:87494586-87494608 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
958005232 3:87802075-87802097 GAGGAGGGAGGGAGGGAAGGAGG - Intergenic
958732590 3:97974527-97974549 GAAGGGGGAGGGAGGGAAGGAGG + Intergenic
959087599 3:101868105-101868127 GAGGGGAGAGGGAGGGAAGAAGG - Intergenic
959112179 3:102134890-102134912 TAGGGAGGATGGAGGATAGTAGG + Intronic
959256846 3:104025832-104025854 CAGGGGGCAGGGAGGGAAGGAGG + Intergenic
959687927 3:109167765-109167787 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
959758660 3:109930089-109930111 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
959760307 3:109955262-109955284 GAGAGGAGATGGAGAGAAGTTGG - Intergenic
960004449 3:112767620-112767642 CAGGAGGGAGGGAGGGAAGTTGG - Intronic
960054165 3:113264821-113264843 GAGGGGGGATAGAGGGTAGGAGG + Intronic
960891410 3:122452503-122452525 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
960891413 3:122452511-122452533 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
960891416 3:122452519-122452541 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
960891419 3:122452527-122452549 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
960969083 3:123126328-123126350 AGCGGGGGATGGGGGGAAGTAGG - Intronic
961185601 3:124912438-124912460 CAAGAGGCATGGAGGGTAGTGGG + Intronic
961208313 3:125105214-125105236 GAGGGGGGATGGAGGGATGGGGG + Intronic
961211416 3:125128841-125128863 GAGGGGGGAATGGGGGAAGTAGG + Intronic
961369603 3:126421507-126421529 AAGCAGGGATGGAGAGAAGTGGG + Intronic
961396780 3:126599184-126599206 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
961460264 3:127045570-127045592 AAGGGAGGAGGGAGGGAAGGAGG + Intergenic
961522759 3:127476724-127476746 AAGGGAGGAAGGAGGGAAGGAGG + Intergenic
961811910 3:129526914-129526936 CAGGTGGGCTGCAGGGAAGGGGG + Intergenic
961958123 3:130825385-130825407 CAGGGAGGAGGGAGGGAGGGAGG + Intergenic
962132754 3:132699223-132699245 CAGTGAGGATGGGGAGAAGTGGG - Intronic
962397020 3:135025102-135025124 AAGGGGGGAGGGAGGGAGGGAGG - Intronic
962516852 3:136160308-136160330 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
962518998 3:136180743-136180765 GAGGAGGGAAGGAGGGAAGGAGG + Intronic
962743315 3:138379156-138379178 GTGGGGGGATGAAGAGAAGTTGG - Intronic
962850035 3:139301511-139301533 CAGAGGGAATGAAGGGAAGCTGG - Intronic
962925028 3:139985028-139985050 CAGTGGAGATGGAGAGAAATGGG - Intronic
963043181 3:141083877-141083899 CAGAGGGGAGGGAGGTAAGCAGG - Intronic
963613715 3:147507493-147507515 TTGGGGGGAGGGAGGGAAGAAGG - Intronic
963638150 3:147825381-147825403 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
963638431 3:147828653-147828675 CAGTGGAGATGGAGACAAGTAGG + Intergenic
964090310 3:152868540-152868562 CAGAAGGGCTGGAGGGATGTGGG - Intergenic
964242343 3:154611261-154611283 GAGGGGGAAGGGAGGGAAGAAGG - Intergenic
964903847 3:161693962-161693984 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
965083887 3:164069463-164069485 CAGGAGGGAAGGAGGGAAGGTGG + Intergenic
965528595 3:169747818-169747840 TAGGGGTGGTGGAGGGAAGGGGG - Intergenic
965612787 3:170562485-170562507 CAGTGGGGAGGGTGGGAAGGGGG + Intronic
965834959 3:172841140-172841162 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
965915248 3:173837826-173837848 CAGTGCAGTTGGAGGGAAGTGGG + Intronic
966029963 3:175333687-175333709 CCGGGGGGATGAAGAGAGGTTGG + Intronic
966311023 3:178594031-178594053 AAGGAGGGAGGGAGGGAAGAGGG - Intronic
966504464 3:180684017-180684039 CAGTGGAGATGGAGAGCAGTAGG - Intronic
966811986 3:183855135-183855157 CTGAGGGGAAGGAGGGAAGGAGG + Intronic
966959724 3:184923150-184923172 GAGGGTGGAAGGAGGGAACTTGG + Intronic
967157906 3:186710445-186710467 CAAGGGTGATGGTGGGAAGTGGG - Intergenic
967258153 3:187614145-187614167 AAGAGAGGATGGAGGAAAGTGGG - Intergenic
967459776 3:189732252-189732274 CAGGGGTGGTGGAGGGGAGTTGG - Intronic
967726735 3:192869299-192869321 GAGGAGGGAAGGAGGGAAGGAGG + Intronic
967789476 3:193531416-193531438 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
967955890 3:194876918-194876940 CTTGGGGGATGCAGGGAAGCTGG + Intergenic
968159980 3:196418259-196418281 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
968208822 3:196829292-196829314 AAGGGGGAAAGGAGGGAAGAAGG - Exonic
968814920 4:2817330-2817352 CAGGGCGGCTGGAAGGAGGTGGG + Intronic
968940099 4:3633302-3633324 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
969280395 4:6166915-6166937 CAGGGTGGAGGAGGGGAAGTTGG - Intronic
969308103 4:6336876-6336898 AAGGAGGGATGGAGGGAGGGAGG - Intronic
969318234 4:6394998-6395020 CAGGGCGGAGGCAGGGAGGTGGG - Intronic
969325338 4:6440870-6440892 CAGGAAGGGTGTAGGGAAGTGGG + Intronic
969350724 4:6596603-6596625 CAGGGAGGATGGATGGTAGGAGG - Intronic
969480832 4:7446057-7446079 CAGGGAGGAAGGAAGGAAGGGGG - Intronic
969495309 4:7523026-7523048 GAGGGAGGAGGGAGGGAAGAGGG - Intronic
970224568 4:13844159-13844181 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
970434690 4:16022104-16022126 AAGGAGGGAAGGAGGGAAGAAGG + Intronic
970502335 4:16690515-16690537 GAGGGGGGAGGGAGGGAGGGAGG + Intronic
970526108 4:16933878-16933900 AAGGGGGGGTGGCGGGAATTTGG - Intergenic
970566099 4:17334077-17334099 GAGGCAGGATGGAGGGAAATGGG - Intergenic
971034169 4:22675131-22675153 GAGGGAGGAAGGAGGGAAGGAGG - Intergenic
971289823 4:25327397-25327419 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
971289826 4:25327405-25327427 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
971289829 4:25327413-25327435 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
971394313 4:26214490-26214512 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
971664331 4:29462184-29462206 GAGGGGGGATGGAGGGAGGAGGG + Intergenic
971665533 4:29478675-29478697 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
972055523 4:34797185-34797207 AGGGAGGGATGGAGGGAAGAAGG - Intergenic
972276330 4:37561200-37561222 CAGAGAGGAAGGAGGGAATTGGG - Intronic
972509500 4:39754240-39754262 GAAGGTGGATGGAGAGAAGTAGG + Intronic
972619573 4:40733822-40733844 AAGGTGGGAAGGAGGGAAGGAGG + Intergenic
972648731 4:40994867-40994889 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
