ID: 929889431

View in Genome Browser
Species Human (GRCh38)
Location 2:45906887-45906909
Sequence ACACTGTCCCAGCCAAGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 157}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929889431_929889439 29 Left 929889431 2:45906887-45906909 CCTGCGCTTGGCTGGGACAGTGT 0: 1
1: 0
2: 0
3: 11
4: 157
Right 929889439 2:45906939-45906961 AAGGAGCTGCATTGTGAGTGTGG 0: 1
1: 0
2: 2
3: 23
4: 217
929889431_929889434 10 Left 929889431 2:45906887-45906909 CCTGCGCTTGGCTGGGACAGTGT 0: 1
1: 0
2: 0
3: 11
4: 157
Right 929889434 2:45906920-45906942 TCTCCTGCCGCCCTTCTTTAAGG 0: 1
1: 0
2: 2
3: 14
4: 183
929889431_929889440 30 Left 929889431 2:45906887-45906909 CCTGCGCTTGGCTGGGACAGTGT 0: 1
1: 0
2: 0
3: 11
4: 157
Right 929889440 2:45906940-45906962 AGGAGCTGCATTGTGAGTGTGGG 0: 1
1: 0
2: 2
3: 16
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929889431 Original CRISPR ACACTGTCCCAGCCAAGCGC AGG (reversed) Intronic
900195278 1:1372705-1372727 ACCATGTTCCAGCCAGGCGCAGG + Intergenic
900726610 1:4220438-4220460 ACACTCTCCCGGCAAAGCACCGG - Intergenic
902502592 1:16921031-16921053 GTACAGTCCCAGCCAGGCGCAGG - Intronic
903236089 1:21951644-21951666 ACTCTGTCCCTGCCAGGCCCCGG - Intergenic
904499809 1:30907590-30907612 ACAGTGGCCCAGCCAGGCACAGG + Intronic
905871655 1:41407867-41407889 ACACTCACCCACCCCAGCGCTGG - Intergenic
912500597 1:110119587-110119609 CCACTGACCCAGCCCAGCCCAGG + Intergenic
915092770 1:153438150-153438172 AAGCTCTCCCAGCCAAGGGCGGG + Intronic
915107744 1:153544951-153544973 ACACCCTCCCAGCCAGGTGCGGG - Intronic
915115779 1:153598645-153598667 ACACTGGGCCAGGCCAGCGCTGG + Intergenic
917957645 1:180116946-180116968 ACAAAGTCCCAGCAAAGCTCAGG + Intergenic
921739262 1:218665423-218665445 ATACCGTCCCAGCCAAGCCCTGG + Intergenic
924775278 1:247111681-247111703 AGACGGTCCCGGCCAAGCGGCGG - Exonic
1063116620 10:3076331-3076353 ACACTGTCCCAGCCACGCAGAGG + Intronic
1066158629 10:32704799-32704821 GCACTCTCCGAGCCAGGCGCGGG + Intronic
1067093891 10:43285963-43285985 ACAATGACCCATCCAAGCCCAGG - Intergenic
1068966705 10:62919093-62919115 ACACTTACCCAGCCAGGCACTGG + Intronic
1070114435 10:73515193-73515215 AAACTGTCACAGCCAAGCTAAGG + Intronic
1070740914 10:78902699-78902721 CCACTGTCCCATCCCAGGGCTGG + Intergenic
1070839909 10:79477884-79477906 AAACTGTCACAGCCAAGAGGAGG + Intergenic
1071417464 10:85454601-85454623 AGTCTGTCTCAGCCAAGAGCTGG + Intergenic
1073081304 10:100862679-100862701 ACACTGTGCCAGCCAAGATCAGG - Intergenic
1073449761 10:103602467-103602489 ACACAGTGCCCGCCAAGGGCAGG - Exonic
