ID: 929887781

View in Genome Browser
Species Human (GRCh38)
Location 2:45893895-45893917
Sequence AGAGCCCCAGCCTCTCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 437
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 398}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929887781_929887785 8 Left 929887781 2:45893895-45893917 CCTCCTGGAGAGGCTGGGGCTCT 0: 1
1: 0
2: 2
3: 36
4: 398
Right 929887785 2:45893926-45893948 AATCCTAGCCTCTCTGTTTCCGG 0: 1
1: 0
2: 3
3: 12
4: 188
929887781_929887786 9 Left 929887781 2:45893895-45893917 CCTCCTGGAGAGGCTGGGGCTCT 0: 1
1: 0
2: 2
3: 36
4: 398
Right 929887786 2:45893927-45893949 ATCCTAGCCTCTCTGTTTCCGGG 0: 1
1: 0
2: 1
3: 22
4: 250
929887781_929887788 14 Left 929887781 2:45893895-45893917 CCTCCTGGAGAGGCTGGGGCTCT 0: 1
1: 0
2: 2
3: 36
4: 398
Right 929887788 2:45893932-45893954 AGCCTCTCTGTTTCCGGGCAAGG 0: 1
1: 0
2: 1
3: 14
4: 154
929887781_929887792 29 Left 929887781 2:45893895-45893917 CCTCCTGGAGAGGCTGGGGCTCT 0: 1
1: 0
2: 2
3: 36
4: 398
Right 929887792 2:45893947-45893969 GGGCAAGGGACTTCTAACTTAGG 0: 1
1: 0
2: 1
3: 7
4: 89
929887781_929887789 15 Left 929887781 2:45893895-45893917 CCTCCTGGAGAGGCTGGGGCTCT 0: 1
1: 0
2: 2
3: 36
4: 398
Right 929887789 2:45893933-45893955 GCCTCTCTGTTTCCGGGCAAGGG 0: 1
1: 0
2: 0
3: 12
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929887781 Original CRISPR AGAGCCCCAGCCTCTCCAGG AGG (reversed) Intronic
900287236 1:1907526-1907548 GCAGGCCCAGCCTCCCCAGGAGG - Intergenic
900554337 1:3272288-3272310 AGAGCCCCTACCTCTCTAGATGG - Intronic
900721484 1:4178747-4178769 AGGGCCCAAGGCTCCCCAGGAGG - Intergenic
900975444 1:6013493-6013515 ACAGCACCAGCCTCCCCACGTGG + Intronic
901236231 1:7669093-7669115 AGTGGCCCAGCCTCTCTGGGTGG - Intronic
901442292 1:9285722-9285744 ACAGCCCCCGCCTCTTGAGGTGG - Intergenic
902288190 1:15419961-15419983 AAAGCCCCAGCATCTCTGGGAGG - Intronic
902394756 1:16126499-16126521 GGAGCACCAGCCTCTGCGGGAGG - Intronic
902704624 1:18196075-18196097 GAAGCCCCAGCCTCTTCATGTGG - Intronic
903035565 1:20490472-20490494 AGAGGCCCTGCCTTTCAAGGAGG - Intergenic
904528709 1:31154735-31154757 GGAACCACAGGCTCTCCAGGTGG + Intergenic
904834496 1:33326238-33326260 AAATGCCCAGCCTCTCCAGATGG + Intronic
904905658 1:33895619-33895641 AGTCCCCCTGCCTCTCCAGAGGG - Intronic
905280588 1:36846579-36846601 ACAGCCCCAGCCTGTCTGGGAGG - Intronic
905412267 1:37778823-37778845 AGAGCACCAGCTCCTCCAGGAGG + Intergenic
907473780 1:54691991-54692013 AGAGCCCCAGTCTCGTCAGTTGG + Intronic
908791413 1:67786396-67786418 AGAGCCCCATCCTCTCTATCTGG - Intronic
908920610 1:69186668-69186690 CCAGCCCCTCCCTCTCCAGGAGG - Intergenic
910755797 1:90689177-90689199 CCAGCCCCAGCCTCTCCACTGGG - Intergenic
910756825 1:90702866-90702888 AGAGCCCCAGCTACTCGGGGGGG + Intergenic
916263007 1:162861250-162861272 AGAGCTCTGGCCTCTCCAGCAGG - Intronic
916853493 1:168727070-168727092 AGGTCCCCACCCTCTCCAGGAGG + Intronic
919806139 1:201382024-201382046 AGAGCCCCTCCCTCTTCAGCTGG - Intronic
922874459 1:228929057-228929079 AGAGCCCCAGCCTCTAGCAGTGG + Intergenic
924827587 1:247557104-247557126 TGAGGGCCAGCATCTCCAGGAGG - Intronic
1062977541 10:1696636-1696658 GGAGGCACAGCCTGTCCAGGTGG - Intronic
1063401665 10:5752161-5752183 AGAGCCCCAACATGTGCAGGTGG + Intronic
1063450716 10:6148232-6148254 AGTGCCACACCCTCTCCATGCGG - Intronic
1065919537 10:30380145-30380167 AGTGGCCCAGCAGCTCCAGGCGG - Intergenic
1066421140 10:35265898-35265920 TGACCCACAGCCTCTCCCGGTGG - Intronic
1066551628 10:36564918-36564940 AGAGCGCCAGCCTCTCTCAGAGG - Intergenic
1067938236 10:50629643-50629665 AGAGGCCCAGACACTCCAAGAGG + Intergenic
1069872961 10:71544397-71544419 TCACCCCCAGCCTCACCAGGGGG + Intronic
1070488456 10:76953129-76953151 TGAGCCCCAGCCTCCCCAAGGGG + Intronic
1070627477 10:78061604-78061626 AGAGCCCCAGCTTCTCTCAGAGG - Intergenic
1071525301 10:86354828-86354850 AGAGCCCCAGCCTATACAGATGG + Intronic
1072282530 10:93880682-93880704 AGAGCCCCAGCATCTAGAAGTGG + Intergenic