972684038 4:41334534-41334556 GAGGGGAGATGGAGGTAGGTGGG + Intergenic
972766889 4:42159466-42159488 CAGTGACGATGGAAGGAAGTGGG + Intergenic
973544354 4:51966084-51966106 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
973544391 4:51966197-51966219 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
973655620 4:53044616-53044638 AAGGAGGGAGGGAGGGAAGAAGG - Intronic
974095496 4:57359467-57359489 AGAGAGGGATGGAGGGAAGTTGG + Intergenic
974142762 4:57908701-57908723 AAGTGGGGATGGAGAGAAGCAGG + Intergenic
974392531 4:61290684-61290706 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
974392534 4:61290692-61290714 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
974429769 4:61780640-61780662 CAGTGGGAATGGATGGAAGAAGG - Intronic
974491473 4:62570537-62570559 CAGGGAGCATGGAAGCAAGTTGG - Intergenic
974694024 4:65341045-65341067 GAGGAGGGATGAAGGGAAGCCGG - Intronic
975110373 4:70616850-70616872 GAGGAGGGATGGAGAGTAGTAGG + Intergenic
975484026 4:74914791-74914813 CAGGGAGAATGGAAGCAAGTTGG - Intergenic
975513854 4:75222862-75222884 CAGGGAGAATGGAGCCAAGTTGG + Intergenic
975518213 4:75270143-75270165 CAGGGAGAATGGAAGCAAGTTGG + Intergenic
975655545 4:76637849-76637871 GAGGGAGGATGAAGGGAACTGGG + Intronic
975810890 4:78168434-78168456 CAGGGGTGCTGCAGGGAAGTGGG - Intronic
975895365 4:79083793-79083815 CAGATGGGATGGAGGGAGGACGG - Intergenic
975916018 4:79326005-79326027 GAGGGCGGATGGCGGGAAGGCGG + Exonic
976310537 4:83607483-83607505 GAGGTGGGGTGGAGGGAAGTGGG + Intergenic
976484861 4:85590244-85590266 ATGGAGGGATGGAGGGAGGTGGG - Intronic
976603761 4:86963423-86963445 CATGGGGGAGGGAAGGAACTGGG + Intronic
976626675 4:87191757-87191779 TATGGGGGAAGGAGGGAAGGCGG - Intronic
977539082 4:98293676-98293698 GCGGGGGCGTGGAGGGAAGTAGG - Intronic
977555910 4:98487151-98487173 AGGGGGGGATGGAGGGAAGGAGG + Intronic
977939226 4:102840580-102840602 GAGGGGGGATGAAGAGACGTTGG + Intronic
978314933 4:107425212-107425234 CAGGAGGGAGAGAGTGAAGTGGG + Intergenic
978706477 4:111718808-111718830 GAGGGGGGAGGGAGGGAGGGAGG + Intergenic
978728627 4:111999336-111999358 GAGGAGGGAAGGAGGGAAGGAGG + Intergenic
978855903 4:113394430-113394452 AAGGGGGGAAGGAAGGAAGGAGG - Intergenic
979346915 4:119598836-119598858 CTGGGGGGTTGGAAGGAAGATGG + Intronic
979538448 4:121851412-121851434 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
979698558 4:123640977-123640999 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
979698579 4:123641037-123641059 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
979865060 4:125744121-125744143 AGGGAGGGAGGGAGGGAAGTGGG + Intergenic
980078618 4:128320513-128320535 AAGGAGGGAGGGAGGGAAGCAGG - Intergenic
980140106 4:128905316-128905338 CAGTGGAGATGGAGAGAAGTGGG - Intronic
980505881 4:133720603-133720625 GAGGGAGGAAGGAAGGAAGTGGG + Intergenic
980807145 4:137828324-137828346 AAGTGGGGAAGGAGGGAAGGAGG + Intergenic
980888948 4:138793617-138793639 GATGGGGGAGGGAGGGAAGGAGG + Intergenic
981334198 4:143550573-143550595 CAGTGGGGGTGGGGGAAAGTGGG - Intronic
981538843 4:145827310-145827332 AGGGGGTGATGGAGGGGAGTAGG + Intronic
981658288 4:147137181-147137203 CAGTGGGGATGGAGAGAACTAGG - Intergenic
981674237 4:147322821-147322843 CAGGAGGGAGGGAGGGAAAGAGG + Intergenic
981729753 4:147885013-147885035 CAGTGGGGGTGGAGCCAAGTGGG + Intronic
981783857 4:148455879-148455901 AAGGAGGGATGGAGGGAGGGAGG - Intergenic
982129035 4:152210442-152210464 GAGGGAGGAAGGAGGGAAGGAGG + Intergenic
982209078 4:153020485-153020507 GAGTGGGGAAGGAGGGGAGTGGG - Intergenic
982220026 4:153116306-153116328 GAGGTGGGGTGGAGGGAAGTGGG - Intergenic
982294085 4:153808823-153808845 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
982294116 4:153808899-153808921 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
982294123 4:153808915-153808937 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
982294126 4:153808923-153808945 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
982294129 4:153808931-153808953 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
982529262 4:156517989-156518011 AAGGAGGGAGGGAGGGAAGCAGG + Intergenic
982643910 4:157998165-157998187 AAGGAGGGAGGGAGGGAAGGTGG - Intergenic
982721379 4:158863490-158863512 CAGGGAAGAGGGAGGGAAGCCGG + Intronic
982803992 4:159740334-159740356 CAGGGGAAAGGGTGGGAAGTGGG - Intergenic
982816489 4:159891937-159891959 AAGGGGGGAAGGAGGGAGGGAGG - Intergenic
982972050 4:162000879-162000901 AAGAAGGGATGGAGGGAAGAGGG + Intronic
983257014 4:165411322-165411344 GAAGAGGGATGGAGGGAAGAAGG - Intronic
983648118 4:170012219-170012241 CAGTGGGGAAGGAAAGAAGTTGG + Intronic
983991871 4:174129681-174129703 TAGTGGGAATGGAGAGAAGTGGG - Intergenic
984149406 4:176108028-176108050 TAGGGGAGAGGGAGGCAAGTGGG - Intronic
984224993 4:177023792-177023814 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985209825 4:187580871-187580893 GAGGAGGGAAGGAGGGAAGGAGG + Intergenic
985273381 4:188216106-188216128 AAGGGGGGAAGGAAGGAAGGAGG - Intergenic
985545986 5:509456-509478 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
985627661 5:998228-998250 GACGGGGGAGGGAGGGAAGAGGG + Intergenic
985648591 5:1096831-1096853 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
985805371 5:2039143-2039165 CTGGGGGGATGGAGGGGGGCTGG + Intergenic
985873940 5:2581098-2581120 CAGGAGGGAGGGAGGGAGGAAGG - Intergenic
986533931 5:8766845-8766867 GAGGGGAGATGGAGGGAAGAGGG + Intergenic
986831818 5:11588876-11588898 CAGGGAGGGAGGAGGGAGGTGGG - Intronic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
987960173 5:24796941-24796963 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
987960176 5:24796949-24796971 CAGGGGGGAAGGAGGGAAGGAGG - Intergenic
988481076 5:31631096-31631118 CACGAGGGAAGGAGGGAGGTGGG + Intergenic
988623636 5:32848437-32848459 AAGGGGGGAAGGAGGGAGGGAGG - Intergenic
988623640 5:32848445-32848467 AAGGGGGGAAGGGGGGAAGGAGG - Intergenic
988939886 5:36133357-36133379 TAGAGGGGAGGGTGGGAAGTGGG + Intronic
989380383 5:40804388-40804410 CATGGGGGATGGAGGGAACTTGG + Intergenic
989395425 5:40950840-40950862 CAGTGGAGATGGGGGGAAGGTGG + Intronic
990200430 5:53366705-53366727 CATGGGGAATGGAGGAAAATGGG + Intergenic
