ID: 929893933

View in Genome Browser
Species Human (GRCh38)
Location 2:45941696-45941718
Sequence CTTGAATTGCTCAGTGACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 216}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929893933_929893937 1 Left 929893933 2:45941696-45941718 CCTGGGTCACTGAGCAATTCAAG 0: 1
1: 0
2: 1
3: 19
4: 216
Right 929893937 2:45941720-45941742 ATGCACTGGAAGAGCCTGGGAGG 0: 1
1: 0
2: 3
3: 19
4: 232
929893933_929893938 2 Left 929893933 2:45941696-45941718 CCTGGGTCACTGAGCAATTCAAG 0: 1
1: 0
2: 1
3: 19
4: 216
Right 929893938 2:45941721-45941743 TGCACTGGAAGAGCCTGGGAGGG 0: 1
1: 1
2: 6
3: 29
4: 309
929893933_929893936 -2 Left 929893933 2:45941696-45941718 CCTGGGTCACTGAGCAATTCAAG 0: 1
1: 0
2: 1
3: 19
4: 216
Right 929893936 2:45941717-45941739 AGCATGCACTGGAAGAGCCTGGG 0: 1
1: 0
2: 4
3: 17
4: 181
929893933_929893935 -3 Left 929893933 2:45941696-45941718 CCTGGGTCACTGAGCAATTCAAG 0: 1
1: 0
2: 1
3: 19
4: 216
Right 929893935 2:45941716-45941738 AAGCATGCACTGGAAGAGCCTGG 0: 1
1: 0
2: 1
3: 24
4: 198
929893933_929893940 15 Left 929893933 2:45941696-45941718 CCTGGGTCACTGAGCAATTCAAG 0: 1
1: 0
2: 1
3: 19
4: 216
Right 929893940 2:45941734-45941756 CCTGGGAGGGACTTGAAGTTAGG 0: 1
1: 0
2: 0
3: 16
4: 218
929893933_929893941 16 Left 929893933 2:45941696-45941718 CCTGGGTCACTGAGCAATTCAAG 0: 1
1: 0
2: 1
3: 19
4: 216
Right 929893941 2:45941735-45941757 CTGGGAGGGACTTGAAGTTAGGG 0: 1
1: 0
2: 1
3: 11
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929893933 Original CRISPR CTTGAATTGCTCAGTGACCC AGG (reversed) Intronic
901346005 1:8542923-8542945 TTTGAAGTGCTCAGTAACCCTGG - Intronic
902374529 1:16024057-16024079 CCTGATTTGCTCTGTGATCCTGG + Intronic
902379470 1:16045821-16045843 CCTGACTTGCTCTGTGATCCTGG + Intronic
903127699 1:21258912-21258934 GCTGACTTGCTCTGTGACCCTGG + Intronic
903164892 1:21513465-21513487 CTTGAATACCTCTGTGACCTTGG + Intronic
903991010 1:27269638-27269660 ATGGAATTGCTCTGTCACCCAGG + Intronic
904393268 1:30199541-30199563 ACTGATTTGCTGAGTGACCCTGG + Intergenic
905383298 1:37580052-37580074 CTTTTATTGCTCAGTGAGCTTGG - Intronic
906560625 1:46754216-46754238 ATTGATTTGCTGTGTGACCCTGG + Intergenic
906638296 1:47425135-47425157 CTGGAATTGGTGAGTGACCAAGG - Intergenic
907483935 1:54764088-54764110 CTTCACTCGCTCGGTGACCCTGG + Intronic
908313795 1:62912823-62912845 CTTAATTTGTTGAGTGACCCAGG + Intergenic
908356635 1:63329529-63329551 CTTGGGCTGCTGAGTGACCCTGG - Intergenic
908480496 1:64534634-64534656 CTTGAATTGCTCAGAGTGCAAGG - Intronic
909667468 1:78151403-78151425 CCTGAATTATTCAATGACCCTGG + Intergenic