1073481883 10:103791201-103791223 GCACCCCCAGCCTCTCCATGGGG - Intronic
1074942132 10:118246203-118246225 AGAGCCTCAGTCACCCCAGGTGG - Intergenic
1075095371 10:119467708-119467730 AGACCAGCAGCCTCTCCTGGGGG + Intergenic
1076148129 10:128141411-128141433 ACAGCCTCAGCCTCCCCAGTAGG + Intergenic
1076462988 10:130659051-130659073 AGGCCCCCAGCCCCTCCAGATGG - Intergenic
1076636722 10:131885943-131885965 CCAGCCCCAGCCTGGCCAGGAGG + Intergenic
1077141950 11:1028622-1028644 TGAGTCCCTGCCTCTCCAGGTGG - Intronic
1077156084 11:1092317-1092339 AGACCCCCAGCTTCCCCATGTGG - Intergenic
1077262426 11:1629917-1629939 AGAGCCACAGCCTCCACAGCCGG - Exonic
1077298980 11:1838554-1838576 ACAGCCACAGCCTCTCCCTGCGG - Intergenic
1077442933 11:2577125-2577147 GGAGACCCAGCCTCACCAGGAGG - Intronic
1077677010 11:4204222-4204244 AGAGCCCCACCTCCTCAAGGAGG + Intergenic
1078771715 11:14358440-14358462 GGTGGCCCAGCCTCTCCCGGAGG + Intronic
1080655258 11:34253104-34253126 GAAGCCCCAGCTCCTCCAGGTGG + Intronic
1081522805 11:43899162-43899184 AGGGGCCCCACCTCTCCAGGTGG + Intronic
1081938719 11:46922521-46922543 TGTGCCTCAGCCTCTCCAGTAGG + Intergenic
1082187522 11:49202807-49202829 GGAGCTCCAGCCTCCCCAGTAGG - Intronic
1082818445 11:57526610-57526632 AGAGCCTCAGCTTCTTCAGCTGG + Intergenic
1083584632 11:63847812-63847834 AGACCCTCAGCCTAGCCAGGAGG + Intronic
1083688383 11:64391426-64391448 AGAGCCCCAGGCTCCACAGGTGG - Intergenic
1083777370 11:64900777-64900799 TGAGCCCCATCCACCCCAGGTGG - Intronic
1084724561 11:70932689-70932711 AGAGCCCCTGCCCCGCCAGGTGG - Intronic
1085391625 11:76185121-76185143 TCTGCCCCAGCCCCTCCAGGTGG + Intergenic
1086044281 11:82514242-82514264 ATAGTCCCAGCTACTCCAGGAGG + Intergenic
1086678806 11:89642619-89642641 GGAGCTCCAGCCTCTCCAGTAGG + Intergenic
1088971744 11:114780192-114780214 AGAGGCCGAGTCTCTTCAGGAGG + Intergenic
1089198246 11:116707810-116707832 TGAGCCCCAGTCTCTCCACGTGG - Intergenic
1089295408 11:117464391-117464413 AAGGGCCCAGTCTCTCCAGGAGG - Intronic
1089324366 11:117647261-117647283 AGATGCCCAGCCTTTCCTGGGGG - Intronic
1089527159 11:119104830-119104852 ACAGCCCCAGACTATCCAGAGGG - Intronic
1089560330 11:119340308-119340330 AGATCCCCAGCCTCTGCCCGGGG - Exonic
1089692262 11:120194181-120194203 AGAGCCCCAGAGTCCCCATGGGG - Intergenic
1091016047 11:132051659-132051681 AGAGCCCCCTCCTCCCCAGGAGG + Intronic
1100240554 12:92706837-92706859 AGCTCCCCAGCTTCCCCAGGTGG - Exonic
1102679725 12:114683191-114683213 AGAGGCTCATCCACTCCAGGCGG + Exonic
1103634020 12:122287519-122287541 AGAACCACAGCCTGTCCAGTGGG - Intronic
1103761223 12:123251595-123251617 AGACCTTCAGCCTCTCCAGTGGG + Intronic
1103931374 12:124452819-124452841 ACAGCCCCTGCTTCTCAAGGCGG + Intronic
1104679980 12:130743350-130743372 AGAATCCCAGCCCCTCCAGCAGG - Intergenic
1104859436 12:131916823-131916845 GGAGCGCCTGCCTCTCGAGGTGG + Intronic
1105259138 13:18766006-18766028 AGAGCCTCTGCCTCTGCAGCAGG - Intergenic
1105261814 13:18785325-18785347 AGAGCCTCTGCCTCTGCAGCAGG - Intergenic
1105264171 13:18801914-18801936 AGAGCCTCTGCCTCTGCAGCAGG - Intergenic
1105821361 13:24083870-24083892 AGAGCACCTGCATCTCCAGACGG - Intronic
1106365539 13:29075842-29075864 AAAGTCCAAGCCTCTCCAGATGG - Intronic
1106466686 13:30019969-30019991 GCACCCCCAGCCTTTCCAGGGGG + Intergenic
1106885435 13:34179603-34179625 AAAGCATCAGTCTCTCCAGGGGG + Intergenic
1108521590 13:51251535-51251557 GGAGTCCCAGCCCCTGCAGGAGG + Exonic
1109123442 13:58487477-58487499 AGAACCACAGCCATTCCAGGAGG - Intergenic
1110440244 13:75518854-75518876 ACAGCCCCAGCCTCCCCAACGGG + Intergenic
1110595476 13:77316654-77316676 ACAGCCCCAGCCACTACAGACGG + Intronic
1112200215 13:97267528-97267550 AGTGCCCCATCCTCTCCAGAAGG - Intronic
1113855699 13:113444327-113444349 TAACCCCCAGCATCTCCAGGTGG - Intronic
1113935837 13:113995274-113995296 AGAGCGCTGGCCTCTCCTGGGGG + Intronic
1114476468 14:22998644-22998666 AGAGGCCCAGGCTCCTCAGGTGG + Exonic
1114524606 14:23359918-23359940 GGAGCATCATCCTCTCCAGGGGG + Exonic
1114616195 14:24069569-24069591 ACAGCCTCCGTCTCTCCAGGTGG - Exonic