990437458 5:55807916-55807938 CAGGGAGAATGGAAGAAAGTTGG - Intronic
990543422 5:56797607-56797629 GAGGAGGGAGGGAGGGAAGGAGG + Intergenic
990768564 5:59216426-59216448 TAGTAGGGATGGAAGGAAGTGGG - Intronic
990816752 5:59794477-59794499 CAGGAGGGAGGGAGGGAAGGAGG - Intronic
990871763 5:60439718-60439740 CAGTGGAGATGGAGAGAGGTGGG - Intronic
990976801 5:61568006-61568028 AAGGGGGGAGGGAGGGAGGAAGG - Intergenic
991557369 5:67910804-67910826 CAGGGGGCATGGAGGGGAGGAGG - Intergenic
992077173 5:73202233-73202255 CAGGGCGGAGGGAGGGAGGGAGG + Intergenic
992166360 5:74055918-74055940 CATGGGGGAAGGAGGGGTGTAGG - Intergenic
992467036 5:77016162-77016184 CTGGGGTGATGGTGGGAAGGTGG + Intergenic
993089625 5:83409308-83409330 CAGGGAGAATGGAGCCAAGTTGG + Intergenic
993276366 5:85864842-85864864 TAGGGAGGGTGGAGAGAAGTGGG + Intergenic
993552419 5:89290180-89290202 CAGGGAGCATTGAGGAAAGTGGG + Intergenic
993852885 5:93033330-93033352 CTGGGGGGATGGAGGGGTGGAGG - Intergenic
993971341 5:94423178-94423200 CTGGGGGGTTGGAGGGATGAAGG + Intronic
994080730 5:95706385-95706407 CAGGAGGAAGGGAGGGAAGGGGG - Intergenic
994081613 5:95713458-95713480 CAGGAGGAAGGGAGGGAAGGGGG - Intergenic
994083678 5:95735182-95735204 CAAGGGGGCAGAAGGGAAGTGGG - Intronic
994198856 5:96949915-96949937 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
994596400 5:101843227-101843249 AAGGAGGAAAGGAGGGAAGTAGG + Intergenic
994730982 5:103490474-103490496 AAGGAGGGAAGGAGGGAGGTTGG - Intergenic
994731028 5:103490624-103490646 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
994918986 5:106017701-106017723 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
994951560 5:106470196-106470218 CAGGGAGGATGAACAGAAGTGGG + Intergenic
994994036 5:107036853-107036875 CTGGGGGGATGAAGAGAGGTGGG + Intergenic
995131767 5:108638079-108638101 TAGGGGGGAAGGAGGGAACATGG + Intergenic
995183095 5:109247039-109247061 CAGTGGGGATGGAGTAAACTGGG + Intergenic
995207446 5:109497433-109497455 CAAGAGGGATGGAGGGAAGAAGG + Intergenic
995324560 5:110875460-110875482 CAGGAAGGAAGGAGGGAAGGAGG - Intergenic
995390059 5:111630479-111630501 AAGGGGGGATGGAGAGAAAAAGG + Intergenic
995624000 5:114056761-114056783 AAGGGGGGAAGGATGGAAGACGG - Intergenic
996009488 5:118465885-118465907 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
996285328 5:121784287-121784309 CAGTGGAGATGGAGAGACGTGGG + Intergenic
996906028 5:128601403-128601425 GAGTGGGGCTGGGGGGAAGTGGG - Intronic
996906040 5:128601432-128601454 GAGTGGGGCTGGGGGGAAGTGGG - Intronic
997174514 5:131760855-131760877 CAGGAGGGAAAGAGGGAAGAAGG + Intronic
997291893 5:132742995-132743017 AAGGAGGGATGGAGGGAGGGAGG - Intergenic
997291905 5:132743031-132743053 AAGGAGGGATGGAGGGAGGGAGG - Intergenic
997297214 5:132776127-132776149 CAGGGCTGTTGGAGGGAAGGGGG - Intronic
997576331 5:134980381-134980403 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
997930583 5:138069489-138069511 GAGAGGGGATGCAGGGAAATGGG - Intergenic
998104066 5:139457208-139457230 CAGGTGGGGTGGAGAGTAGTGGG - Intronic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
998804058 5:145901146-145901168 GAGGGGGGAAGGAGGGAGGGGGG + Intergenic
998896374 5:146804447-146804469 TAGAGGGGATGGAGGGGAGAGGG - Intronic
998920540 5:147062996-147063018 GAGGGGGGAAGAAGGGAAGGGGG + Intronic
999054301 5:148557255-148557277 CTGGGGAGATGGAGAGAAGTGGG + Intronic
999357286 5:150947162-150947184 GAGGGGAGAAAGAGGGAAGTGGG + Intergenic
1000032515 5:157416482-157416504 GAGGGGGGATGAAGAGAGGTTGG + Intronic
1000428054 5:161115986-161116008 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1000676680 5:164130337-164130359 AAGGAGGGAGGGAGGGAAGAAGG - Intergenic
1000774789 5:165406309-165406331 GAGGGTGGAGGGAGGGAAGGGGG - Intergenic
1001183208 5:169540299-169540321 GAGGGAGGATGGCTGGAAGTGGG + Intergenic
1001320458 5:170676227-170676249 CAGGTGGGAGGGAGGGAGGAAGG + Intronic
1001388007 5:171355891-171355913 GAGGGGGGAGGGAGAGCAGTGGG - Intergenic
1001734622 5:173988660-173988682 CAGGGGAGATGGAGGGAAGTGGG - Intronic
1001774787 5:174320734-174320756 AAGGAGGGAGGGAGGGAAGAAGG - Intergenic
1001774832 5:174320864-174320886 AAGGAGGGAGGGAGGGAAGAAGG - Intergenic
1001831757 5:174794888-174794910 CAGGGGGGACGGGGGGGGGTGGG - Intergenic
1001915768 5:175558698-175558720 CAGGCTGGATGGAGTGCAGTGGG - Intergenic
1001919435 5:175588733-175588755 GAGGGAGGAGGGAAGGAAGTAGG + Intergenic
1002214497 5:177620359-177620381 CAGGGGGAAGGGTGGGAAGTGGG + Intergenic
1002255430 5:177954769-177954791 GAGGGGGGAGGGAGGGAGGAGGG + Intergenic
1002255434 5:177954780-177954802 GAGGGAGGAGGGAGGGAAGGAGG + Intergenic
1002281995 5:178136420-178136442 CAGAGGGGATGGTGGGGGGTGGG + Intronic
1002297860 5:178241357-178241379 CAGAGGGGATGTGGGGAAGAGGG + Intronic
1002377009 5:178796056-178796078 AAGGAGGGAGGGAGGGAAGTGGG + Intergenic
1002673700 5:180891243-180891265 CAGGGGGAATGGAACCAAGTTGG + Intergenic
1002782991 6:381014-381036 CAGGAGGGGTGGAGGGAAAGAGG + Intergenic
1002917637 6:1541974-1541996 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1002917649 6:1542002-1542024 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1002917656 6:1542018-1542040 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1002917705 6:1542162-1542184 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1003146565 6:3514958-3514980 CAGGGATGATGGAGGGGAATTGG + Intergenic
1003146847 6:3516751-3516773 CAGGGGAGATGATGGGGAGTGGG - Intergenic
1003173189 6:3736226-3736248 CAGGGGAGAAGGAGGGATGGAGG - Intronic
1003583760 6:7367152-7367174 GAAGGGGGATGGAGGGAAGAGGG - Intronic
1003709792 6:8576441-8576463 AAGGAGGGAGGGAGGGAGGTAGG - Intergenic
1003860669 6:10319389-10319411 CCGTGGGGATAGAGGGACGTGGG + Intergenic
1003860680 6:10319418-10319440 CCGTGGGGATGGAGGGATGTGGG + Intergenic
1003860690 6:10319449-10319471 CGGTGGGGATGGCGGGACGTGGG + Intergenic
1003860699 6:10319479-10319501 CCGTGGGGATGGCGGGACGTGGG + Intergenic
1003860708 6:10319509-10319531 CCGTGGGGATGGCGGGACGTGGG + Intergenic
1003860777 6:10319750-10319772 CCGTGGGGATGGAGGGACGTGGG + Intergenic
1003860787 6:10319780-10319802 CCGTGGGGATGGAGGGACGTGGG + Intergenic
1003872204 6:10412419-10412441 GAGAGGGGAGGGAGGGAAGGAGG + Intronic