1074703625 10:116112821-116112843 TGTCTGCCCCAGCCAAGCGCTGG - Intronic
1076578960 10:131494140-131494162 GCGCTGTCCAAGCCAAGCACAGG + Intergenic
1077096724 11:802138-802160 ACACTGCCCCTGCCATGCCCTGG + Intronic
1078455132 11:11469021-11469043 ACACTGTCCCTACCAAACCCTGG - Intronic
1082066553 11:47905541-47905563 ACACTCTCCCAGCAAAGCCGTGG - Intergenic
1084357859 11:68651605-68651627 CCACTGGGCCAGCCAAGCCCTGG + Intergenic
1085056096 11:73404936-73404958 CTGCTGGCCCAGCCAAGCGCTGG + Intronic
1086522375 11:87684275-87684297 AAACTGTCACAGCCAAGAGGAGG - Intergenic
1088379155 11:109173916-109173938 ACACTATCCCAGCCAACACCAGG - Intergenic
1089717478 11:120375823-120375845 AAACTGTCACAGCCAAGAGGAGG - Intronic
1091347101 11:134862867-134862889 AGACTGTCACAGCCAAGAGGAGG - Intergenic
1091710890 12:2739631-2739653 GCCCTCTCCCAGCCAAGCCCTGG + Intergenic
1091751000 12:3021095-3021117 ACACTGTCCCAGCCTCTCTCTGG + Intronic
1091876066 12:3933924-3933946 ATTCTGTCCCACCCAAGGGCAGG + Intergenic
1092412947 12:8268182-8268204 CGACTGTCCCAGCCAAACTCTGG + Intergenic
1100743991 12:97625524-97625546 ACACTGTCCCAGTCAATTGTAGG + Intergenic
1102436127 12:112925355-112925377 CCCCTCTCCCAGCCAACCGCAGG + Intronic
1102644000 12:114391841-114391863 GCACTTTCCCAGTCAAGTGCAGG - Intronic
1102827795 12:115964666-115964688 ACACTGTCCCATCCTATCCCTGG + Intronic
1104446969 12:128842608-128842630 TCACTGTCCCAGGCAAGCCGAGG + Intergenic
1105256078 13:18744741-18744763 GCACTGTCCCATCCCAGGGCTGG + Intergenic
1107904871 13:45052660-45052682 ACATTGACCCAGCAAAGAGCTGG - Intergenic
1110278201 13:73662247-73662269 ATCCTGTCCCAGCCAAGCTGGGG + Intergenic
1111772926 13:92622187-92622209 ACCCTGTCCCTGCCAGGCTCTGG + Intronic
1116902601 14:50375989-50376011 AAACTGTCACAGCCAAGAGGAGG + Intronic
1117520958 14:56550919-56550941 CCACTGTCCCAACCAAAAGCAGG - Intronic
1118329605 14:64805121-64805143 ACACTGACCCTGCCAACCTCAGG - Intronic
1119615134 14:76094104-76094126 ACCCTGTTCCAGCCCAGCACTGG + Intergenic
1119670967 14:76518010-76518032 ACATTGTCCCACCCAACCACAGG - Intergenic
1121005712 14:90489401-90489423 AGAATGTCCCAGCCCAGTGCTGG - Intergenic
1121854364 14:97253092-97253114 AAACAATCCCAGCCAAGCCCAGG - Intergenic
1122615154 14:103012393-103012415 ACACTGTTGCAGCCACGCACTGG + Intronic
1125792241 15:42375924-42375946 ATACTGTCACAGCCAAGAGAAGG - Intronic
1126919866 15:53509244-53509266 ACACTAGGCCAGCCAAGAGCAGG - Intergenic
1129742890 15:77998526-77998548 ACAATGGCCCAGCCAGGGGCAGG + Intronic
1131587011 15:93706347-93706369 ACACAGTCCCAGCCAAGCAGAGG + Intergenic