1115089037 14:29551680-29551702 AGAGTCCCAGAGACTCCAGGAGG + Intergenic
1118395653 14:65334314-65334336 AGGGCCCCACTCTCTCCAAGTGG + Intergenic
1118945879 14:70387041-70387063 GGAGCCCTATCCTCTCCAGATGG - Intronic
1119212197 14:72840449-72840471 ACAGCCCCTGCCTTTCCAGGCGG + Intronic
1119765048 14:77182592-77182614 AGGGCCCCTGCCCCTCCAGAGGG - Intronic
1121115126 14:91338064-91338086 CCAGCTCCAGCCTCTCCACGCGG + Exonic
1121622832 14:95362015-95362037 AGTGCCCCAGTGCCTCCAGGAGG - Intergenic
1122722561 14:103730441-103730463 TGAGCCTCAGGCTCCCCAGGAGG - Intronic
1122855378 14:104557452-104557474 GGACCCCCAGCCAATCCAGGTGG + Intronic
1202834282 14_GL000009v2_random:66127-66149 AGAGCCTCTGCCTCTGCAGCAGG + Intergenic
1123632742 15:22273300-22273322 AGAGCCCCAGACTCTGCGGCTGG + Intergenic
1125499154 15:40227553-40227575 AGAGTCCCAGCGAGTCCAGGGGG + Intergenic
1125606787 15:40943984-40944006 AAACCCCAAGCCTCACCAGGAGG - Intergenic
1125721880 15:41849178-41849200 AGGGCTTCAGGCTCTCCAGGGGG - Intronic
1126496355 15:49294866-49294888 AGATTACCAGCCTTTCCAGGTGG + Intronic
1129810192 15:78504254-78504276 ATAGTCCCAGCTACTCCAGGAGG - Intergenic
1129893221 15:79085682-79085704 AGAGTCCCAGGCTCTTCAGGAGG + Intronic
1129946445 15:79542928-79542950 ACAGCCCCAGCCTCAGCAGTTGG - Intergenic
1130987466 15:88854240-88854262 TGAGCCCCAGCATCACAAGGAGG + Intronic
1131151811 15:90052000-90052022 ACAGCCCCTTCCTCTGCAGGTGG - Intronic
1132327129 15:100981243-100981265 AAAGCCCCATCCTCTAGAGGTGG - Intronic
1132339443 15:101068751-101068773 GGCGCCCCAGCCCCTCCAGACGG - Exonic
1132342137 15:101085495-101085517 AGAGCCCCAGCCTGGCCAGTGGG + Intergenic
1132516598 16:368872-368894 AGAGCGACAGCCTCTCCTGAAGG + Intronic
1132688399 16:1171722-1171744 AGAGCTCCAGGGACTCCAGGAGG - Intronic
1132709564 16:1260329-1260351 AGAGGCCCAGCCTCCGCATGGGG - Intergenic
1132896601 16:2232253-2232275 CGAGCCCCAGCCCCTGCTGGCGG - Exonic
1133896247 16:9932121-9932143 AGAGGCCCAGCCTCCCAAGTTGG - Intronic
1133965552 16:10528923-10528945 AGAGCGCCAGCCTGTTCATGAGG + Exonic
1134677522 16:16101141-16101163 AGAGCCTCAGCCTCCCGAGTAGG + Intronic
1134734692 16:16490461-16490483 AGAGCCCCACCCCCTCCACAAGG - Intergenic
1135133696 16:19872527-19872549 AGAGGCCCAGGGTCCCCAGGAGG + Exonic
1135989451 16:27208845-27208867 AGAGCCCCAGCCTGCCAGGGTGG - Intronic
1136169385 16:28479080-28479102 TGTGCCCCAGTCTCTCAAGGAGG + Intronic
1136909773 16:34135744-34135766 AGAACACCAGGCTCTGCAGGAGG - Intergenic
1137057769 16:35753650-35753672 AAGCCCCCAGTCTCTCCAGGTGG - Intergenic
1137569058 16:49552857-49552879 AGGGCCCCCACCCCTCCAGGAGG + Intronic
1137686568 16:50390755-50390777 AGGGGCCCAGCCTCACCTGGCGG - Intergenic
1137719923 16:50621919-50621941 CCAGCCCCAGCCCCTCCATGCGG + Intronic
1138557220 16:57778775-57778797 CGAGTCCCAGCTACTCCAGGAGG + Intronic
1139510451 16:67425264-67425286 ACAGCCACAGCTTCCCCAGGGGG + Intergenic
1139650570 16:68360114-68360136 AGAGCCGCAGCCCCACCCGGGGG + Exonic
1139654184 16:68377367-68377389 ACAGCCCCAGCCGCTCCTGGTGG + Intronic
1140196346 16:72858812-72858834 AGAGCCCCAGGCCCTGCAGCGGG + Intronic
1141477550 16:84283960-84283982 AGAGGCCCAGCCCCTGCAGCTGG + Intergenic
1141896930 16:86964277-86964299 ATCGCCCCATTCTCTCCAGGTGG + Intergenic
1141970322 16:87477466-87477488 AGAGCCCCAGACTCTGCGGCTGG - Intronic
1142220756 16:88853841-88853863 AGAGCCCCCACCTGTCCAGGGGG - Intronic
1142235134 16:88918476-88918498 GGAGCCCCACCCTGTCCAGGAGG - Intronic
1142342616 16:89533609-89533631 AGCGTCACACCCTCTCCAGGGGG - Intronic
1142390731 16:89798067-89798089 TGAAGCCCAGCCTCTCAAGGTGG + Intronic
1143566125 17:7721875-7721897 TGAGCCCCAACTTCTCCATGTGG + Intronic
1143582150 17:7833912-7833934 TAAGCCACAGCCTCTTCAGGCGG - Intergenic
1143610691 17:8016029-8016051 AGGGCCCCAACCCCTCCCGGAGG + Intronic
1144713206 17:17416508-17416530 AGAGCCACAGCCAATCCAGCAGG - Intergenic
1145294275 17:21575536-21575558 AGGGTCCCAGTATCTCCAGGGGG - Intergenic
1145369552 17:22297650-22297672 AGGGTCCCAGTATCTCCAGGGGG + Intergenic