1003874446 6:10423640-10423662 GAGGGGGGATGGAGGAAAGGGGG + Intergenic
1003972173 6:11310306-11310328 CAGTGGGCAGAGAGGGAAGTGGG - Intronic
1003983532 6:11412358-11412380 CAGGGGCAAAGGAGGGAAATGGG + Intergenic
1004126818 6:12882121-12882143 ACAGGGGGATGGAGGGAAGCAGG + Intronic
1004139286 6:13000638-13000660 AAGGGGGGAGGGAGGGAGGAAGG + Intronic
1004510050 6:16277884-16277906 CAGTGGGGAGGGAGGGGAGCAGG + Intronic
1005223992 6:23620167-23620189 GAGGGGGGAGGGAGGGAGGGAGG + Intergenic
1005598400 6:27401625-27401647 AAGGAGGGAAGGAGGGAAGAAGG - Exonic
1005602687 6:27443778-27443800 AAGTGGGGGTGGAGGGAGGTGGG - Intergenic
1005665107 6:28044452-28044474 AAGGGGGGAGGGAGGGAGGAAGG + Intergenic
1005821785 6:29604802-29604824 AAGGAGGGATGGAGGGAACATGG + Intronic
1006042445 6:31267612-31267634 CAGGTGGGCTTGAGGGGAGTGGG - Intergenic
1006052033 6:31352701-31352723 CAGGTGGGCTTGAGGGGAGTGGG - Intronic
1006093949 6:31644379-31644401 CAGGGGGCAGGGAGGGCAGCTGG + Intronic
1006308808 6:33242611-33242633 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1006477218 6:34264328-34264350 TAGGGGGAATGGAGAGATGTTGG - Intergenic
1006827744 6:36948630-36948652 GAGGGAGGAAGGAGGGAAGGAGG - Intronic
1006827753 6:36948653-36948675 GAGGGAGGAAGGAGGGAAGGAGG - Intronic
1006948383 6:37800837-37800859 CAGGGAGGATGGAGGGGTGACGG + Intergenic
1007345175 6:41223690-41223712 CAGGGGATTTGGAGGGCAGTGGG - Intergenic
1007407512 6:41643527-41643549 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1007741036 6:44009612-44009634 GAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1007755585 6:44097266-44097288 CTGGGGTGTTGGAGGGAACTTGG - Intergenic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1007958202 6:45935990-45936012 CAGGGAGGATGGAGGAAATCGGG - Intronic
1008323975 6:50154302-50154324 GAGGGTGGATGGAGGGAGGAGGG - Intergenic
1008327419 6:50200235-50200257 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
1008527274 6:52419626-52419648 AAGGAGGGACGGAGGGAAGGAGG + Intergenic
1009828887 6:68904044-68904066 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1009828890 6:68904052-68904074 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1009977723 6:70690852-70690874 CAGTGGGGAAGGGGGGAAGGGGG - Intronic
1010246604 6:73665368-73665390 AAGGGGGGATGAAGAGAAGTTGG + Intergenic
1010346001 6:74811345-74811367 GAGGGGGGAAGGAAGGAAGGGGG + Intergenic
1010615502 6:78007080-78007102 CGGGGAGAATGGAAGGAAGTTGG + Intergenic
1011238665 6:85246814-85246836 GAGGGGGAAGGGAGGGAAGGGGG - Intergenic
1011601442 6:89064090-89064112 AAGGAGGGAGGGAGGGAAGAAGG - Intergenic
1011632321 6:89339516-89339538 AGGGGGGAAGGGAGGGAAGTGGG + Intronic
1011641254 6:89418242-89418264 AAGGAGGGAGGGAGGGAGGTGGG + Intergenic
1012074394 6:94666410-94666432 CAGGGCGGGTGGGGAGAAGTTGG - Intergenic
1012872839 6:104692131-104692153 AAGGGGGGAGGGAGGAAAGGAGG + Intergenic
1012978452 6:105805023-105805045 CTTGGGGGATGGTGGGAGGTGGG + Intergenic
1013170080 6:107628961-107628983 AAAGGAGGATGGAGGGATGTGGG - Intronic
1013424442 6:109998258-109998280 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1014265334 6:119270515-119270537 AAGAGGGGTTGGAGGGAAATGGG - Intronic
1014877977 6:126684737-126684759 GAAGGGGGAGGGAGGGAAGAGGG + Intergenic
1015383906 6:132600774-132600796 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1015383953 6:132600922-132600944 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1015383962 6:132600954-132600976 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1015383983 6:132601014-132601036 AAGGGGGGAAGGAGGGAAGGAGG + Intergenic
1015395154 6:132725603-132725625 GAGGGGGGATGGTGGGAGGAGGG - Intronic
1015528052 6:134192583-134192605 GAGGGGGGATGGATGGAGGTGGG - Intronic
1015998510 6:139018837-139018859 CAGGAGGGAGGGAGGGAGGGAGG + Intergenic
1016575409 6:145564783-145564805 CAGGGGGTGTGGAGGGAGCTGGG + Intronic
1016840449 6:148519713-148519735 CTGGGGGGCTGGCCGGAAGTTGG + Exonic
1016981652 6:149860400-149860422 CAGGAGGGAGGGAGGGAGGGAGG - Intronic
1017043464 6:150325920-150325942 CAGGGGAGGTGGTGAGAAGTGGG + Intergenic
1017206486 6:151808409-151808431 CAGGAGGGAGGGAGGGAGGGAGG + Intronic
1017334063 6:153234485-153234507 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1017931905 6:158963391-158963413 GAGGGGGGAGGGAGGGAGGGAGG - Intergenic
1018271193 6:162079659-162079681 AGGTGGGGAAGGAGGGAAGTGGG - Intronic
1018826577 6:167412283-167412305 CAGGGAAGAAGGATGGAAGTAGG - Intergenic
1018857239 6:167683475-167683497 CACAGGGGATGGAGGGATGGGGG + Intergenic
1018869618 6:167770869-167770891 CTGTCTGGATGGAGGGAAGTGGG - Intergenic
1018953535 6:168393538-168393560 CAGAAGGGATGGGTGGAAGTGGG + Intergenic
1019273925 7:166148-166170 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1019273932 7:166164-166186 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1019273945 7:166196-166218 GAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1019285791 7:222306-222328 CAGTGAGGATGGAGGGACTTGGG + Intronic
1019335165 7:479226-479248 GAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1019335180 7:479268-479290 GAGGAGGGAAGGAGGGAAGAGGG + Intergenic
1019471879 7:1225367-1225389 CAGGGGAGAGGGAGGGAGGGAGG + Intergenic
1019481484 7:1268914-1268936 CAGGTGTCAGGGAGGGAAGTGGG - Intergenic
1019732231 7:2634560-2634582 GCGGGGGGATGGAGGGGAGGTGG + Intronic
1020095977 7:5369566-5369588 CAAGAGGGAAGGAGGGAAGGAGG + Intronic
1020224653 7:6271240-6271262 CAGCCAGGATGGTGGGAAGTTGG - Intronic
1020369604 7:7417519-7417541 GAGGGGGGAGGGAGGGAGGGAGG + Intronic
1020382820 7:7565670-7565692 GAGTGGGCATGGAGAGAAGTGGG - Intergenic
1020677502 7:11198673-11198695 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1020677505 7:11198681-11198703 AAGAGGGGAAGGAGGGAAGGAGG - Intergenic
1020722255 7:11761897-11761919 AAGGGGGGAAGGAGGGAGGCAGG - Intronic
1020877264 7:13713516-13713538 AAGGGGGAAGGGAGGGAAGGAGG + Intergenic
1021123147 7:16819717-16819739 GAGTGGGGAGGGAGGGAAGAGGG - Intronic
1021545464 7:21808515-21808537 GAGAGGGGATGCAGAGAAGTTGG - Intronic
1021627645 7:22610081-22610103 TAGTGGAGATGGAGAGAAGTTGG - Intronic
1021632279 7:22659211-22659233 TTGGGGGGGTGGGGGGAAGTGGG - Intergenic