1132191594 15:99867055-99867077 ACCCTGTCCCCGCCAGGCTCTGG - Intergenic
1133354150 16:5123686-5123708 TGACTGTCCCAGCCAAACTCTGG + Intergenic
1135099006 16:19589872-19589894 AGACTGTCCAAGCCCAGCTCTGG + Intronic
1136033360 16:27519483-27519505 CCAGTGTCCCAGCCAGGCTCAGG + Intronic
1137715226 16:50594486-50594508 ACACTGTCCCAGGGCAGGGCAGG + Intronic
1139850842 16:69950966-69950988 ACACTGTCCCAGCCAGGACACGG + Intronic
1139879825 16:70173878-70173900 ACACTGTCCCAGCCAGGACACGG + Intronic
1139956195 16:70694150-70694172 ACCCTGCCCCAGCAAAGCCCTGG + Intronic
1140372698 16:74421670-74421692 ACACTGTCCCAGCCAGGACACGG - Intronic
1141267598 16:82511006-82511028 ACACTGTCACAGACATGCCCAGG + Intergenic
1144445324 17:15321999-15322021 CCACTGTTCCAGCCAAGACCTGG - Intronic
1145025444 17:19464841-19464863 ACTCTGTCCAAGCCAGGCACAGG - Intergenic
1147652012 17:42068117-42068139 ACACTGCCCCAGCTAAGCTAGGG + Intergenic
1147990701 17:44331078-44331100 ACGCTGTCCCAGCAGAGCTCTGG - Intergenic
1148550718 17:48549435-48549457 AAACTGTCCCAGGCAGGGGCTGG - Exonic
1151600658 17:75104253-75104275 ACACTGTCTCAGCCCAGCCCAGG + Intronic
1151719083 17:75845456-75845478 CCTCTGTCCCAGCCAGGCCCTGG + Intergenic
1152032550 17:77853328-77853350 AAACGTTCCCAGCCAAGCCCTGG + Intergenic
1152404195 17:80087185-80087207 GCCCTGCCCCAGCCAAGCTCAGG - Intronic
1152658181 17:81529619-81529641 AGAATGTCTCAGCCAAGCCCTGG + Intronic
1153501101 18:5750999-5751021 ACACTGTTACAGCCAACTGCAGG - Intergenic
1153805377 18:8705538-8705560 TCACTGTCCCAGCCCCGCCCGGG - Intergenic
1157945731 18:51978434-51978456 AAACTGTCACAGCCAAGAGGAGG + Intergenic
1160111981 18:76041823-76041845 AGACTGAGCCAGCCAAGCACAGG + Intergenic
1161093760 19:2376965-2376987 ACACTGGGCCAGACACGCGCTGG - Intergenic
1161722481 19:5910905-5910927 CCACTGGCCCAGCCAAGACCAGG - Intronic
1163337004 19:16679687-16679709 TCAGTGTCCCAGCCAAGTGATGG - Intronic
925189430 2:1870963-1870985 ACACAGCCCCAGCCTAGGGCAGG - Intronic
927359046 2:22210045-22210067 CCACTGTCCCACCCAAGGGCAGG - Intergenic
928183372 2:29086886-29086908 AAACTGTCACAGCCAAGGGGAGG - Intergenic
929889431 2:45906887-45906909 ACACTGTCCCAGCCAAGCGCAGG - Intronic
930616531 2:53599943-53599965 ACCCTGTGCCAGCCAGGTGCTGG - Intronic
930919002 2:56728228-56728250 ACTCTGTCCCTGCCATGAGCAGG - Intergenic
932091098 2:68807283-68807305 CCACAGTCTCATCCAAGCGCTGG - Exonic
935385823 2:102499156-102499178 TCAGTGTCCCTGCCAAGCTCAGG + Intronic
938092913 2:128444807-128444829 ACTCTGCCCCAGCCAACCACAGG - Intergenic