1146496648 17:33328569-33328591 AGAGACACAACCTCTTCAGGGGG + Intronic
1146518882 17:33510897-33510919 AGAGACCCAGCTCCTCCTGGGGG + Intronic
1148469514 17:47884553-47884575 CGAGCCCCACTTTCTCCAGGGGG - Intergenic
1148839117 17:50483467-50483489 ACAGCTCCAGCCTGCCCAGGGGG - Exonic
1149982599 17:61323234-61323256 AGAGCCCAAACTTCCCCAGGGGG + Intronic
1149988537 17:61367016-61367038 CGAGCCCCAGCCTCGGCAGGCGG - Intronic
1150124819 17:62628942-62628964 GAGGCCCCAGACTCTCCAGGGGG - Intronic
1150210321 17:63438088-63438110 AGGGGCCCAGCCTCCCCACGGGG + Intronic
1151215749 17:72575381-72575403 AGAGCCCCAGCAGCGCCCGGGGG + Intergenic
1151655189 17:75492530-75492552 ACAGGCTCAGCATCTCCAGGTGG - Exonic
1151768597 17:76145215-76145237 TGAGCCCCAGCCTCTGCACTTGG - Exonic
1152136417 17:78506593-78506615 CGTGCCCCATCATCTCCAGGAGG - Intronic
1152649987 17:81488275-81488297 AGCCCCCCAGCCTCTCCACCCGG - Intergenic
1152945370 17:83194968-83194990 GCAGCCCCAGCCCCTCCAGCGGG - Intergenic
1153056394 18:950199-950221 AGGGCCCCAGCCACTCCACTGGG + Intergenic
1154130603 18:11733991-11734013 AGGCCCCCAGCCTCACCAGAAGG + Intronic
1154424226 18:14259647-14259669 AGAGCCTCTGCCTCTGCAGCAGG + Intergenic
1154426897 18:14278849-14278871 AGAGCCTCTGCCTCTGCAGCAGG + Intergenic
1154429625 18:14298383-14298405 AGAGCCTCTGCCTCTGCAGCAGG + Intergenic
1155193778 18:23453711-23453733 AGAGCCCTAACCACTCAAGGTGG - Intronic
1157215871 18:45782992-45783014 AGAGTCCCACCCTCTTCTGGAGG + Intergenic
1157573320 18:48727907-48727929 AGAGTCCCAGACTGTCCAGATGG - Intronic
1157682506 18:49617982-49618004 GGATCCCCAGGCTCTCCAGCCGG - Intergenic
1160457059 18:79008848-79008870 TGAGGCTCAGCCTCGCCAGGGGG + Intergenic
1160814954 19:1030876-1030898 GGCGCCCCAGCCACTGCAGGCGG - Intronic
1160888516 19:1364202-1364224 AGAGCCCCAGCCGCCCCTCGTGG + Intronic
1160950621 19:1665592-1665614 AGAGGCCCAGCCTCTGCTAGGGG - Intergenic
1161003015 19:1920638-1920660 GCAGCCACAGCCTCTGCAGGAGG - Intronic
1161320048 19:3636943-3636965 AGATCCCCAAGCTCTCAAGGAGG - Intronic
1161403382 19:4078637-4078659 AGAGCTCCAGCCTCCGCTGGGGG - Intergenic
1162035283 19:7935027-7935049 ATGGCCCCAGCGGCTCCAGGCGG + Intronic
1162794347 19:13078833-13078855 ACAGCCCCACGCTCTCCAAGTGG + Intronic
1163371478 19:16903603-16903625 AGATCCCCAGCCTCCCCACGGGG - Exonic
1164596206 19:29531910-29531932 AGAGTACCAGCCTCAGCAGGAGG + Intronic
1164706321 19:30322880-30322902 AGGTGCCCAGCCTTTCCAGGAGG - Intronic
1165092027 19:33392621-33392643 AGAGGTCCAGCCCCACCAGGCGG + Intronic
1165832123 19:38735498-38735520 AGACCTGCAGTCTCTCCAGGTGG - Exonic
1166149105 19:40858304-40858326 TGAGCCTCAGCTTCTCCAGTAGG + Intronic
1166686516 19:44799912-44799934 AGTTCCCAAGCCTCTCCAGTGGG - Intronic
1167110860 19:47460166-47460188 AGAGACACAGCCTGTCCATGAGG - Intronic
1167390783 19:49193606-49193628 TCAGCCCCAGCCTCTCTGGGGGG - Intronic
1167724128 19:51199472-51199494 AGAGACCCAGGCCCTGCAGGTGG - Intergenic
1168280664 19:55303830-55303852 GGAGCCCCTGTCCCTCCAGGAGG + Intronic
1168660807 19:58164557-58164579 ATAAGCCCAGTCTCTCCAGGTGG - Intergenic
1202638401 1_KI270706v1_random:61565-61587 AGAGCCTCTGCCTCTGCAGCAGG - Intergenic
924962880 2:49319-49341 AATGTTCCAGCCTCTCCAGGAGG - Intergenic
925380178 2:3419166-3419188 AGGGCCCCAGCCTTTCTAGCAGG + Intronic
925911650 2:8577707-8577729 AGAGCCACTGCCTGTCCTGGAGG + Intergenic
926752613 2:16210208-16210230 CGTGCCCCAGCTTCTCCTGGGGG - Intergenic
929887781 2:45893895-45893917 AGAGCCCCAGCCTCTCCAGGAGG - Intronic
932007542 2:67941804-67941826 ATATTCCCAGCCTCTTCAGGCGG + Intergenic
932175479 2:69596887-69596909 AAACCCCCAGCCACTCCTGGGGG - Intronic
932340751 2:70961367-70961389 GAAGTCTCAGCCTCTCCAGGGGG + Intronic
932630238 2:73335699-73335721 AGGACCCCAGCTACTCCAGGGGG + Intergenic
932813860 2:74845898-74845920 ACAGCCTCAGCCTTCCCAGGAGG + Intronic
934491526 2:94764547-94764569 AGAGGCTCTGCCTCTGCAGGAGG - Intergenic
935720865 2:105977904-105977926 AGATTCCCAGCCTCTTCAGATGG + Intergenic