910559053 1:88570187-88570209 CTTTATTTTCTCAGTTACCCTGG - Intergenic
911161638 1:94687614-94687636 CCTTAATTCCTCAGTGGCCCTGG + Intergenic
913529039 1:119720290-119720312 CTAGACTTGCTCAGACACCCAGG - Intronic
915601027 1:156923566-156923588 CTGGAACTGCTCAGGGTCCCTGG - Intronic
916517443 1:165532788-165532810 CTTGAAAAGCTTAGGGACCCTGG - Intergenic
918224611 1:182470281-182470303 GTTGAATTTCTCACTGACACAGG - Intronic
921323906 1:213971697-213971719 CTTGTCTTGCTCTGTCACCCAGG - Intergenic
922489660 1:226005762-226005784 ATTCAATTGCCCAATGACCCCGG - Intergenic
923562522 1:235052059-235052081 CTTGTCTTGCTCTGTCACCCAGG - Intergenic
924380246 1:243456333-243456355 CCTGAAAAGCCCAGTGACCCTGG - Intronic
924675214 1:246169069-246169091 CTTGAATTCCTTAGAGAGCCTGG + Intronic
924892961 1:248304991-248305013 GGTGTCTTGCTCAGTGACCCAGG - Intergenic
1064429650 10:15259849-15259871 CTTCACTTGCTCTGTCACCCAGG + Intronic
1064540099 10:16396532-16396554 CTTGAATTGCTCACTCTGCCTGG + Intergenic
1065371615 10:24992493-24992515 CCTGAATTGCTCAGTGTCAGTGG + Intronic
1067201477 10:44175800-44175822 TTTGAATTTCTCTGTGATCCAGG + Intergenic
1070009518 10:72458671-72458693 TTTGAATTCTTCTGTGACCCTGG - Intronic
1070331888 10:75423359-75423381 CTTGTGTTGCTCTGTTACCCAGG + Intergenic
1070528640 10:77316935-77316957 CCTGACTTGCTGTGTGACCCTGG + Intronic
1072524849 10:96262734-96262756 CTTGAATTCCACACTGACTCAGG - Intronic
1073806473 10:107104133-107104155 CTTGAATTTCTCAGTTGCACTGG - Intronic
1074771413 10:116737144-116737166 ATTGACCTGCTCTGTGACCCTGG - Intronic
1077793228 11:5463736-5463758 TTTGAAGGACTCAGTGACCCTGG + Intronic
1078258891 11:9685657-9685679 CTTGTCTTGCTCTGTCACCCAGG + Intronic
1080266393 11:30406371-30406393 TTTGAATTGCTCTGTGACCATGG + Intronic
1080408779 11:32003730-32003752 CTTGATTGGCTGTGTGACCCTGG - Intronic
1083759411 11:64807488-64807510 CTTGACTTGCTGTGGGACCCTGG - Intronic
1084550894 11:69841026-69841048 CTTGAATGGCTCGGTGTGCCAGG + Intergenic
1085473137 11:76770980-76771002 CATGAATGGTTCACTGACCCTGG + Intergenic
1085801882 11:79597891-79597913 TTTTAATTGCTCAGAGTCCCAGG - Intergenic
1086499521 11:87437639-87437661 CATGAAATGCTCACTGACCCAGG - Intergenic
1086499530 11:87437686-87437708 CATGAAACGCTCACTGACCCAGG - Intergenic
1086867883 11:92002052-92002074 CTTGTCTTACTCTGTGACCCAGG - Intergenic
1088855410 11:113746320-113746342 GCTGAATTGCTCTGTGACTCTGG - Intronic
1090628794 11:128628192-128628214 CTGGGGTTGCCCAGTGACCCTGG + Intergenic
1092152973 12:6263721-6263743 CTTGTCTTGCTCTGTCACCCAGG - Intergenic
1092881733 12:12892218-12892240 CTTGAGTTGCTCAGAAACCTGGG + Intronic
