ID: 929890830

View in Genome Browser
Species Human (GRCh38)
Location 2:45917746-45917768
Sequence GCCGCACGGGAGCTCACGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 0, 2: 6, 3: 115, 4: 277}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929890820_929890830 15 Left 929890820 2:45917708-45917730 CCGTGGAGCAGGGGGCGGCGCTC 0: 200
1: 415
2: 511
3: 317
4: 324
Right 929890830 2:45917746-45917768 GCCGCACGGGAGCTCACGGTCGG 0: 1
1: 0
2: 6
3: 115
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929890830 Original CRISPR GCCGCACGGGAGCTCACGGT CGG Intronic