936019108 2:108981289-108981311 AGAGCCGCACCCGCCCCAGGTGG + Intronic
936916840 2:117648736-117648758 AGAGCCCACTCCTCTCTAGGGGG + Intergenic
937220437 2:120340196-120340218 AGAGACCCAGCCTATCGGGGAGG - Intergenic
937354362 2:121188645-121188667 AGACACCCAGCCTCACCTGGAGG - Intergenic
937661277 2:124432371-124432393 AGGGACCCAGTGTCTCCAGGAGG - Intronic
938259910 2:129888141-129888163 ACAGCCCCAGCCCACCCAGGAGG + Intergenic
938279517 2:130054110-130054132 AGAGGCTCTGCCTCTGCAGGAGG - Intergenic
938330464 2:130444820-130444842 AGAGGCTCTGCCTCTGCAGGAGG - Intergenic
938359481 2:130676683-130676705 AGAGGCTCTGCCTCTGCAGGAGG + Intergenic
938435880 2:131283332-131283354 AGAGGCTCTGCCTCTGCAGGAGG + Intronic
940736337 2:157457006-157457028 AGAGCCCAAGCATCACCAGTAGG - Intronic
942051425 2:172144593-172144615 AGAGGCCCAGCATCACCCGGTGG + Intergenic
942748816 2:179264935-179264957 CGAGGCCCAGGCTCCCCAGGCGG + Intergenic
943621256 2:190150476-190150498 AGACCTTCAGCCTCTCCAGTGGG + Intronic
945833054 2:214809422-214809444 AGCGCAGCAGCTTCTCCAGGCGG + Exonic
946349742 2:219142352-219142374 AGAGCCCCGCCCTCTACAGCTGG - Intronic
946609705 2:221444399-221444421 AGTGCCCCAACAGCTCCAGGAGG - Intronic
946939844 2:224759125-224759147 ACAGCCCCATCCTGACCAGGAGG - Intergenic
947441229 2:230123426-230123448 ATAGCCCTAGTCTCTACAGGTGG - Intergenic
947497443 2:230648241-230648263 TGTGCCCCAGCCTCTCGAGTAGG - Intergenic
947772508 2:232681875-232681897 AGTGTCCAAGCCCCTCCAGGAGG + Exonic
948391800 2:237616911-237616933 AAAGCCCAGGCCTCTCCAGAAGG + Intergenic
948551893 2:238778401-238778423 GTAGCCCCAGCCTCACCACGAGG + Intergenic
948648896 2:239426604-239426626 AGAGGCCCTGGCTGTCCAGGAGG + Intergenic
948687622 2:239678986-239679008 AAAGCCCCTGCCTCTCCGAGTGG + Intergenic
948721979 2:239906188-239906210 AGAACCCCCGGCCCTCCAGGTGG + Intronic
948814781 2:240504314-240504336 AAAGCACCAGATTCTCCAGGAGG + Intronic
948815781 2:240509871-240509893 AGAGCCCCACCCTCGGCTGGTGG + Intronic
948920424 2:241063724-241063746 AGAGGCCCAGGCTCTGCATGTGG - Intronic
1168784534 20:526597-526619 AAAGACCCTGCCTCTGCAGGTGG + Intronic
1170295298 20:14818352-14818374 AGAGCCAAAGCCACTCCAGAAGG - Intronic
1170530188 20:17283463-17283485 ACAGCCTCAGACTCTCCAGAAGG + Intronic
1171360358 20:24582615-24582637 GAGGCCCCAGCCTGTCCAGGTGG - Intronic
1171884985 20:30645627-30645649 AGAGCCTCTGCCTCTGCAGCAGG - Intergenic
1172822515 20:37750244-37750266 TGGGCTCCAGCCTCTCAAGGGGG - Intronic
1172884057 20:38219668-38219690 GGAGCTCCAGCTTCCCCAGGAGG + Exonic
1173191684 20:40881682-40881704 AGAGATCCATCCTCTCCAGAGGG - Intergenic
1173758392 20:45538401-45538423 AGAGCCACAGCACCTCCTGGGGG - Intronic
1173761206 20:45562183-45562205 ATAGCCCCACCTTCTCCTGGAGG - Exonic
1175243045 20:57563653-57563675 TGAACCCCAGCCTCCCCGGGTGG + Exonic
1175272889 20:57747194-57747216 AGACCCCCAACCTCACCAGGGGG + Intergenic
1175755001 20:61523807-61523829 AGACCCCTACCCTCTCCAGGTGG + Intronic
1175903457 20:62368874-62368896 AGAGCCCCAAGCTGTCAAGGGGG - Intergenic
1175948044 20:62567873-62567895 ACAGCCCCAGCCTGCCCAGCAGG + Intronic
1176845143 21:13871033-13871055 AGAGCCTCTGCCTCTGCAGCAGG - Intergenic
1176847871 21:13890590-13890612 AGAGCCTCTGCCTCTGCAGCAGG - Intergenic
1176849245 21:13900349-13900371 AGAGCCTCTGCCTCTGCAGCAGG - Intergenic
1179504492 21:41831588-41831610 AGAGCGCCTGGCTCTCCCGGGGG - Intronic
1179659533 21:42865553-42865575 AGGCTCCCAGCCTCTCCAGCTGG + Intronic
1180080870 21:45487014-45487036 GCAGCCCCCGGCTCTCCAGGGGG - Intronic
1180834497 22:18923075-18923097 ACAGCACCAGACTCTGCAGGTGG + Intronic
1180869533 22:19138418-19138440 AGAGCCCCAGCCTTGCCCTGAGG - Intronic
1181009511 22:20032267-20032289 ACACGCCCATCCTCTCCAGGCGG - Intronic
1181179004 22:21054410-21054432 AGCGTCCCAGCCTAGCCAGGAGG + Intronic
1181308937 22:21933323-21933345 AGAGTCCCAGCCTCTGCAGCGGG - Intronic
1182126395 22:27818953-27818975 AGGACCCCAGCGTCTCCAGAAGG - Intergenic
1182498356 22:30727079-30727101 GGAGCCCCAGCCTATGCATGTGG + Intronic