1094499610 12:31010222-31010244 TGTGACTTGCTCAGGGACCCCGG + Intergenic
1095520377 12:43056856-43056878 CTTGACTTTCTCAGTGACTTTGG + Intergenic
1095570183 12:43675503-43675525 CTGGAATGGCTCAGTGATCTGGG + Intergenic
1096997508 12:55848049-55848071 CTGGAATTGGTTAGTGACCAGGG + Intergenic
1098883091 12:75936587-75936609 CTTAAGTTGCTCAGTGAGGCAGG - Intergenic
1100382982 12:94079001-94079023 CTTGAACTCCTCACTGTCCCCGG - Intergenic
1102439376 12:112949551-112949573 CTTGAATTGTTCTGTGGACCTGG - Intronic
1102465977 12:113131057-113131079 CTGGACTTGCTGTGTGACCCTGG - Intronic
1102974070 12:117193525-117193547 CTTGTCTTGCTCTGTCACCCAGG - Intergenic
1104025417 12:125022470-125022492 CTTGAATTTCTCAGTTATCCAGG - Intronic
1107051225 13:36052412-36052434 CTGGACTTGCTGAGTGACCCAGG - Intronic
1107729531 13:43334458-43334480 CTTGAGCTGCTCAGAGTCCCTGG + Intronic
1108425179 13:50292078-50292100 TATGAACTGCTAAGTGACCCAGG - Intronic
1110819307 13:79896158-79896180 CTTCAAAAGCTCAGTGACCCTGG - Intergenic
1111059750 13:83000967-83000989 CTTGCCTTGCTCTGTCACCCAGG + Intergenic
1112875357 13:104031599-104031621 CTTGTAATGCTCTATGACCCTGG + Intergenic
1115793912 14:36911355-36911377 CTTTAATGGCTCTGTGACCTTGG - Intronic
1116762073 14:49026971-49026993 CTTGAGTGGCTGGGTGACCCAGG - Intergenic
1120096473 14:80394464-80394486 CTTGAATTGCTATGACACCCTGG + Intergenic
1120189351 14:81426357-81426379 CTTGAATTTCCCAGTGAAGCTGG + Intronic
1121241860 14:92436685-92436707 CCTGCAGTGCTCCGTGACCCAGG + Intronic
1121384221 14:93502385-93502407 ATTGTCTTGCTCAGTCACCCAGG - Intronic
1121682264 14:95803489-95803511 CTGGAAATGCTCAGTGAGGCTGG + Intergenic
1127462224 15:59209858-59209880 CTTGCCTTGCTCTGTCACCCAGG + Intronic
1127816393 15:62613074-62613096 CTTAAGTAGCTCAGTGACCATGG + Intronic
1128486938 15:68101772-68101794 TTTGACTTGCTCTGTCACCCAGG + Intronic
1128761299 15:70217765-70217787 TTTGGAGTGTTCAGTGACCCAGG + Intergenic
1130874529 15:88001553-88001575 CGTGAATAGCTCATTGTCCCAGG + Intronic
1131972149 15:97903726-97903748 CTAGAATTGCTGTGTGACCTTGG + Intergenic
1132193755 15:99893781-99893803 CTTTAATTGCTTTATGACCCAGG + Intergenic
1132689744 16:1177183-1177205 CTTGGATTTCTAAGTGACACAGG + Intronic
1133235572 16:4385984-4386006 CTAGATTTGCTCAGAGGCCCCGG + Intronic
1134788515 16:16966648-16966670 CCTGATTTGCTGTGTGACCCTGG - Intergenic
1135273193 16:21086474-21086496 CTTGATTTGCTCCTTGACCTAGG - Intronic
1138410414 16:56835190-56835212 TTTGAACTCCACAGTGACCCTGG + Intronic
1138583446 16:57956214-57956236 CTCGATTTGCTCTGTGACCCTGG + Intronic