938140832 2:128793570-128793592 CCACTGTCTCAGCCCAGCGTGGG + Intergenic
948184078 2:236005615-236005637 AAAATGTCCCAGCCAAGAGAAGG - Intronic
1170470308 20:16661976-16661998 CCACTCTCCCAGCCAAGGGGGGG - Intergenic
1170649368 20:18225838-18225860 ACACTGTCTGAGCCCAGCACAGG - Intergenic
1171374284 20:24681709-24681731 ACACTGACCCAGCCAGCCTCAGG + Intergenic
1172313434 20:33935237-33935259 ACACAGTCCCAGGCAAGTTCAGG + Intergenic
1174576858 20:51542890-51542912 ACACTGTCCCGGGCCACCGCTGG + Intronic
1176173153 20:63705384-63705406 CCACTGTGCCAGCCTAGGGCAGG + Intronic
1178365078 21:31983425-31983447 GCATTCTCTCAGCCAAGCGCTGG + Intronic
1178781150 21:35604388-35604410 ACACGGTCCCATCCATGCCCAGG + Intronic
1179150701 21:38806079-38806101 CCACCGTCCCGACCAAGCGCCGG + Exonic
1179544970 21:42107732-42107754 ACCCTGTCCCAGCAAGGTGCAGG - Intronic
1179630226 21:42673335-42673357 GCACGGACCCAGCCAAGCCCAGG + Intronic
1180593071 22:16956879-16956901 ATCCAGTCCCAGCCAAGCACTGG + Intergenic
1180800568 22:18630037-18630059 ACACCCTCCCAGCCAGCCGCTGG + Intergenic
1180851800 22:19025594-19025616 ACACCCTCCCAGCCAGCCGCTGG + Intergenic
1181221151 22:21365225-21365247 ACACCCTCCCAGCCAGCCGCTGG - Intergenic
1181521389 22:23450557-23450579 GCACTGTCCCAGCCCCGGGCGGG - Intergenic
1182427069 22:30279521-30279543 TCACTTTCCCAGGCAAGCCCCGG - Intergenic
1182905687 22:33934208-33934230 TCACTCTCCCAGCCAGGCACCGG - Intergenic
1183494267 22:38133485-38133507 ACAGTGACCCATCCAAGCGCAGG - Intronic
1185053372 22:48565205-48565227 CCACTGTCACGGCCAAGTGCTGG + Intronic
949105752 3:198012-198034 ACAGTGTCTCAGCCAGGGGCAGG + Intronic
950448519 3:13052406-13052428 ACACTGTCCCAGCCACGCCGGGG - Intronic
951709095 3:25571540-25571562 ACACTGTCCCATCCCAGAGCAGG + Intronic
957906973 3:86569904-86569926 ACCCTGTCCCTCCCAAGCCCTGG + Intergenic
961890510 3:130126835-130126857 CGACTGTCCCAGCCAAACTCTGG + Intergenic
968359876 3:198139464-198139486 ACGCTGGCTCAGCCAAGCCCCGG - Intergenic
969288271 4:6221984-6222006 CCACTGTCCCCGCCCAGCCCCGG + Intergenic
969695045 4:8729551-8729573 ACACTGCCCCAGCCCAGCCCTGG - Intergenic
972278829 4:37584341-37584363 AGGCTGTCCCCGCCAAGCTCCGG + Exonic
972439045 4:39067186-39067208 AAACTGTCACAGCCAAGAGGAGG - Intronic
974480637 4:62438306-62438328 AGACTGTCCCTGCAAAGCCCAGG - Intergenic
984466131 4:180101582-180101604 TCACTGTCTCAGGCAAGGGCAGG + Intergenic
986169991 5:5307378-5307400 TCACTCTCCCAGCCAAGAGATGG - Intronic
986172771 5:5327264-5327286 CCACTGTTCCAGCAGAGCGCTGG - Intergenic
992894489 5:81234623-81234645 GCACTGTCACAGCAAAGCACAGG + Intronic