1182776779 22:32837289-32837311 AGTGCTCCAGCCTCTCCACGGGG - Intronic
1183367891 22:37416880-37416902 ACAGCCACAGCCCCTCCACGTGG + Intronic
1183553235 22:38505738-38505760 AGAGGCCCAGCGTCGCCAAGCGG + Intronic
1183831032 22:40418482-40418504 AGGGCCCCAGCCTCATCAAGGGG - Exonic
1184056278 22:42052388-42052410 TGTGCCCCAGCCTCTCGAGTAGG + Intronic
1184562262 22:45269857-45269879 AGAGCCCGAGGTTCTGCAGGAGG - Intergenic
1184863429 22:47189708-47189730 AGAGACGCAGCCCCTCCTGGGGG + Intergenic
1185336964 22:50275062-50275084 AGAGCCCCACCCAGTCCGGGGGG - Exonic
1185418494 22:50722261-50722283 GGAGCCCCCGGCTCTCCACGGGG - Intergenic
1203284586 22_KI270734v1_random:148374-148396 ACAGCACCAGACTCTGCAGGTGG + Intergenic
949891320 3:8735655-8735677 AGAAGCCTAGCCTCTCCACGTGG + Intronic
951323157 3:21271678-21271700 ACAGCCCAAGCCTCTCCAACGGG - Intergenic
952014589 3:28941572-28941594 ATAGTCCCAGCCACTCAAGGTGG - Intergenic
952217448 3:31291588-31291610 AGAGGCCCTGCTTCTCCAGATGG + Intergenic
952268682 3:31811323-31811345 TGAGCCCAGGCCTCTCCGGGTGG - Intronic
952710945 3:36431485-36431507 AGAGCCCCTGCCTGCCCAGGTGG - Intronic
954322438 3:49841310-49841332 AAAGCCCCAGTCTCACTAGGGGG + Intronic
954876578 3:53806365-53806387 CCAGCCCCAGCCCCTCTAGGTGG - Intronic
955095642 3:55795332-55795354 GGTGCCCCAGCTTATCCAGGAGG - Intronic
955805042 3:62724996-62725018 TGAGCCCCAGGCTCCCCAGGTGG + Intronic
956766080 3:72485741-72485763 AGGCACCCAGCCTCTCCAGGAGG + Intergenic
956800168 3:72750405-72750427 AGAGGCCCAGACACTCCAAGAGG + Exonic
960974572 3:123161785-123161807 ACACCCCCAGCCCCTCCAGGGGG - Intronic
961488106 3:127231747-127231769 TGAGCCCCAGCATCACCAGTGGG + Intergenic
961512326 3:127410677-127410699 AGATCCACAGCGTCACCAGGAGG + Intergenic
961651974 3:128421278-128421300 AGAGGCTCTGCCTCTCCAGCTGG + Intergenic
962519764 3:136187547-136187569 AGAGTCCCAGCTACTCTAGGAGG + Intronic
967952409 3:194851477-194851499 AGGAGCCCAGCCTCTCCAGAGGG + Intergenic
968085136 3:195870780-195870802 AGGGCACCAGCCTCTCCTGGAGG + Intronic
969443559 4:7231879-7231901 AGAGACCCAGGCTCTCGGGGTGG + Intronic
969662787 4:8539975-8539997 AAATCCCCAGCATCTCTAGGTGG - Intergenic
969689559 4:8696686-8696708 TGGGCCTCAGCCTCTCCAGCTGG + Intergenic
970202843 4:13627389-13627411 AGAGCCCCTGGCTCTTGAGGTGG + Exonic
971103265 4:23493651-23493673 AGGGACCCAGCCTGGCCAGGTGG - Intergenic
971294628 4:25377365-25377387 GGAGCCCCCGGCTCTCCACGAGG - Intronic
972556605 4:40188154-40188176 AGTACCCCAGCCTCTCAAGCTGG - Intergenic
972573702 4:40332942-40332964 AGACCCTCAACCTCCCCAGGAGG - Intergenic
973368636 4:49227908-49227930 AGAGCCTCTGCCTCTGCAGCAGG - Intergenic
976360853 4:84176299-84176321 AGAGATCTATCCTCTCCAGGAGG - Intergenic
976599214 4:86922812-86922834 ACAGCCCCGTCCTCTCCAAGGGG + Intronic
979033184 4:115678558-115678580 CGGGCCCCAGCCTCTCCGAGGGG - Intergenic
979050256 4:115921291-115921313 AGAGATCGAGCCTCTCAAGGAGG + Intergenic
979120625 4:116895472-116895494 TGTGCCTCAGCCTCTCCAGCAGG - Intergenic
982190040 4:152844178-152844200 AGACCTTCAGCCTCTCCAGTGGG + Intronic
982274247 4:153623097-153623119 AGAGCCCCAGGCACTCTCGGTGG + Intronic
982549799 4:156783541-156783563 AAAGACTCAGCTTCTCCAGGAGG + Intronic
982875648 4:160646237-160646259 AGGCCCCCAGCATCTCCAGCTGG - Intergenic
983844172 4:172495621-172495643 AGAGCTTCAGCCTCTAAAGGTGG + Intronic
1202765735 4_GL000008v2_random:147423-147445 AGAGCCTCTGCCTCTGCAGCAGG - Intergenic
986031388 5:3896268-3896290 TGTGCCTCTGCCTCTCCAGGAGG + Intergenic
986124772 5:4874878-4874900 AAAGTCCTGGCCTCTCCAGGTGG + Intergenic
986280238 5:6316395-6316417 AGAGCCCAAGGCCCTCCTGGGGG - Intergenic
988547615 5:32173614-32173636 AAAGCACCAGCCGCGCCAGGGGG + Intronic
990524952 5:56616080-56616102 AGCGCCCCACCCTCTGCAGCAGG + Intergenic
991977765 5:72199737-72199759 GGAGCCCCACCGCCTCCAGGAGG + Exonic
991998091 5:72408136-72408158 AGAGCGGCAACCTCTCCAAGAGG - Intergenic
992747530 5:79834353-79834375 ACAGGCCCATCCTCTCCTGGTGG + Intergenic
997028726 5:130097446-130097468 AGAGTCCCAGCCTCTCCTGGAGG - Intronic