1139455368 16:67070823-67070845 CTTGTCTTGCTCTGTCACCCAGG - Intronic
1140181603 16:72725078-72725100 CTTGACTAGCTCTGTGACCTTGG + Intergenic
1141281279 16:82631811-82631833 CTTGAAGTGCTGACTGAGCCAGG + Intronic
1145272387 17:21411598-21411620 CTTGAATTGCTTTGTGACCTGGG + Intronic
1145310594 17:21699063-21699085 CTGGAATTGCTTTGTGACCTGGG + Intronic
1146942191 17:36850991-36851013 CTTGACTTGCTGTGTGACCTTGG + Intergenic
1155601468 18:27553620-27553642 CTTGTCTTGCTCAGTTTCCCAGG + Intergenic
1155888974 18:31242969-31242991 CTTGAGCTGCACAGAGACCCAGG + Intergenic
1156550465 18:38011016-38011038 CATGATTTGCACAGTGACCTTGG - Intergenic
1156701357 18:39829440-39829462 CTACAATTGCTCAGTGACAAAGG + Intergenic
1157069817 18:44393125-44393147 CTAGATTAGCACAGTGACCCTGG + Intergenic
1158156900 18:54436076-54436098 CTTGAATTGATCAGAGCCCTTGG - Intergenic
1158381947 18:56941467-56941489 CTTGAATTGCAGAGGGAACCAGG + Intronic
1159999652 18:75004538-75004560 CTTGATAGGCTGAGTGACCCTGG - Intronic
1161138451 19:2634364-2634386 CAGAAATTGCTCAGTGTCCCCGG + Intronic
1163226096 19:15962637-15962659 TTTGAATCTCCCAGTGACCCAGG - Intergenic
1163467474 19:17476714-17476736 CTCAAATTGCTCTGTGACCTTGG + Intronic
1164646284 19:29860768-29860790 CTGGACTTGCTCTGTCACCCAGG + Intergenic
1164854449 19:31510183-31510205 CTTGAATGTCTCTGTGACACTGG + Intergenic
1165399482 19:35588773-35588795 CTAGAATGGTTCAGGGACCCAGG - Intergenic
1165453431 19:35897994-35898016 CCTCAATTCCTCAGTGTCCCAGG - Intronic
1166132187 19:40752392-40752414 CTTTACTTGCTATGTGACCCTGG - Intronic
1167063383 19:47165840-47165862 CTGGGATTGCCCAGTGGCCCTGG - Intronic
1167475213 19:49696656-49696678 CTTGTCTTGCTCTGTCACCCAGG + Intronic
1168126106 19:54284072-54284094 CTGGGATGACTCAGTGACCCGGG + Intergenic
926576955 2:14593198-14593220 CTGAAATTGCTCAGTAAACCAGG - Intergenic
927641887 2:24850493-24850515 CTAGGATTGCTCAGGGCCCCAGG + Intronic
929893933 2:45941696-45941718 CTTGAATTGCTCAGTGACCCAGG - Intronic
930237103 2:48899098-48899120 CTTGAACTGTTTAGGGACCCAGG + Intergenic
930564928 2:53006737-53006759 CTTGTATCACTCAGTGCCCCTGG - Intergenic
932557104 2:72834138-72834160 CTGGAATAGCTCAGGGAGCCAGG - Intergenic
934659331 2:96134767-96134789 CCTGAATAGGACAGTGACCCAGG - Intronic
935601643 2:104928099-104928121 CCAGAATTGCTCAGTGGCCCAGG + Intergenic
935725552 2:106020942-106020964 ATTTAGTTGTTCAGTGACCCAGG + Intergenic
936504397 2:113093557-113093579 CTTCAATAGCTGTGTGACCCTGG + Intergenic
937065682 2:119015204-119015226 ATTGAATTGCTCAGCGAACAGGG - Intergenic
937247298 2:120501950-120501972 CCTGATTTGCTGTGTGACCCTGG - Intergenic
