ID: 929887182

View in Genome Browser
Species Human (GRCh38)
Location 2:45889302-45889324
Sequence TCTCTAGGGCTTTGCTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 189}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929887182_929887186 8 Left 929887182 2:45889302-45889324 CCAGGACAGCAAAGCCCTAGAGA 0: 1
1: 0
2: 1
3: 17
4: 189
Right 929887186 2:45889333-45889355 AGAACTGCACCAGGCATAAATGG 0: 1
1: 0
2: 0
3: 16
4: 149
929887182_929887185 -1 Left 929887182 2:45889302-45889324 CCAGGACAGCAAAGCCCTAGAGA 0: 1
1: 0
2: 1
3: 17
4: 189
Right 929887185 2:45889324-45889346 ACAGTGATGAGAACTGCACCAGG 0: 1
1: 0
2: 1
3: 43
4: 346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929887182 Original CRISPR TCTCTAGGGCTTTGCTGTCC TGG (reversed) Intronic