1022109233 7:27218177-27218199 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1022638213 7:32157203-32157225 GAGGGGGGTTGAAGAGAAGTTGG - Intronic
1023270628 7:38458067-38458089 GCGGAGGGATGGAGGGAGGTGGG + Intronic
1023397401 7:39763873-39763895 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1023706491 7:42946745-42946767 CAGAGCTCATGGAGGGAAGTTGG + Intronic
1023765362 7:43505332-43505354 CAGTGGAGATGAAGTGAAGTGGG - Intronic
1023848151 7:44134829-44134851 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1023932087 7:44712253-44712275 CAGAGGTGTTGGAGGGAAATGGG + Intergenic
1024851384 7:53721242-53721264 CATGGGAGGTGGAGGGTAGTGGG + Intergenic
1024948262 7:54833466-54833488 CAGGTGGGATGGAGGGGGGTGGG + Intergenic
1025064112 7:55838509-55838531 GAGGGGGGAGGGAGGGAGGGAGG - Intronic
1025147062 7:56514241-56514263 AAGGAGGGACGGAGGGAAGGAGG - Intergenic
1025147068 7:56514257-56514279 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1025147075 7:56514273-56514295 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1026102716 7:67396188-67396210 CCTGGGGGAAGGAGGGAAGCTGG - Intergenic
1026112412 7:67469095-67469117 GAGGGGGGAGGGAGGGAGGGAGG - Intergenic
1026214451 7:68335809-68335831 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1026433614 7:70373150-70373172 CAGGGGGGAGTGGGGGAAGAAGG + Intronic
1026638641 7:72105784-72105806 GAGGGGGGAGGGAGGGAGGGAGG + Intronic
1026690294 7:72545124-72545146 GAGGGAGGAAGGAGGGAAGGAGG + Intergenic
1026871074 7:73852214-73852236 AAGGCGGGAAGGAGGGAAGCAGG - Intergenic
1026962820 7:74420026-74420048 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1026962827 7:74420042-74420064 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1027271291 7:76520548-76520570 CAGGGATGATGGAGAGAAATGGG - Intergenic
1027321055 7:77010483-77010505 CAGGGATGATGGAGAGAAATGGG - Intergenic
1027416879 7:77983400-77983422 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1027733577 7:81905214-81905236 CAGGAGGGAGGAAGGGAAGGAGG - Intergenic
1027899513 7:84092739-84092761 AAGGAGGCATGGAGGGAAGGAGG - Intronic
1028206524 7:88023820-88023842 CAGGAGGGTAGGGGGGAAGTGGG - Intronic
1028277270 7:88872599-88872621 CAGGGGGGAGGGATGGCATTGGG - Intronic
1028600301 7:92593512-92593534 GAGTGGGAAGGGAGGGAAGTGGG - Intergenic
1028636783 7:92997986-92998008 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1028659560 7:93253721-93253743 CAGGTGGCATGGAGGGCAGTGGG + Intronic
1028805884 7:95025670-95025692 CAGGGGGAATGGAACCAAGTCGG - Intronic
1029084946 7:98004068-98004090 AAGGGGGGAGGGAGGGAGGGAGG - Intergenic
1029088266 7:98028297-98028319 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1029142957 7:98424630-98424652 CAGGATGGAAGGATGGAAGTTGG + Intergenic
1029184478 7:98728769-98728791 AAGGAGGGAGGGAGGGAAGAAGG - Intergenic
1029196130 7:98806770-98806792 GAGGGGGGATGGAGTGAGGCTGG - Intergenic
1029252567 7:99247571-99247593 CTGGTGGGAGGGAGGGAAGATGG - Intergenic
1029438608 7:100575547-100575569 CAGGGGGCATGCAGGGCAGGGGG + Intronic
1029488462 7:100857269-100857291 CAGAGGGAATGGAGGGCAGGAGG + Intronic
1029574664 7:101395558-101395580 CAGCGGGGCTGGAGGGAAAATGG + Intronic
1029613011 7:101637310-101637332 CAGGGAGGATGGTGGACAGTAGG + Intergenic
1029793701 7:102871907-102871929 CTGGGGGCAGGGAGGGAAATAGG - Intronic
1029926946 7:104328545-104328567 CAGGAGGGAGGGAGGGGAGCCGG + Intergenic
1030114584 7:106053662-106053684 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1030380358 7:108803946-108803968 CAGGGGGGAGAGAGGGAAGCAGG - Intergenic
1030412848 7:109203510-109203532 CAGGGAGGAAGGAGGTAAGAAGG + Intergenic
1031809350 7:126346476-126346498 GAGGGGGGAGGGAGAGAATTAGG + Intergenic
1032169484 7:129572641-129572663 TAGTGGGGATGGAGAGATGTTGG + Intergenic
1032172587 7:129597729-129597751 TAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1032318650 7:130864771-130864793 CAGGGGGAATGAAGAGAAGTTGG + Intergenic
1032402450 7:131633279-131633301 CAGGTGGGAAGAAGGGAGGTTGG - Intergenic
1032526526 7:132581956-132581978 AAGGGGAGATGGAGGGAGGGAGG + Intronic
1032549598 7:132772010-132772032 CCGTGGGGATGGGGGGAACTTGG + Intergenic
1032630160 7:133642423-133642445 CAAAGGGGATGGAGGGAAATAGG - Intronic
1032653457 7:133903411-133903433 CAGCAGAGATGGAGGGAACTGGG + Intronic
1032738204 7:134712056-134712078 AGGGAGGGAGGGAGGGAAGTTGG + Intergenic
1033263674 7:139865868-139865890 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1033327611 7:140392474-140392496 CAGTGAGGATGGAGAGAAGAGGG - Intronic
1033422838 7:141218332-141218354 CAGTGGGGATGGAGGAAGGGAGG + Intronic
1033480581 7:141736341-141736363 GTGGGGGGCTGGAGGGAAGGTGG - Intergenic
1033769659 7:144535558-144535580 GAAGGGGGAGGGTGGGAAGTGGG - Intronic
1034204948 7:149307255-149307277 GAGGGTGGAGGGAGGGAAGAGGG + Intergenic
1034429385 7:151033673-151033695 TAGGGGGGCTCGAGGGAGGTGGG - Exonic
1034889756 7:154829462-154829484 GAGGGAGGAGGGAGGGAAGAAGG + Intronic
1034988152 7:155530420-155530442 CAGGGGTCATGGAGGGGAGAGGG - Intronic
1035314301 7:157988642-157988664 CAGGGGGGCTGGAGGGAACCGGG + Intronic
1035444689 7:158932282-158932304 CTTGGGGGATGGAGTGCAGTGGG + Intronic
1035785630 8:2258224-2258246 CAGGTGGGATGGTGGGGGGTGGG - Intergenic
1035807177 8:2463492-2463514 CAGGTGGGATGGTGGGGGGTGGG + Intergenic
1035992755 8:4510744-4510766 GAGGAGGGAAGGAGGGAAGAGGG - Intronic
1036495754 8:9268565-9268587 AAGGGGGGAAGGAGGGAAGGGGG + Intergenic
1036496614 8:9276025-9276047 AGGGAGGGAGGGAGGGAAGTAGG - Intergenic
1036623630 8:10446020-10446042 CTGGAAGGATGGAGGGAGGTGGG + Intergenic
1036663048 8:10720858-10720880 GAGGGGGGAAGGAGGGAGGAAGG - Intergenic
1036778269 8:11628456-11628478 CAGTAGGGATGCAGGGAAGGGGG + Intergenic
1036779319 8:11634735-11634757 CAGGTGGGGTGAAGGGAGGTGGG - Intergenic
1037260603 8:17002719-17002741 AAGGGAGGAGGGAGGGAAGGCGG + Intergenic
1037339803 8:17832242-17832264 CAGGAGGGATGGCGGGAGGAAGG + Intergenic
1037774405 8:21823398-21823420 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1037775788 8:21834803-21834825 CAGGAGGGAGGGAGGGAGGCAGG + Intergenic
1037902739 8:22697137-22697159 CAGGAGGGAGGAAGGGAAGGAGG - Intergenic
1037921322 8:22808189-22808211 GTGGGTGGATGGATGGAAGTTGG - Intronic