997229719 5:132233740-132233762 AAAGCCCAAGCCTTTCCAGCTGG + Intronic
997233786 5:132261064-132261086 ACAGCCTCTGCCTCACCAGGTGG + Intronic
998468188 5:142362819-142362841 ACAGCCCCAGCCTCCCCACCAGG - Intergenic
998554637 5:143111436-143111458 TGAGCTCCAGCCTCTCCATTTGG + Intronic
999282393 5:150374258-150374280 ACAGCCCCTGCCTTCCCAGGGGG - Exonic
999514629 5:152288589-152288611 GTAGCCCCAGCCACTCCAGATGG - Intergenic
1001597061 5:172905164-172905186 GGAGGCCCAGCCTCGCCAGGTGG + Intronic
1001940394 5:175735972-175735994 AGGGTCCCAGCCTCTCAGGGTGG + Intergenic
1002780321 6:359965-359987 TGAGCTCCAGCCTCTTCTGGAGG - Intergenic
1004670133 6:17788079-17788101 AGAGCCCCTGGATCTCCAGAAGG + Intronic
1006188753 6:32195259-32195281 AGAGCTGCAGCTTCTCCACGTGG + Exonic
1006743483 6:36325363-36325385 GGAGCCCCAGCCTCTGTAGATGG + Exonic
1011466515 6:87663021-87663043 TGAGACACAGCCTCTCCATGAGG + Exonic
1012427713 6:99132179-99132201 GGAGCCCCAGCCTCCTCTGGGGG - Intergenic
1012998221 6:105994239-105994261 AGAGCCCGGGCCTCTTTAGGCGG - Intergenic
1013024004 6:106251332-106251354 TGAGCCCTAGCCTTTGCAGGTGG + Intronic
1013078640 6:106793107-106793129 AGGGCTCCAGCTTCTCCAGCAGG + Intergenic
1016581503 6:145633581-145633603 AGGGGCCCAGCCTGGCCAGGAGG + Intronic
1017615762 6:156244818-156244840 AAATTCCCTGCCTCTCCAGGTGG - Intergenic
1017700332 6:157063333-157063355 AGAGCACCTGCCTCTTAAGGTGG - Intronic
1018910794 6:168100108-168100130 CCAGCACCAGCCACTCCAGGTGG - Intergenic
1019048032 6:169162981-169163003 ACAGCACCAGCCCCTCCGGGCGG - Intergenic
1019169490 6:170124216-170124238 AGAGCCCAAATCTCTCCAGTAGG - Intergenic
1019268264 7:131327-131349 AGACCTGCAGCCTCCCCAGGTGG - Intergenic
1019287803 7:232234-232256 CGACTCCCACCCTCTCCAGGTGG - Intronic
1019482143 7:1271874-1271896 AGAGCCCACGGCTCCCCAGGTGG + Intergenic
1022257004 7:28668882-28668904 AGGGCCCCAGCCTCTGAAAGAGG - Intronic
1022523377 7:31022111-31022133 GGAGTCCCAGCCTCCCCAGCTGG - Intergenic
1023557752 7:41440965-41440987 AGAGCACCAGCCTCTGGATGTGG - Intergenic
1023873285 7:44274083-44274105 AGGGCCTCAGCCTCTCCTGCTGG - Intronic
1024627411 7:51219894-51219916 AGAGTGGCAGCCTTTCCAGGAGG + Exonic
1025237368 7:57243913-57243935 AGGGAGCCAGCCTCCCCAGGAGG - Intergenic
1025963182 7:66242724-66242746 AGACCACCAGCCTCTTCAGTAGG + Intronic
1029585662 7:101469192-101469214 AGACCCCCAGAATTTCCAGGAGG - Intronic
1029640503 7:101816648-101816670 GAAGCGCCTGCCTCTCCAGGAGG + Intronic
1029667575 7:102005721-102005743 AGAGCCCCAGCCTCAGCAGGTGG - Intronic
1029709157 7:102290105-102290127 AGTGCCCCATCCTCTAAAGGTGG + Intronic
1030225515 7:107146022-107146044 TGAGACCCGGCCTCTCCAGATGG + Intronic
1030728379 7:112953977-112953999 AGAAGCCCAACCTATCCAGGTGG - Intergenic
1032542024 7:132711121-132711143 TGAGCCCAAGCTTCTCCAAGAGG + Intronic
1033227151 7:139571294-139571316 AGAGCTCCAGGCTCTCGTGGAGG + Exonic
1034001050 7:147413778-147413800 AGAGCTCCAGCCTCTGCATCTGG + Intronic
1034571360 7:151958978-151959000 AGAGCACCAGTCCTTCCAGGTGG + Intronic
1034823910 7:154242907-154242929 GGAGCTCCAGCATCTCCTGGTGG - Intronic
1034865204 7:154635802-154635824 TGAGCCTCAGACTCTCCATGGGG + Intronic
1034871317 7:154686630-154686652 ACTGACCCACCCTCTCCAGGAGG - Intronic
1035627600 8:1083333-1083355 AGAGCCCCAGCCTTTCGGAGAGG + Intergenic
1036127483 8:6076220-6076242 AAAGGCTGAGCCTCTCCAGGAGG - Intergenic
1036179794 8:6574392-6574414 AGAGCCCACCCCACTCCAGGAGG + Intronic
1036580017 8:10065204-10065226 AGAGCCCCAGGGTGTCCAGGTGG + Intronic
1036710855 8:11077701-11077723 AACCCTCCAGCCTCTCCAGGAGG + Intronic
1037831744 8:22193983-22194005 AGAGGCCCCACCTCTCCAGGAGG - Intronic
1037838332 8:22227576-22227598 AGACCCCCATCCTCTCAAGCTGG - Intronic
1038110882 8:24496100-24496122 TGAGTCCCAGCCACTCCAGCTGG + Intronic
1038803426 8:30769689-30769711 AGATGCACAGCTTCTCCAGGTGG + Intergenic
1038983682 8:32786179-32786201 AGAGCGCGAGCCTCCCCAGTGGG + Intergenic
1039907639 8:41798203-41798225 AGAGCTCCAGCCTCCCCGGGGGG - Intronic