939146129 2:138417016-138417038 CTGGAGTTCCACAGTGACCCAGG - Intergenic
939981126 2:148783009-148783031 CATGAAAATCTCAGTGACCCTGG + Intronic
941030628 2:160507723-160507745 CTTTAATTGCTGTGTGACCCTGG + Intergenic
946710838 2:222503800-222503822 CAAGAATTCCTCAGTGACCGAGG + Intronic
947581170 2:231319550-231319572 CTTAAACTGCTAAGTGACCAGGG + Intronic
947717106 2:232346467-232346489 CTTGAGTTGCTCTGTTGCCCAGG - Intergenic
947735546 2:232452788-232452810 CTTGAGTTGCTCTGTTGCCCAGG - Intergenic
1170509266 20:17059989-17060011 CTGGATTTGCTCAGTGTGCCTGG + Intergenic
1171359161 20:24574556-24574578 CTGGAAGTGCTCAGTGGCCTGGG - Intronic
1173555967 20:43965919-43965941 CTTCAATTCCTCAGTGACAGAGG + Intronic
1174417429 20:50376844-50376866 CTTGAATTGCTGCCTGGCCCAGG + Intergenic
1175177750 20:57123248-57123270 CTTGCATTGTGCTGTGACCCAGG - Intergenic
1178896979 21:36567054-36567076 CGTGAATTGATCTGTGGCCCTGG + Intronic
1179366047 21:40759367-40759389 TTTGAATTCCTCATTGCCCCTGG + Intronic
1181572500 22:23775200-23775222 CATGACTTGCTGTGTGACCCCGG + Intronic
1182049354 22:27301039-27301061 CTTTACATGCTCAGTGACCTTGG + Intergenic
1182094303 22:27615615-27615637 CTAGAAATGCTGTGTGACCCTGG + Intergenic
1183549067 22:38470639-38470661 CTTGACTCGCTGTGTGACCCTGG + Intronic
1183731688 22:39622001-39622023 ACTGAATTGCTGTGTGACCCTGG - Intronic
1184705693 22:46211709-46211731 CTTGTCTTGCTCTGTCACCCAGG + Intronic
1184773106 22:46609540-46609562 CTAGATTTGCCCAGGGACCCAGG + Intronic
951095018 3:18618956-18618978 CTTGAATTGCTCTCTGCCCTTGG + Intergenic
953043262 3:39273499-39273521 CATGAATGGCTGAGAGACCCTGG + Intronic
954220820 3:49152795-49152817 CTTGTCTTGCTCTGTCACCCAGG - Intergenic
954790489 3:53129876-53129898 CTTGGATTGCTCCGTGACCCAGG - Intronic
956069010 3:65428030-65428052 ATTGAAATGCTCAATGAGCCTGG - Intronic
956242327 3:67143762-67143784 CTTGCTTTGCTCTGTCACCCAGG - Intergenic
957770219 3:84681301-84681323 AGTGACTTGCTCAGTGACCTTGG + Intergenic
959444566 3:106422665-106422687 CTTGAATTTCTCAGTAAACTAGG + Intergenic
961642485 3:128373419-128373441 ATTGGATTGCTCAGGCACCCAGG + Intronic
961728899 3:128952753-128952775 CTTGTCTTGCTCTGTCACCCAGG - Intronic
966080026 3:175989397-175989419 CTGGAACAGCTCAGTGACCTGGG - Intergenic
968430344 4:554797-554819 CTTGAAAGGCTCAGTGAGGCGGG - Intergenic
970664988 4:18326531-18326553 CTTGTATTGCTCAGTGGGTCTGG + Intergenic
972074741 4:35072607-35072629 CTTATATGGCTCAGTAACCCAGG + Intergenic
973036599 4:45415037-45415059 CTTCAAATGCACAGTTACCCTGG - Intergenic
976251659 4:83058241-83058263 CTTAAATTGCTCTATCACCCAGG + Intronic