1038070593 8:24008521-24008543 TAGGGAGGTTGGAAGGAAGTAGG - Intergenic
1038256751 8:25957478-25957500 CAGTGGGGATGGGAGGCAGTGGG - Intronic
1038285610 8:26203881-26203903 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1038293663 8:26271663-26271685 CAGGGATGGAGGAGGGAAGTGGG + Intergenic
1038400431 8:27280303-27280325 CAGGGGGTGTGGGGAGAAGTGGG - Intergenic
1038675716 8:29621060-29621082 CAGGGTGGAGGGAGAGAGGTTGG + Intergenic
1038869562 8:31479601-31479623 CAGGAGTGATGAAGGGCAGTTGG - Intergenic
1038899856 8:31830362-31830384 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1038899859 8:31830370-31830392 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1039103747 8:33967925-33967947 CAGTGGGGATGGAGCCAAGATGG - Intergenic
1039170520 8:34739583-34739605 CAGGGAGAATGGAGCCAAGTTGG + Intergenic
1039375211 8:37026106-37026128 CAGGGAGGGTGGATTGAAGTAGG - Intergenic
1039400963 8:37268911-37268933 CAGGTGGGATGCAGGCAAGATGG + Intergenic
1039644189 8:39262616-39262638 AGGGAGGGATGGAGGGAAGGAGG - Intronic
1039774358 8:40720873-40720895 AAGGTGGGAGGGAGGGAAGGGGG + Intronic
1039801951 8:40965551-40965573 CAGGGAGGATGGAACCAAGTTGG + Intergenic
1039803547 8:40980434-40980456 CAGGAGGGAAGGAAGGAACTAGG - Intergenic
1040647905 8:49421015-49421037 CAGGTGGGAGGGAAAGAAGTAGG - Intergenic
1040962302 8:53047747-53047769 CAGGGAGGATGGAACCAAGTTGG - Intergenic
1040989987 8:53339190-53339212 CAGGGAGAATGGAGCCAAGTTGG + Intergenic
1041038239 8:53817680-53817702 CAGGGGGTAGGGATGGTAGTAGG + Intronic
1041444181 8:57931891-57931913 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1041802323 8:61813504-61813526 AAGGAGGGAAGGAGGGAAGAAGG - Intergenic
1042095118 8:65206976-65206998 CAGGGGGAAGGGTGGGAAGGGGG - Intergenic
1042230024 8:66545711-66545733 GAGGAGGGATGGAGGGAAGGAGG + Intergenic
1042893751 8:73642880-73642902 CAGTGTGGCTGGAGTGAAGTTGG + Intronic
1043037734 8:75218949-75218971 AAGGAAGGATGGAGGGAAGGAGG + Intergenic
1043037747 8:75218984-75219006 GAAGGGGGAAGGAGGGAAGGAGG + Intergenic
1043597605 8:81902998-81903020 AAGGGGGAATGGAGGGTAGAAGG + Intergenic
1043814212 8:84781693-84781715 CAGTGGGAATTGAGGGAGGTGGG + Intronic
1044009145 8:86970597-86970619 CAGGTGGGAGGGAGAGAAGAGGG - Intronic
1044091683 8:88010320-88010342 AAGGAAGGATGGAGGAAAGTTGG - Intergenic
1044094977 8:88052412-88052434 CAGTGGAGATGGAGCAAAGTGGG - Intronic
1044261422 8:90127836-90127858 GAGGTGAGATGTAGGGAAGTTGG + Intergenic
1044429824 8:92095670-92095692 CAGGAGGGAAGGAGGGATGGAGG + Intronic
1044443564 8:92247776-92247798 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1044624528 8:94223787-94223809 GAGGGGGGATGGAGGGAAAATGG + Intergenic
1044648987 8:94474889-94474911 GAGGGAGGAGGGAGGGAAGGCGG - Intronic
1044930257 8:97245291-97245313 CTGGGGGAATGAAGGGAAGGGGG - Intergenic
1045249628 8:100472686-100472708 CAGGGTGGATGGAGTTGAGTGGG - Intergenic
1045322199 8:101090801-101090823 CAGTGGGGATGGAGAGAATTGGG + Intergenic
1045370178 8:101515069-101515091 AAGGAGGGAGGGAGGGAGGTAGG - Intronic
1045412131 8:101929670-101929692 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1045487117 8:102640402-102640424 AAGGGAGGAAGGAGGGAAGGAGG + Intergenic
1045541879 8:103094425-103094447 GAGGGGGAAGGGAGGGAAGGTGG - Intergenic
1045544710 8:103118215-103118237 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1045648651 8:104323351-104323373 CAGGGGAGTTGGAGGTAAGAAGG - Intergenic
1045718315 8:105074893-105074915 CGGGAGGGAGGGAGGGAAGAAGG - Intronic
1045972592 8:108096040-108096062 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1046026028 8:108725084-108725106 CAGGGGAGATGGCTCGAAGTGGG - Intronic
1046164903 8:110419815-110419837 CAGGGAGGAAAGAGGGAAATTGG + Intergenic
1046605341 8:116365508-116365530 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
1046754674 8:117961121-117961143 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1046790761 8:118319333-118319355 CAGGGTGAAGGGAGAGAAGTGGG - Intronic
1046972379 8:120237207-120237229 CAGGGAGAATGGAACGAAGTTGG - Intronic
1047061838 8:121235732-121235754 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1047212980 8:122854545-122854567 CAGGGTGGAAGGAGGGAAAGAGG - Intronic
1047299814 8:123603874-123603896 GAGGGTGGAGGGTGGGAAGTGGG + Intergenic
1047939777 8:129818086-129818108 CAGGAGAGATGGAGAGATGTAGG - Intergenic
1047953667 8:129956816-129956838 CTGGGGGGAGGGAGGGAGGGAGG - Intronic
1048161859 8:132028596-132028618 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1048235582 8:132686658-132686680 CAGTGGTGATAGAGGGAAGTGGG + Intronic
1048294969 8:133207285-133207307 CAGGGGAGAAGCAGGGCAGTGGG + Intronic
1048453564 8:134555965-134555987 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1048453574 8:134555989-134556011 AAGGCGGGAGGGAGGGAAGGTGG + Intronic
1048505837 8:135020519-135020541 CAGGAGTGTTGGAGGGAAGTGGG - Intergenic
1048742556 8:137578237-137578259 AAGGAGGAATGGAGGGAAGGAGG - Intergenic
1049311787 8:141937403-141937425 GAGGAGGGAGGGAGGGAGGTGGG - Intergenic
1049356694 8:142192693-142192715 CAGGAGGGAGGGAAGGAAGAGGG + Intergenic
1049611506 8:143558249-143558271 CAGGCGGGCTGGCGGGAAGAGGG + Intronic
1049612599 8:143562376-143562398 CGGGTGGGAGGGAGGGAGGTGGG + Intronic
1049776476 8:144408184-144408206 TGGTGGGGATGGAGGGAGGTAGG - Intronic
1049854897 8:144855255-144855277 CAGGGGGAGAGGAGGGCAGTAGG + Intergenic
1050053483 9:1627345-1627367 GAAGAGGGAGGGAGGGAAGTAGG + Intergenic
1050091214 9:2017237-2017259 GGGGTGGGGTGGAGGGAAGTTGG + Intronic
1050218447 9:3357602-3357624 AAGGGAGGATGAAGAGAAGTTGG + Intronic
1050571125 9:6940046-6940068 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1050912200 9:11085601-11085623 AAGGGAGGAGGGAGGGAAGGAGG + Intergenic
1050947001 9:11536017-11536039 ATGGGGAGATGGAGAGAAGTTGG + Intergenic
1051355360 9:16235294-16235316 CAGCGGAGATGGTGGGAAGGGGG - Intronic
1051693354 9:19741285-19741307 AAGGGGAGCTAGAGGGAAGTGGG + Intronic
1051733678 9:20175229-20175251 CAGGGGGAAAGGTGGGAAGGCGG + Intergenic
1051752493 9:20357957-20357979 CAGGAGGGAGGGAGAAAAGTAGG - Intronic
1051989510 9:23135197-23135219 CAGGGAGGGTGTATGGAAGTTGG - Intergenic