997606759 5:135180381-135180403 ACTGAGTCCCAGCCAACCGCAGG - Intronic
998378677 5:141708550-141708572 AACCTGTCCCAGCCAAGAGGAGG + Intergenic
1002196786 5:177505388-177505410 AAGCTGGCCCAGCCAAGCCCAGG - Intronic
1005064497 6:21805403-21805425 ACACTGAGCAAGCCAAGAGCAGG + Intergenic
1005833150 6:29687058-29687080 ACACTGCCCTAGCCAAGTGATGG - Intergenic
1006031208 6:31177848-31177870 ACTCTTTCCCAGCCCAGCCCTGG - Intronic
1006450121 6:34100875-34100897 GCACTGTTCCAGCCCAGCCCGGG + Intronic
1007925213 6:45644579-45644601 AGACTGTCTCAGCCAAGCCAAGG - Intronic
1009801948 6:68549338-68549360 ACACTGTGCAAGTCAAGCCCTGG + Intergenic
1016583701 6:145659793-145659815 ACAGAGTTCCAGCCAATCGCAGG + Intronic
1019664782 7:2246386-2246408 ACACTCTCCCAGCCAACGTCAGG - Intronic
1023284419 7:38604482-38604504 ACACTGCCCCAGCCCTGCACAGG + Intronic
1026982770 7:74536315-74536337 ACACTGCCTCAGCCCAGAGCAGG - Intronic
1028773672 7:94656042-94656064 ACCCTGTCCCGTCCAAGCACAGG + Exonic
1029203863 7:98856782-98856804 CCACTGTGCCAGCCAAGCCGAGG + Intronic
1029220117 7:98981996-98982018 GGCCTGTCGCAGCCAAGCGCCGG + Intronic
1029550574 7:101235172-101235194 TCACTGTCCTAGCCCAGTGCTGG + Intronic
1031928408 7:127660370-127660392 ACAGTCTCCCAGTCAAGAGCAGG - Intronic
1036786254 8:11689692-11689714 ACCCTGGCCCAGCCAAGGGTGGG - Intronic
1037316997 8:17608519-17608541 GCACTGTCCCATACAAGAGCCGG + Intronic
1039767478 8:40644984-40645006 AAACTGTCACAGCCAAGAGGAGG + Intronic
1040542918 8:48376023-48376045 ACACTGTACCAGCAAAGCTAGGG - Intergenic
1040600182 8:48875588-48875610 ACACTGACACAGCCAAGCTATGG - Intergenic
1042949880 8:74189914-74189936 AAACTGTCACAGCCAAGAGGAGG - Intergenic
1043048785 8:75359645-75359667 GGACTGTCCGAGCCAAGTGCAGG + Intergenic
1045055206 8:98362759-98362781 ACACAGTCACAGCTAAGCCCAGG + Intergenic
1048176521 8:132157526-132157548 ACACTCTCCCAGCCAGCCACTGG - Intronic
1049586905 8:143436523-143436545 TCACGGTCCCAGACAGGCGCTGG + Intergenic
1050114035 9:2244543-2244565 AAACTGTCCCAGACATGGGCAGG - Intergenic
1050715636 9:8522015-8522037 ACACTGTCACATCCCAGCCCTGG + Intronic
1060602424 9:124887050-124887072 AGACTGTCCTAGCCAAGCTCTGG - Intronic
1061855797 9:133441359-133441381 ACAATGTCCCAGGCAAGGGGAGG - Intronic
1062623378 9:137432616-137432638 ACAAAGTCACAGCCCAGCGCTGG - Intronic
1062744578 9:138203284-138203306 ACGCTGGCTCAGCCAAGCCCCGG - Intergenic
1185745396 X:2568801-2568823 AAACTGTCACAGCCAAGAGGAGG + Intergenic
1190618413 X:52262107-52262129 ACACTCTCCCAGCCAGCCCCTGG + Intergenic
1199933994 X:152553364-152553386 AGACAGTCCCAGCCCAGCCCTGG - Intergenic