1040007356 8:42631564-42631586 AGAGGCCCAGCCTCTTCCCGTGG - Intergenic
1040286788 8:46104532-46104554 AAAGCCCCAGCCTCTGGAGCAGG - Intergenic
1040298774 8:46177156-46177178 AGAGCCCCAGGCTTTGCAGCAGG + Intergenic
1040595497 8:48834331-48834353 AGAGCGCCTGTCTCTCCAGCAGG + Intergenic
1040965527 8:53077689-53077711 ACAGCCCAAGCCTCCCCAGTGGG - Intergenic
1041878092 8:62712987-62713009 AGAACCTCAGCTTCTCCAGTGGG + Intronic
1045361621 8:101438444-101438466 AGAACCCAAGCCTCTCAAGCAGG + Intergenic
1047282096 8:123454709-123454731 AGAACCCCAGTGTCACCAGGTGG + Intronic
1049205536 8:141361861-141361883 AGAGCCCCCACCCCTCCAGGTGG + Intronic
1049262891 8:141649210-141649232 AGAGCCCCAGCCTTCCAAGCAGG - Intergenic
1049300754 8:141868125-141868147 GGATCCCCTGCCTCTCTAGGGGG + Intergenic
1049465366 8:142749043-142749065 CGGGCCCCTTCCTCTCCAGGAGG + Intergenic
1049640263 8:143712118-143712140 ACAGCCCCAGCAGTTCCAGGGGG - Intronic
1049922356 9:377120-377142 AGAGCACGAGCGGCTCCAGGCGG - Exonic
1050461182 9:5878974-5878996 AGAGCTCCTGCCTCTCCTGAGGG + Intergenic
1050552677 9:6761446-6761468 CCAGCCCCAGCCTCTCAAGTAGG + Intronic
1052135795 9:24908458-24908480 AGAGCCCCAGCATCACAAAGTGG - Intergenic
1052878886 9:33588010-33588032 TGAGCCTCTGCCTCTGCAGGAGG - Intergenic
1052880259 9:33597484-33597506 AGAGTCTCTGCCTCTGCAGGAGG + Intergenic
1053491216 9:38505084-38505106 GGAGCCCCAGCAAATCCAGGTGG - Intergenic
1053495714 9:38546734-38546756 AGAGGCTCTGCCTCTGCAGGAGG - Intronic
1053497087 9:38556210-38556232 TGAGCCTCTGCCTCTGCAGGAGG + Intronic
1053666046 9:40318262-40318284 AGAGGCTCTGCCTCTGCAGGAGG + Intronic
1053890812 9:42691090-42691112 AGAGACTAAGCCTCTCCAGAGGG + Intergenic
1053915626 9:42943307-42943329 AGAGGCTCTGCCTCTGCAGGAGG + Intergenic
1054377201 9:64458290-64458312 AGAGGCTCTGCCTCTGCAGGAGG + Intergenic
1054518564 9:66058021-66058043 AGAGGCTCTGCCTCTGCAGGAGG - Intergenic
1056585825 9:87926546-87926568 AGAGGCTCTGCCTCTGCAGGAGG - Intergenic
1056611057 9:88126397-88126419 AGAGGCTCTGCCTCTGCAGGAGG + Intergenic
1057197164 9:93121560-93121582 AGAGCCCAACCCCCTCCACGGGG - Exonic
1057208405 9:93186435-93186457 AGAGGCCATGCCTGTCCAGGGGG + Intronic
1057671523 9:97094285-97094307 GGAGCCCCAGCAAATCCAGGTGG - Intergenic
1057675646 9:97134249-97134271 AGAGGCTCTGCCTCTGCAGGAGG - Intergenic
1058326749 9:103707867-103707889 AAAATCTCAGCCTCTCCAGGTGG - Intergenic
1058954657 9:109934467-109934489 ACAGTCCCAGTCTCTCCAGCTGG + Intronic
1059245798 9:112848723-112848745 AGAGACCCTGCCTCTCCTGTGGG + Intronic
1060760126 9:126239912-126239934 AGAGCTCCAGCCGCACCAGGTGG + Intergenic
1061067608 9:128288434-128288456 AGAGCTCCAGCGTGGCCAGGTGG + Intronic
1061643805 9:131982314-131982336 AGAGCCCCTCCCTCTCCGTGTGG - Intronic
1061693435 9:132354197-132354219 AAAGCTCCAGCCCCTCCAAGTGG + Intronic
1062046929 9:134428630-134428652 AGAGCCGCAGCCTCTTTCGGGGG - Intronic
1062141277 9:134960431-134960453 AGAGGCCCTGACCCTCCAGGAGG + Intergenic
1062221649 9:135419293-135419315 AGGGCACCAGAGTCTCCAGGAGG - Intergenic
1062378607 9:136276149-136276171 GGAGCCCCTGTCTCTGCAGGAGG - Intergenic
1203546485 Un_KI270743v1:132313-132335 AGAGCCTCTGCCTCTGCAGCAGG - Intergenic
1185815495 X:3151343-3151365 AGATCCCCTTCCTATCCAGGGGG - Intergenic
1187298545 X:18026311-18026333 AGAGCCGCACCCTCTCGGGGAGG + Intergenic
1189987478 X:46566801-46566823 CCAGCCCCAGCCTCTCCTTGGGG - Intergenic
1190221603 X:48515657-48515679 AGTCCCCCAGCCCCTCCTGGAGG - Intronic
1195019573 X:100812999-100813021 AGACCTTCAGCCTCTCCAGTGGG + Intergenic
1195469865 X:105219538-105219560 GCAGCCCCAGCCTCCACAGGGGG + Exonic
1195968931 X:110453753-110453775 AGAGCCACAGCCTCTGGATGTGG + Exonic
1196730649 X:118938184-118938206 AGAGTGGCAGCCTTTCCAGGAGG - Intergenic
1198596706 X:138243797-138243819 AATGCCCCAGTCTATCCAGGTGG - Intergenic
1199221098 X:145316405-145316427 ATAGCCCCAGCCTCTATAGAGGG + Intergenic
1200152142 X:153956470-153956492 AGTGCCCCAGCCTGTGCAGGAGG - Intronic
1201326936 Y:12771301-12771323 GAAGCCTCAACCTCTCCAGGAGG + Intronic