1052335475 9:27315083-27315105 CAGAGGGGCTGGAGGGAAAGGGG + Intergenic
1052922381 9:33981820-33981842 AAGCGGGGAAGGAGGGAAGGGGG + Intronic
1053135895 9:35650139-35650161 AAAGGGGGAGGGAAGGAAGTGGG - Intronic
1053262776 9:36684746-36684768 CAGGGGGCAGGGTGGGAGGTAGG - Intergenic
1053337286 9:37286928-37286950 AAGGGGGGAGGGAGGGAGGGAGG - Intronic
1053337314 9:37286977-37286999 GAGGGGGGAGGGAGGGAGGGAGG - Intronic
1053375736 9:37604798-37604820 CAGGGAGAATGAAGGGAAGTGGG + Intronic
1055004374 9:71488794-71488816 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1055072053 9:72176402-72176424 CAAGGGTGAAGGAGGGAACTCGG + Intronic
1055595085 9:77857641-77857663 AAGGGGGGAAGGAGGGAAGGAGG + Intronic
1055996490 9:82165990-82166012 AAAAGGGGAGGGAGGGAAGTAGG + Intergenic
1056184141 9:84116334-84116356 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1056897012 9:90560322-90560344 CAGGGGAAAGGGTGGGAAGTGGG + Intergenic
1057024605 9:91725485-91725507 CATGGGGGTTGGAGGGAACCTGG - Intronic
1057230471 9:93318657-93318679 CATGGAGAAGGGAGGGAAGTGGG - Intronic
1057267602 9:93629639-93629661 CAGGGGGCAGGGAAGGAAGAGGG - Intronic
1057283933 9:93732689-93732711 CAGGGGGGAGGGAGAGAGGGAGG + Intergenic
1057469161 9:95342409-95342431 CTGGGGGGAAGGAGGTAACTAGG + Intergenic
1057546695 9:96024315-96024337 CAGAGTGAATGAAGGGAAGTAGG + Intergenic
1057674407 9:97127339-97127361 CCTGGGGGCAGGAGGGAAGTGGG + Intergenic
1057778798 9:98033430-98033452 GGGTGGGGCTGGAGGGAAGTGGG + Intergenic
1057931293 9:99195872-99195894 TAGAGGGGATTAAGGGAAGTAGG - Intergenic
1058935764 9:109767907-109767929 CAGGATGGAAGGAGGGAAGGTGG + Intronic
1059018190 9:110544900-110544922 TATGGGGGATGAAGAGAAGTTGG - Intronic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059340876 9:113597005-113597027 CAGGGGGCAGGGAGGCAGGTGGG - Exonic
1059669380 9:116478228-116478250 AAGGGGGGAGGGAGGGAGGGAGG + Intronic
1059701084 9:116775767-116775789 AAAGGGGGAAGGAGGGAAGGAGG + Intronic
1059901899 9:118936804-118936826 CAGGGTGGATGGTGGGAAGAGGG - Intergenic
1059929904 9:119250107-119250129 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1060601715 9:124882463-124882485 CAGGGGGAGTGCTGGGAAGTGGG + Intronic
1060735740 9:126065568-126065590 GAGGGGGGAAGGAGGGAGGGAGG - Intergenic
1060956829 9:127647589-127647611 CAGAGGAGATGGTGAGAAGTGGG - Intronic
1060999823 9:127896825-127896847 CTGGGGGGATGGGAGGACGTAGG - Intronic
1061255638 9:129453311-129453333 AATGGGGGATGGAGGGATGGAGG + Intergenic
1061255648 9:129453334-129453356 GATGGGGGATGGAGGGATGGAGG + Intergenic
1061255834 9:129453852-129453874 GATGGGGGATGGAGGGATGGAGG + Intergenic
1061295661 9:129675502-129675524 CATGGGGGAGGGAGGGTAGCAGG - Intronic
1061339221 9:129965794-129965816 GAGGGGGGAAGGAGGGAGGGAGG + Intronic
1061389006 9:130306976-130306998 GAGGGAGGAGGGAGGGAAGGAGG - Intronic
1061390618 9:130315344-130315366 GAGGGGAGAGGGAGGGGAGTGGG - Intronic
1061416084 9:130447594-130447616 AAGGAGGGCTGGAGGGCAGTGGG + Intronic
1061416545 9:130450372-130450394 CATGCAGGATGGAGGGAAGGAGG - Intronic
1061448418 9:130655277-130655299 CAGGTGGGAAGGAGTGAAGCGGG + Intergenic
1061664113 9:132150338-132150360 CAGGTGGGAAGGAGGGTAGAAGG + Intergenic
1061789678 9:133052386-133052408 CAGGGGGGAAGGAAGGATGGGGG - Intronic
1061802113 9:133118382-133118404 CAGGTGGGCTGGAGTGAAGAGGG - Intronic
1061942553 9:133891409-133891431 GAGGGGGGATGGAGGGGGGACGG + Intronic
1061947352 9:133916148-133916170 CAGGGAGAATGGAGGGAAGGAGG + Intronic
1062050541 9:134444501-134444523 GACGGGGGAAGGAGGGAAGGAGG - Intergenic
1062144068 9:134979123-134979145 GAGGGGGGAGGGAAGGAAGGAGG + Intergenic
1062144086 9:134979180-134979202 AAGGAGGGAGGCAGGGAAGTAGG + Intergenic
1062145667 9:134988437-134988459 GGGGGCAGATGGAGGGAAGTTGG - Intergenic
1062146862 9:134994417-134994439 GATGGGGGATGGTGGCAAGTGGG - Intergenic
1062204069 9:135326102-135326124 CTTGGGGGGTGGCGGGAAGTGGG + Intergenic
1062318198 9:135978380-135978402 CAGGGGGGATGGTGGGGGATGGG - Intergenic
1062326812 9:136016493-136016515 CAGGGAGCATGGAGGGCAGGCGG - Intronic
1062328235 9:136023031-136023053 CAGGAAGGAGGGAGGGAAGGAGG + Intronic
1062328242 9:136023050-136023072 GAGGGAGGAAGGAGGGAAGAGGG + Intronic
1062328251 9:136023072-136023094 GAGGGAGGAGGGAGGGAAGGAGG + Intronic
1062332544 9:136051024-136051046 CAGCGGGGAAGGAGGGAGGGAGG + Intronic
1062449155 9:136608299-136608321 GAAGGGGGAAGGAGGGAGGTAGG + Intergenic
1062449206 9:136608444-136608466 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1062449214 9:136608463-136608485 GAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1062722450 9:138051472-138051494 AAGGGGAGAGGGAGGGAAGGAGG - Intronic
1202802111 9_KI270720v1_random:9561-9583 AAGGAGGGAAGGAAGGAAGTAGG - Intergenic
1185549218 X:970008-970030 GAGGGAGGATGGATGGAAGGAGG + Intergenic
1185627588 X:1493382-1493404 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1185680008 X:1880799-1880821 GAGGGGGTAGGGAGGGAAGGAGG + Intergenic
1185680027 X:1880946-1880968 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1185680082 X:1881291-1881313 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1185918913 X:4067242-4067264 GAGGGGGGAGGGAGGGAGGGAGG - Intergenic
1186022429 X:5271384-5271406 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1186079293 X:5912897-5912919 CAGGAGGGAGGGAGGGAAGGAGG + Intronic
1186079300 X:5912913-5912935 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1186079307 X:5912929-5912951 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1186079314 X:5912945-5912967 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1186137003 X:6532715-6532737 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186267282 X:7844583-7844605 ATGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186297707 X:8169068-8169090 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186325152 X:8467403-8467425 GTGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186376413 X:9006799-9006821 GAGGTGGGATGGAGGGAAGTGGG - Intergenic
1186406994 X:9313050-9313072 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1186490769 X:9970437-9970459 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1186490772 X:9970445-9970467 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1186490815 X:9970586-9970608 AAGAAGGGAGGGAGGGAAGTAGG - Intergenic