977873761 4:102124946-102124968 CTTGGATAGCTGAGTGACCTTGG + Intergenic
978615816 4:110593997-110594019 CTTGTCTTGCTCTGTCACCCAGG - Intergenic
981701878 4:147616510-147616532 CTTAACTAGCTCAGTGAGCCTGG + Intergenic
981820579 4:148882055-148882077 CTTGAATTGCTCTATTACCCAGG + Intergenic
985392292 4:189502876-189502898 CTTTACTTGCTCTGTCACCCTGG - Intergenic
986412296 5:7493048-7493070 CTTGACTTCCTCAGTGTCTCAGG + Intronic
990263149 5:54046998-54047020 CTTCAATCTCTCAGTAACCCCGG + Intronic
990600985 5:57358512-57358534 CTTAATTTTCTCAGTGAGCCAGG + Intergenic
991117843 5:62974834-62974856 CATGCATTACTGAGTGACCCTGG + Intergenic
991318466 5:65339212-65339234 TGTGAATTTCTCAGTGACCTTGG - Intronic
991489711 5:67170650-67170672 GTTGAAATGCTCAGGGACCAAGG - Intergenic
992553432 5:77881010-77881032 CTTGTCTTGCTCTGTCACCCAGG + Intergenic
992906657 5:81353311-81353333 CCTGAATTGCTCTCTGAACCTGG - Intronic
993606604 5:89998515-89998537 CATGAATTGCTCTTTGACCCTGG + Intergenic
996939279 5:128984386-128984408 CCTGATTTGCCCAGTAACCCAGG - Intronic
999617287 5:153437729-153437751 CTTGAATTGCTATATGACCTTGG - Intergenic
1001490122 5:172149139-172149161 TTTGTATTGCTCTGTCACCCAGG - Intronic
1002299653 5:178250077-178250099 CTTGGATTGCCCGGTGCCCCAGG - Exonic
1002780593 6:362467-362489 CTTGAAGAGCTCCTTGACCCTGG - Intergenic
1005402110 6:25445558-25445580 GTTGTCTTGCTCAGTTACCCAGG + Intronic
1006304767 6:33212300-33212322 GTTGAATGGCTCGCTGACCCTGG + Exonic
1006953564 6:37846019-37846041 TTAGAATTGCTCTGTGACCCAGG + Intronic
1007382660 6:41500776-41500798 CTTGACTTGCTGTGTAACCCCGG - Intergenic
1008381160 6:50841158-50841180 CTTTAATTGCTTACAGACCCTGG + Intronic
1009540269 6:64945734-64945756 CTTGGAGTGCTCAGTGTCCTTGG - Intronic
1010240050 6:73607063-73607085 CTTGGATTGATCTGTGACCCTGG + Intronic
1012230549 6:96755860-96755882 CTTGTCTTGCTCTGTCACCCAGG - Intergenic
1012575487 6:100791875-100791897 CTTTTTTTGCACAGTGACCCTGG + Intronic
1013825728 6:114208713-114208735 CTTTACTTACTCAGTGACCCTGG + Intronic
1014222004 6:118807139-118807161 CTTGAATGTTTGAGTGACCCAGG - Intergenic
1017552957 6:155529807-155529829 CTTGTCTTGCTCTGTTACCCAGG + Intergenic
1019885206 7:3898175-3898197 CTTTAATTACTCAGTGACAGAGG + Intronic
1019919037 7:4151138-4151160 CTTGGACTGCTCAGGGACTCTGG - Intronic
1020080615 7:5283947-5283969 CCTGAAGTGCACAGTGGCCCAGG - Intronic
1022591437 7:31667355-31667377 CTTGAAATGCACAGTCACACAGG - Intergenic
1023989994 7:45123200-45123222 CTTGACTTGTGCAGTGACACAGG - Intergenic
1025111353 7:56219029-56219051 CTTGTCTTGCTCTGTCACCCAGG + Intergenic
1026860339 7:73783014-73783036 CTTGTCTTGCTCTGTCACCCAGG + Intergenic
1027361942 7:77417922-77417944 CCTGAATTTATCAGGGACCCAGG + Intergenic
1027419108 7:78002725-78002747 TTTGACTTGCTCTGTCACCCAGG - Intergenic
1027951742 7:84824939-84824961 CTTGTATTGCTCAGGGATCAAGG - Intergenic
1029038646 7:97549719-97549741 CTTGGGCTGCTCAGTGGCCCTGG - Intergenic
1029249532 7:99225974-99225996 CTGGAGTTGCTCCGTGCCCCTGG + Intergenic
1029249631 7:99226552-99226574 CTTGTCTTGCTCTGTCACCCAGG - Intergenic
1029302895 7:99598664-99598686 CTTGGACTGCACATTGACCCAGG - Intronic
1029991834 7:104969425-104969447 TTTGACTTGCTCTGTGACCCAGG - Intergenic
1032327871 7:130949189-130949211 CTGGCATTGCTCAGTGACCTTGG - Intergenic
1033932176 7:146537700-146537722 CCTGAAATGCTCACTGTCCCAGG - Intronic
1035568755 8:658898-658920 CTTCACTTGCTCTGCGACCCAGG + Intronic
1039533150 8:38282643-38282665 CTTGCCTTGCTCTGTCACCCAGG - Intronic
1041254975 8:55972158-55972180 CATGAACTGCTCAGTGTCACTGG + Intronic
1043781950 8:84347173-84347195 TTTAAATTGCTCTGTCACCCAGG - Intronic
1045851244 8:106701078-106701100 CTTGAGTTGGTATGTGACCCAGG + Intronic
1050717198 9:8543418-8543440 CTTCAATTGCTCAGTGATGATGG + Intronic
1051582157 9:18688640-18688662 TTTGAAATGCTCTGTTACCCAGG - Intronic
1056341814 9:85642237-85642259 CTTGACTTGCTCTGTAATCCAGG + Intronic
1056657213 9:88519447-88519469 CCTGAATTCTCCAGTGACCCTGG + Intergenic
1056993416 9:91431771-91431793 CTTGTGCTGCTCAATGACCCAGG + Intergenic
1057737544 9:97678373-97678395 CTAGTATTGCTCTGTCACCCAGG - Intronic
1057743723 9:97734829-97734851 CTTGACTTGCTCTGTGATCTGGG + Intergenic
1058066884 9:100558624-100558646 CTTGAATTCCTTAGTGAACTGGG - Intronic
1060093679 9:120767729-120767751 CTTTACTTGCTCATTCACCCAGG + Intronic
1060664378 9:125424081-125424103 CCTGATTTGCTGTGTGACCCAGG + Intergenic
1061161190 9:128895321-128895343 CTTGCTTTGCTCCGTGGCCCAGG - Intronic
1061630953 9:131871946-131871968 CTTGTATTTCTCAGTGATCCAGG + Intronic
1062418839 9:136469144-136469166 TTTGAATGGCTCAGTGAGACCGG - Intronic
1188446337 X:30256675-30256697 CTAGAATTGCTGAGTGACAAAGG - Intergenic
1190878336 X:54475285-54475307 ATTGATTTGCTCTGTGACCTTGG - Intronic
1192166782 X:68831543-68831565 TGTGAAGTGCTCAGTTACCCTGG + Intronic
1192215066 X:69152394-69152416 CTTCACTTGCTCTGTGACCTTGG - Intergenic
1194702290 X:97129190-97129212 CTTGTCTTGCTCTGTCACCCAGG + Intronic
1197251354 X:124219088-124219110 TTTGAGTTGCTCAGGGACCCTGG + Intronic
1198846746 X:140920380-140920402 CTGGCATTGCTGATTGACCCTGG + Intergenic
1199291625 X:146111141-146111163 ATTGAATTGCTCAGCGAACAGGG - Intergenic
1201561965 Y:15327405-15327427 CCTGAATTACTCAGTGAACAGGG + Intergenic