1186614292 X:11170575-11170597 GATGGGGGATGCAAGGAAGTAGG + Intronic
1186672348 X:11780550-11780572 CAGAGGGGAAGGAAGGAAGGAGG - Intergenic
1186927139 X:14346612-14346634 GAGGGAGGATGTAGAGAAGTTGG - Intergenic
1187039669 X:15580299-15580321 CAGAGGGGAATGAGGGAAGCAGG - Intronic
1187126367 X:16457757-16457779 GAGGGGGGAGGGAGGGATGGAGG + Intergenic
1187447646 X:19373058-19373080 CAGGGAGGAGGGAGGGAGGGAGG + Intronic
1187464997 X:19519207-19519229 CAGTGGGGCTGGGGGGAGGTAGG - Intergenic
1187695350 X:21913718-21913740 GAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1187715888 X:22102201-22102223 CAGAGGGGAAGGAGGGAAGGAGG - Intronic
1187972886 X:24676331-24676353 GAGGGAGGATGAAGAGAAGTGGG + Intergenic
1188415476 X:29927887-29927909 CAGGAGGGAGGGAGGGAGGGAGG + Intronic
1188463522 X:30453522-30453544 AAGGGGGAATGGAGGGTAGAAGG + Intergenic
1188580592 X:31707468-31707490 GAGGGAGGAGGGAGGGGAGTGGG + Intronic
1188697722 X:33216445-33216467 GAGGGGGAATGGAGGGAAGCGGG + Intronic
1188738262 X:33744561-33744583 CAGGGTGGAGGGTGGGAAGAGGG + Intergenic
1189214516 X:39311640-39311662 GGTGGGGGATGGAGAGAAGTGGG - Intergenic
1189338681 X:40187487-40187509 CAGAGTGGATGGAGGGAAATGGG + Intergenic
1189675505 X:43456877-43456899 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1189809521 X:44768344-44768366 CCTAGAGGATGGAGGGAAGTGGG + Intergenic
1189913466 X:45834785-45834807 GTGGGGGGTTGGAGGAAAGTGGG + Intergenic
1190055040 X:47176350-47176372 GAGAGCGGATGGAGGGAAGAAGG - Intronic
1190952317 X:55158402-55158424 AAGGGGGGATGAAAAGAAGTTGG + Intronic
1191046242 X:56140602-56140624 GAGGGTGGATGGTGGGAAGAGGG + Intergenic
1191059507 X:56279694-56279716 CAGTGGAGATGGAGAGAAGGAGG + Intronic
1191073016 X:56421765-56421787 CTGGGGGGATGGAGCCAAGATGG - Intergenic
1191870715 X:65742724-65742746 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1191975674 X:66868678-66868700 TAGGAGGGAGGGAGGAAAGTGGG - Intergenic
1192844177 X:74888150-74888172 CAGGGGGGAAGGATAGCAGTAGG + Intronic
1192938825 X:75891639-75891661 CAGGGGGAATGAAGAGATGTTGG + Intergenic
1193034624 X:76935771-76935793 CAGGGAGGATGGAACCAAGTTGG + Intergenic
1193374374 X:80741040-80741062 GAGGGGGGATGGATAGCAGTAGG - Intronic
1193452275 X:81685468-81685490 CAGGGAGGATGGAACAAAGTTGG + Intergenic
1193644263 X:84047597-84047619 CAGTGGGCTTGGAGGGGAGTGGG - Intergenic
1193716226 X:84937409-84937431 AAGGGGAGATGGAGGGATGAAGG + Intergenic
1193782602 X:85722205-85722227 CGGGGGGGATGAAGAGAGGTTGG - Intergenic
1193824416 X:86205465-86205487 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1193824419 X:86205473-86205495 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1194202971 X:90977723-90977745 CAGGGAGAATGGAAGCAAGTTGG - Intergenic
1194203697 X:90985049-90985071 CAGGGAGAATGGAAGCAAGTTGG + Intergenic
1194982545 X:100454999-100455021 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1194982555 X:100455031-100455053 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1194982575 X:100455087-100455109 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1195073841 X:101307050-101307072 CAAGGGGGATGGGGAGAGGTTGG + Intergenic
1195408561 X:104544056-104544078 CAGTGGAGATGGAGAGAAGTAGG - Intergenic
1195428951 X:104766415-104766437 GAGGGAGGAAGGAGGGAAGGAGG - Intronic
1195549461 X:106150616-106150638 AAGGGGGGAGGGAGGGAGGAAGG + Intergenic
1195892733 X:109713057-109713079 AAGGAGGGATGAAGGGAAGAAGG + Intronic
1195934620 X:110113023-110113045 CAGAGGGGAGGGAGGGAGGAAGG - Intronic
1195966665 X:110435162-110435184 AAGGGAGGAAGGAGGGAAGGAGG + Intronic
1196132912 X:112176806-112176828 GAAGGGGGATGAAGAGAAGTTGG - Intergenic
1196328105 X:114433045-114433067 AAGGCGGGAGGGAGGGAAGGAGG - Intergenic
1196575601 X:117314801-117314823 GAGGGGGGAGGGTGGGAGGTGGG - Intergenic
1196650077 X:118159352-118159374 GAGGGGGGGGGGAGGGAAGGAGG + Intergenic
1196883191 X:120219017-120219039 GAGGGAGGATGAAGAGAAGTTGG + Intergenic
1197087053 X:122491107-122491129 CAGGGAGAAGGGTGGGAAGTGGG - Intergenic
1197207371 X:123801586-123801608 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1197207413 X:123801696-123801718 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1197446933 X:126562228-126562250 CAGGGGTTAAGGAGGGGAGTGGG + Intergenic
1197693149 X:129523536-129523558 TAGGGTGGGTGGACGGAAGTGGG - Intergenic
1197783622 X:130179545-130179567 CAGGAGGAATGGAGGTCAGTAGG - Intronic
1198019484 X:132644213-132644235 AAGGGGGGAGGGAGGGAAGGAGG + Intronic
1198134673 X:133736718-133736740 CAGGGGAGATGGAGAGTAATAGG + Intronic
1198210935 X:134515431-134515453 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1198473316 X:136970907-136970929 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1198592548 X:138199817-138199839 CAGGGGGAATGGAACCAAGTTGG + Intergenic
1199011981 X:142769059-142769081 CAGGGAGAATGGAAGCAAGTTGG - Intergenic
1199046580 X:143181255-143181277 AAGGAGGGAAGGAGGGAAGAAGG + Intergenic
1199264872 X:145818178-145818200 CAGTGGGGATTGAGGGTAGAGGG - Exonic
1199282103 X:146013988-146014010 GAGGAGGGAGGGAGGGAAATGGG + Intergenic
1199536873 X:148912460-148912482 CAGGGTGGAGGGTGGGAAGAGGG + Intronic
1199706604 X:150431558-150431580 GAGGGTGGACGGAGGGAAGAGGG - Intronic
1200413990 Y:2889336-2889358 AAGGAGGGACGGAGGGAAGAAGG - Intronic
1200548807 Y:4553149-4553171 CAGGGAGAATGGAAGCAAGTTGG - Intergenic
1200549531 Y:4560496-4560518 CAGGGAGAATGGAAGCAAGTTGG + Intergenic
1201256467 Y:12112694-12112716 GAAGGGGGAGGGAGGGAAGGAGG - Intergenic
1201438392 Y:13984811-13984833 GTGCGGGGAGGGAGGGAAGTGGG - Intergenic
1201446181 Y:14057897-14057919 GTGCGGGGAGGGAGGGAAGTGGG + Intergenic
1201524699 Y:14919411-14919433 AAGGGGGGAAGGAAGGAAGGAGG + Intergenic
1201561347 Y:15320903-15320925 CAGGGAGAATGGAGCCAAGTTGG - Intergenic
1201652285 Y:16302751-16302773 AAGGAGGGAAGGAGGGAGGTTGG + Intergenic
1201949491 Y:19548486-19548508 GAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1202193758 Y:22273888-22273910 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic