ID: 929894131

View in Genome Browser
Species Human (GRCh38)
Location 2:45943797-45943819
Sequence CAGCCTCCCCTGCTGCTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 532
Summary {0: 1, 1: 0, 2: 4, 3: 48, 4: 479}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929894131_929894133 9 Left 929894131 2:45943797-45943819 CCAGACAGCAGCAGGGGAGGCTG 0: 1
1: 0
2: 4
3: 48
4: 479
Right 929894133 2:45943829-45943851 TAAGTAAACAAAGGTGAATTTGG 0: 1
1: 0
2: 2
3: 28
4: 318
929894131_929894132 0 Left 929894131 2:45943797-45943819 CCAGACAGCAGCAGGGGAGGCTG 0: 1
1: 0
2: 4
3: 48
4: 479
Right 929894132 2:45943820-45943842 TGTCTGTGTTAAGTAAACAAAGG 0: 1
1: 0
2: 1
3: 27
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929894131 Original CRISPR CAGCCTCCCCTGCTGCTGTC TGG (reversed) Intronic
900109130 1:998269-998291 CAGCCTCCCCTGCCCCGGTAAGG - Intergenic
900254566 1:1691343-1691365 CATCCTTCCCTTCTGCTGTCTGG + Exonic
900263318 1:1744618-1744640 CATCCTTCCCTTCTGCTGTCTGG + Intronic
900615536 1:3564093-3564115 CTGCCTCCTCTGCTGTTGTCAGG - Intronic
900645893 1:3708631-3708653 CCCCCTCCCCTGAAGCTGTCTGG - Intronic
900698437 1:4027630-4027652 CAGCCACCCCCTCTTCTGTCGGG + Intergenic
900709101 1:4101233-4101255 CCCCCTCCCCTGCTGCTGCCTGG + Intergenic
900773060 1:4561250-4561272 CAGCCTGCCCAGCTGCTATGAGG - Intergenic
900811309 1:4803356-4803378 CAGCATCCCCAGCTGCAGGCAGG - Intergenic
901016715 1:6236060-6236082 CGGCCCGCCCTGTTGCTGTCCGG + Intergenic
901065462 1:6492124-6492146 CCGCCTCCCCCGCTGCGGTGGGG - Intronic
901822667 1:11840234-11840256 CACCCTCTCCTGGTGCTGCCTGG + Exonic
901883154 1:12205579-12205601 CACCCTGCCCTGCTGCTGCATGG - Intronic
902213455 1:14920368-14920390 CAGCCTCCCCACCCCCTGTCTGG + Intronic
902385911 1:16075810-16075832 CAGACTTCCCTGTGGCTGTCGGG - Intergenic
903034111 1:20483978-20484000 CAGCCGCTCCTGCTGCAGCCAGG + Intronic
903221606 1:21872664-21872686 CTGCCTGCCCTGCTTCTGTATGG - Exonic
903768681 1:25750514-25750536 TCACCTCCACTGCTGCTGTCTGG + Intronic
903888089 1:26552738-26552760 CAGCCTCCCAAACTGCTGGCTGG + Intronic
904379902 1:30103532-30103554 CTGCCTCCCCTCCTCCTGCCCGG - Intergenic
904548579 1:31296629-31296651 CGGCGTCGCCTGCTGCTGCCCGG + Exonic
904745650 1:32709107-32709129 ATGCCTCCCCTGCTGCCCTCTGG - Intergenic
905523905 1:38622306-38622328 GAGCCTCAGGTGCTGCTGTCAGG + Intergenic
906256534 1:44354997-44355019 CAGCCTCTCCCGCTGCTGACGGG - Exonic
906821209 1:48932099-48932121 CAGCCTCCTCTGGTGCTGGCAGG - Intronic
907011552 1:50968450-50968472 CGGCCTGCCCTTCTGCTGGCGGG - Exonic
907321590 1:53606181-53606203 AAGGCCCCTCTGCTGCTGTCTGG + Intronic
907910911 1:58825202-58825224 CCGCCCCACCTGCTGCTTTCTGG + Intergenic
909447285 1:75761187-75761209 CAACCTCCCAAGCTGCTCTCTGG - Exonic
909825281 1:80119746-80119768 CATCCTCCTTTGCTGCTGTTTGG - Intergenic
910626295 1:89311793-89311815 CTGCCTCCTCTGCTTTTGTCAGG - Intergenic
911002405 1:93180172-93180194 CTGCCTCCGGTGCTGCTGCCTGG - Exonic
911690710 1:100830732-100830754 CACCCCTCCCTGCTGCTGACAGG + Intergenic
912152549 1:106878261-106878283 CTGCCTCCTCTGCTTTTGTCAGG + Intergenic
912506742 1:110161767-110161789 CCTCCTCCCCGGCTGCTGTGGGG + Intronic
913087763 1:115455040-115455062 CGGCCTCCCAAGCTGCTGCCAGG + Intergenic
913958527 1:143322852-143322874 CACCCTGCCCTGCTGCGCTCTGG - Intergenic
914052844 1:144148232-144148254 CACCCTGCCCTGCTGCGCTCTGG - Intergenic
914126353 1:144818309-144818331 CACCCTGCCCTGCTGCGCTCTGG + Intergenic
914255316 1:145957749-145957771 CCGCCGCCGCTGCTCCTGTCTGG - Exonic
914852803 1:151327379-151327401 CAGCCTCCGCGGCCGCTGTCAGG - Exonic
914981216 1:152415990-152416012 CATCCTGCCCTCCTGCAGTCTGG - Intergenic
915100539 1:153495797-153495819 CTGTCACCCCTGCTGTTGTCTGG - Intergenic
915267694 1:154730860-154730882 CAGCACCCCCTTTTGCTGTCTGG - Intronic
915284470 1:154843965-154843987 CAGCCCCCCCTCCTACTTTCGGG - Intronic
915511824 1:156390834-156390856 CAGCCTCCTCAGATGCTGTTGGG - Intergenic
916260530 1:162837543-162837565 CAGACTTCCCTACTGCTGCCTGG + Intronic
917693654 1:177495599-177495621 CTACCTCTCCTGCTGCAGTCAGG + Intergenic
918068581 1:181118612-181118634 CAGCCTCCCAAGTTGCTGGCTGG + Intergenic
918317322 1:183332849-183332871 CACCCTCCCCTGCTGGTTTCTGG + Intronic
920041885 1:203103368-203103390 CATCTTCCCCTGCTTCTGGCAGG + Intronic
922842058 1:228650577-228650599 CTGCCTGCCCTCCTGCTGGCGGG + Intergenic
923082166 1:230668377-230668399 TAGCCAGCCCTGCTGCTGTCTGG + Intronic
923946734 1:238896281-238896303 CTGCCTCCTCTGCTTTTGTCAGG + Intergenic
1062971637 10:1653338-1653360 GAACCTCCCTTGCTGGTGTCTGG + Intronic
1063362292 10:5468512-5468534 CAGCCCCACCTGCTGCTCTCTGG + Intergenic
1064553141 10:16521861-16521883 CAGCCTCCTCTTCTCCTGGCAGG - Exonic
1064654524 10:17543909-17543931 CAGCCTCCCTTGCAGCTAGCTGG - Intergenic
1065023513 10:21519709-21519731 CAGCTTCCCCTGCTCTGGTCTGG + Intronic
1065192303 10:23224237-23224259 CAGCCTCCGCTGCTGATACCCGG + Intronic
1065805217 10:29387779-29387801 CAGATGCCCCTGGTGCTGTCGGG - Intergenic
1065917291 10:30364657-30364679 GAGCCTCCCCTGCTCCTGCCTGG + Intronic
1067017704 10:42770312-42770334 CAGGCTTCCCTGCTGATTTCAGG + Intergenic
1067431710 10:46249786-46249808 CAGGGCCCCCTGCTGCTGCCTGG + Intergenic
1067441708 10:46312388-46312410 CAGGGTCCCCTGCTGCTGTCTGG - Intronic
1069798714 10:71069337-71069359 GTGCCTGCCCTGCTGCTGGCTGG + Intergenic
1069987196 10:72292495-72292517 CAGCCTCTGCCGCTGCTCTCAGG - Intergenic
1070156679 10:73839757-73839779 CAGCCAGCCCTGCAGCAGTCTGG + Intronic
1070214519 10:74363244-74363266 CAGCCTCTCCTGCTGTAGTCAGG - Intronic
1070769651 10:79074803-79074825 CAGCCTGCCCGGCTGCTCCCTGG - Intronic
1070840511 10:79484186-79484208 CAGCCTCCTCCACAGCTGTCAGG + Intergenic
1070955789 10:80462496-80462518 CAGCCTTTCCTGCTGCTGAGGGG - Intronic
1071102483 10:82055118-82055140 CAGTCTCAGCTGCTGCTGACAGG + Intronic
1071376758 10:85013560-85013582 CAGCCTCCCATAGTGCTATCTGG + Intergenic
1072731865 10:97851645-97851667 CAGCAGCCTCTGCTGCAGTCTGG - Intronic
1073423637 10:103443161-103443183 CAGCTTCTCCTGCTCCTCTCTGG - Exonic
1073467807 10:103704500-103704522 CAGAATCCCTTGCTGCTGCCAGG + Intronic
1073931218 10:108578995-108579017 CAGCCTCCCCAGTAGCTGGCTGG - Intergenic
1075625894 10:123964373-123964395 CAGCCAGCCCTGCTTCTGGCAGG + Intergenic
1075693760 10:124418795-124418817 CCGCCTCCCCCGCCGCTGTCAGG + Intronic
1076232816 10:128835680-128835702 CAGCATCTCCTGCTGCTCACAGG + Intergenic
1076241653 10:128913113-128913135 CTCCCTCCCCTGCAGCTGACTGG + Intergenic
1076461439 10:130650019-130650041 CAGCATGCCCAGCTGCTGTACGG + Intergenic
1076731976 10:132443853-132443875 CAGACACCCCAGCTGCTGGCTGG - Intergenic
1076746936 10:132519269-132519291 CCGCCTCCCCCTCTGGTGTCCGG + Intergenic
1077190748 11:1255133-1255155 CAGCCATCCTTTCTGCTGTCGGG - Exonic
1077349316 11:2084957-2084979 CAGCCTCCCCTCCTCAGGTCAGG - Intergenic
1077858528 11:6154097-6154119 CAGCCCCCACTGCTGGTGGCAGG + Intergenic
1077908964 11:6557945-6557967 CAGCATGGCCTGCTGCTCTCGGG + Exonic
1078735068 11:14012204-14012226 CAGCCTCTCCTGCTGGCTTCAGG + Intronic
1079689112 11:23400297-23400319 CACCCTCCGCAGCTGCTGGCTGG - Intergenic
1080459172 11:32438502-32438524 CTGCCTCTCCTTCGGCTGTCTGG - Intergenic
1080688733 11:34537798-34537820 CAGCATCCCCTGCTGGGGACAGG + Intergenic
1080937889 11:36882563-36882585 CAGCCACCACTGCTTCTATCAGG - Intergenic
1081650972 11:44824051-44824073 CAGCTCCACCTCCTGCTGTCGGG + Intronic
1082785807 11:57315805-57315827 CTGCCTCCCCTTCTGCTATCAGG + Intronic
1083733873 11:64668690-64668712 CCCCCTCCCCTGCTGCCCTCTGG - Intronic
1084199411 11:67545458-67545480 CAGCGTCCCCTGCTGGTACCAGG + Intergenic
1084316973 11:68351282-68351304 TAGCCACCCCTGCAGCTGCCGGG + Intronic
1084455828 11:69267732-69267754 CAGACTCCCTGGCTGCTGGCTGG - Intergenic
1084790489 11:71472674-71472696 GAGCCACCCTGGCTGCTGTCTGG - Intronic
1084958644 11:72704476-72704498 CAGCCTGGCCTGCTGGTGGCTGG + Intronic
1085030211 11:73266497-73266519 CAGCCTCCCTTTCAGCTCTCAGG - Intronic
1085982120 11:81737502-81737524 CTGCCTCCACTGCTGCTGATGGG - Intergenic
1086324714 11:85686413-85686435 CTTCCTCCCCTGATGCTGGCTGG - Intergenic
1087664761 11:101031374-101031396 CTGCCTTCCCAGCTGCTGTCTGG + Exonic
1088797039 11:113273292-113273314 CAAGCGCCCCTGCTGGTGTCGGG + Intronic
1089208605 11:116785523-116785545 CAGCATCTCTTCCTGCTGTCGGG + Exonic
1089773276 11:120818283-120818305 CAGGCTACCCTGCCCCTGTCGGG + Intronic
1090066246 11:123506163-123506185 CAACCTCCCCCGCTGCACTCTGG - Intergenic
1090519842 11:127466325-127466347 CAGCATCCACTACTTCTGTCTGG - Intergenic
1091296614 11:134478259-134478281 CAGCCTCCTCAGCAGCTGTGCGG - Intergenic
1091310659 11:134573210-134573232 CAGCCTCCCTGGCAGCTGCCTGG - Intergenic
1091750551 12:3019149-3019171 CAGCCTCCGCTGCCTCTGCCAGG + Exonic
1091917523 12:4280576-4280598 CTTCCTTCCCTTCTGCTGTCTGG + Intronic
1095951571 12:47784522-47784544 CAGGCTCTCCTGATGCTCTCAGG - Intronic
1096218126 12:49809567-49809589 CACCCTCCCCAGCTGCTTTCTGG + Intronic
1096534828 12:52264840-52264862 CTGCCTCCTCTGCTTTTGTCAGG - Intronic
1096536731 12:52279647-52279669 CCTCCTCCCCTCCTGCTGTGAGG + Intronic
1096758889 12:53823263-53823285 CACTCTCCCCTGCTGCTGGCTGG - Intergenic
1097017440 12:55997458-55997480 CTGCCTCCACTCCTTCTGTCTGG + Intronic
1097055853 12:56248722-56248744 CTGCCTCCCCTCCTGCAGGCCGG + Intronic
1097282183 12:57851946-57851968 CAGCCCCCTGTGCTCCTGTCAGG + Intergenic
1098726483 12:73974484-73974506 CAGCCTCCCCAGTAGCTGACAGG + Intergenic
1099600151 12:84725201-84725223 CAGCCTCCCAAGGTGCTGGCAGG + Intergenic
1099916147 12:88896155-88896177 AAGTCTCCTCTGCTGCTCTCAGG + Intergenic
1101753320 12:107601263-107601285 CAGCCTCTCCTGCCTCTGTGAGG + Intronic
1102112338 12:110373924-110373946 CATCCTCCCCTGCTCCAGCCAGG - Exonic
1102168568 12:110824860-110824882 CTGCCTTCCCTCCTGCTGTGTGG + Intergenic
1103760875 12:123249539-123249561 CACCCTCCACAGCTGCTGGCCGG + Intronic
1104198752 12:126567179-126567201 CATCCTCCGCAGCTGCTGGCCGG - Intergenic
1104340958 12:127948001-127948023 CAGGCTCCCTTGCTGTTGTGTGG + Intergenic
1104365418 12:128172399-128172421 CAGCTTCCAGTGCTGCTGTTGGG - Intergenic
1104619437 12:130299839-130299861 CACCCGGCCCTGCTGCTGTGAGG + Intergenic
1104694412 12:130852513-130852535 CAGGCCCCGCTGCTGCTGTCAGG - Intergenic
1104745327 12:131206945-131206967 CGGTCTCCCCAGCTGCTGGCGGG - Intergenic
1104789012 12:131470161-131470183 CGGTCTCCCCAGCTGCTGGCGGG + Intergenic
1104860094 12:131919088-131919110 TACCCTCCCCTGCTGCAGCCCGG - Intronic
1104906257 12:132215019-132215041 CACCCTCCGCTGGTGCTGACTGG + Intronic
1104971244 12:132531786-132531808 CAGCCTCCCGTGTTGCTGAGTGG + Intronic
1105705164 13:22963819-22963841 GAGCCTCGCCTGCTGCTGACGGG + Intergenic
1106837424 13:33650060-33650082 CAGCCTCAACTGCTTCTGACTGG + Intergenic
1107661404 13:42643192-42643214 CATCCTCCCCTGCTAGTGCCAGG - Intergenic
1111146709 13:84191368-84191390 CCTCCTCCACTGCTGCAGTCTGG + Intergenic
1111249869 13:85589156-85589178 CTGCCTCCTCTGCTTTTGTCAGG - Intergenic
1112326794 13:98446956-98446978 CAGAATCGCCTGCTGGTGTCGGG - Intronic
1113582215 13:111437702-111437724 CTGCCTCCCCTGGAGCTGTGTGG + Intergenic
1113906552 13:113822016-113822038 CAGCCTCTCCTGCAGCTGCGCGG + Exonic
1114041751 14:18685168-18685190 CAGTCCCACCTGCTGCTGTAGGG - Intergenic
1114081397 14:19203942-19203964 CAGCCCCCACAGCTGCTTTCAGG - Intergenic
1117072340 14:52068594-52068616 CTGCCTGCCCCGCTGCTGTAGGG - Intronic
1118094580 14:62521935-62521957 CAGCCTCCACTGCTGAAATCCGG + Intergenic
1118322935 14:64763956-64763978 CAGGCACCCCTGCTCCTGTCTGG - Intronic
1119574113 14:75702847-75702869 CATCCTCCCAGGCTTCTGTCTGG - Intronic
1119600742 14:75974835-75974857 CAGCCTCCCAAGGTGCTGGCTGG - Intronic
1119766813 14:77195673-77195695 CACCTTCCCTTGCTGCTGTGGGG - Intronic
1119916640 14:78408199-78408221 CACCCTCCCCTGCTTCTCTAGGG + Intronic
1121011582 14:90523104-90523126 CAGCCTCCTGCGATGCTGTCAGG - Intergenic
1121784697 14:96648903-96648925 CAGGCTCCCATGCTGCTCCCAGG + Intergenic
1121917433 14:97848659-97848681 CAGTCTCCCCTGCTCCTCCCAGG + Intergenic
1122055337 14:99094204-99094226 CAGCCTTGCCAGCTGCAGTCAGG + Intergenic
1122201718 14:100126795-100126817 CCGACTCCCATGCTGCTGCCAGG + Intronic
1123061846 14:105598057-105598079 CGGCAGTCCCTGCTGCTGTCCGG + Intergenic
1123086586 14:105719788-105719810 CGGCAGTCCCTGCTGCTGTCCGG + Intergenic
1123115722 14:105893183-105893205 CAGCCTCCCCTGCTAGGGGCTGG - Intergenic
1124006510 15:25799186-25799208 CAGACTTCCCTGATGGTGTCTGG + Intronic
1124216732 15:27813324-27813346 CAGCCCCTCCTGCTGGGGTCAGG - Intronic
1124613294 15:31223750-31223772 CTGGGCCCCCTGCTGCTGTCAGG - Intergenic
1125338638 15:38653038-38653060 CAGCCTCCTCTGCCCTTGTCTGG + Intergenic
1125647093 15:41281989-41282011 CAGTCTACTCTGCTGCTGCCTGG + Intergenic
1125666814 15:41437375-41437397 CAGCCTCCCGAGTAGCTGTCAGG - Intronic
1126351637 15:47750537-47750559 GAGTCTCCACTGCTCCTGTCAGG + Intronic
1127730024 15:61791343-61791365 CAGCCTCCTCTGCTGCCGAGTGG + Intergenic
1128307562 15:66609973-66609995 CAGCCTCACCTGCAGCTTGCTGG - Intronic
1128941294 15:71790063-71790085 AAGCCGCCACTTCTGCTGTCAGG - Intergenic
1129454464 15:75669381-75669403 AAGGCTCCCCTGCCGCAGTCTGG + Intergenic
1129888761 15:79057213-79057235 CAGCCATCCCTGCTGCAGGCTGG + Intronic
1130044108 15:80430803-80430825 CAGGCTGCCCAACTGCTGTCAGG - Intronic
1130192222 15:81748406-81748428 CACCCTTCCCTGCTGCTGACAGG + Intergenic
1130330487 15:82918480-82918502 CAGCCTCACCTGCTGAGGTGGGG - Intronic
1130527703 15:84721516-84721538 CAGCTGTCCCTGCAGCTGTCTGG - Intergenic
1130960889 15:88657947-88657969 CTGCCGCACCTGCTGCTCTCCGG - Intergenic
1132016336 15:98320729-98320751 CAGACTGCCCAGCTACTGTCAGG - Intergenic
1132336316 15:101050654-101050676 CCACCTTCCCTGATGCTGTCTGG - Intronic
1132611998 16:821832-821854 CACCCTCCCCAGCTCCTGGCTGG - Intergenic
1132732880 16:1371510-1371532 CACCCTCACCTGCTGCTCCCAGG + Intronic
1132755461 16:1482357-1482379 CAGCCTCCTCAGATGCTTTCTGG - Intergenic
1136129616 16:28211672-28211694 CAGCCTCCCCCGCGGGGGTCGGG - Exonic
1136295724 16:29301055-29301077 CAGCCTCCCCAGGTGCTCGCCGG - Intergenic
1138230030 16:55329959-55329981 CAGTGTCCCCTGATGCTGGCTGG + Intronic
1138874838 16:60936782-60936804 CAGCCTCTCCTGCTGATACCCGG + Intergenic
1139364782 16:66426906-66426928 CTGCCCCGCCTGCTGCTGTGTGG + Intergenic
1139909794 16:70390658-70390680 CCCTCTCTCCTGCTGCTGTCTGG + Intronic
1140330321 16:74050065-74050087 GGGCCTCCCCTTCTGCTCTCAGG + Intergenic
1141694186 16:85612147-85612169 GAGCCTCCCCTGCCGCCTTCTGG - Intronic
1141823513 16:86463682-86463704 CAGCCCTCCCAGCTGCTGCCTGG - Intergenic
1141948351 16:87325082-87325104 CCGCCTCACCTGCTGGTGTTGGG + Intronic
1142372669 16:89691726-89691748 GAGCCTCCCCTGCTGCAGGAGGG - Intronic
1142374104 16:89697943-89697965 GAGGCTCCCCTGCTGCTTACAGG - Exonic
1142656655 17:1399373-1399395 CAGGCTCCCATGCTGCGATCGGG - Intronic
1143033514 17:3981529-3981551 CCGCCTCCCCTGGTGCTGTGTGG + Intergenic
1143067779 17:4263628-4263650 GAGCCTCCCGTGCTGCCCTCGGG + Exonic
1144636459 17:16912389-16912411 CACCCTCCTTGGCTGCTGTCTGG + Intergenic
1146257251 17:31398779-31398801 CAGCCTCTCCTCCCTCTGTCCGG - Intronic
1146432422 17:32810214-32810236 CAGCCTCCCTGTCTGCTGTCTGG - Intronic
1146661208 17:34666246-34666268 CAGCCTCCTCTCCTGCTGGTAGG - Intergenic
1147258203 17:39194637-39194659 CACCCTCCCCTGCTGCCTGCTGG - Intronic
1147587792 17:41662689-41662711 CTTCCTTCCCTGCTGCTGTTAGG + Intergenic
1147647073 17:42040327-42040349 CAGCGTCCGCTGCTGGCGTCAGG + Intronic
1147948442 17:44093441-44093463 CAGCATCTCCTGCTGCTGCTTGG + Exonic
1148330570 17:46811603-46811625 CACCCTGTCCTGCTGCTGCCTGG - Intronic
1148669518 17:49400130-49400152 CACTCTCTCCTGCTTCTGTCTGG - Intronic
1148691286 17:49528419-49528441 CAGCCTCCCCACTTGCGGTCTGG + Intergenic
1148862728 17:50613001-50613023 CACCCTCCTTTGCTGCTCTCTGG - Intronic
1149663864 17:58352306-58352328 CAGCCTCCCCGCCTGCTGGCGGG - Intronic
1149864841 17:60145562-60145584 CAGCCTCCACAGGTGCTGGCAGG + Intergenic
1150133307 17:62680688-62680710 CAGGCTCGCCTGCTGCCGCCTGG + Intronic
1150569617 17:66374438-66374460 CAGACTCCTCTGCTGCTTACAGG + Intronic
1150824908 17:68465846-68465868 CATCCTCTACTGCTGCTGTAGGG - Intergenic
1151352903 17:73542284-73542306 AAGCTGCCCCTGCTGCTGTCAGG - Intronic
1151656021 17:75496373-75496395 CTTTCTCCCCTGCAGCTGTCAGG + Exonic
1151708345 17:75784750-75784772 CAGCAACCCCTGCTGCCGTGTGG + Exonic
1152237697 17:79147089-79147111 CAGCCTGCTGTGCTGCTGTCTGG + Intronic
1152293383 17:79453388-79453410 CAGCCTCCCCATCTGCCGCCAGG - Intronic
1152502346 17:80720847-80720869 CGGCCGCTTCTGCTGCTGTCTGG + Intronic
1152562021 17:81083356-81083378 GGGCCGCCCCTGCTGCTGGCAGG - Intronic
1152822243 17:82443355-82443377 CCGCCTCCCTTGCTGATGCCAGG - Exonic
1152934892 17:83130672-83130694 CAGCCTCGCCTGCTGCTGGCGGG - Intergenic
1153627834 18:7038487-7038509 CGCCCGCCCCTGCTGCTCTCAGG - Intronic
1155227511 18:23741866-23741888 CAGCCTCCCAAAGTGCTGTCAGG - Intronic
1155308470 18:24501485-24501507 CTGCTTCCTCTCCTGCTGTCTGG - Intergenic
1155455251 18:26005075-26005097 CAGCCCACACTGCAGCTGTCAGG - Intergenic
1156459675 18:37314710-37314732 CAGCCTCCCCTGCAGCTTGTGGG + Intronic
1157475466 18:48020951-48020973 CTGCCTCCTCTCCTCCTGTCTGG + Intergenic
1157552305 18:48590220-48590242 CAGCCTCAGCTGCTGCTCTGGGG + Intronic
1157611226 18:48957289-48957311 CAGCCTCCACCCTTGCTGTCTGG - Intergenic
1158158349 18:54451088-54451110 CAGCCTCCCTTGCAGCTGGATGG - Intergenic
1160032998 18:75278655-75278677 GAGCCTGGCCTGCTGCTGCCTGG + Intronic
1160970069 19:1764023-1764045 CAGCCTCCCCAGCCCCTTTCTGG + Intronic
1161427619 19:4212578-4212600 GAGCCTCCACTGCTGCTCCCAGG + Exonic
1161574671 19:5048891-5048913 CTGACCCCCCTGCTTCTGTCTGG - Intronic
1161586199 19:5107143-5107165 CAGCTTCCCCGGCAGCTCTCAGG + Intronic
1162107002 19:8375905-8375927 CACCCTCCGCAGCCGCTGTCCGG - Intronic
1162138303 19:8569719-8569741 CAGCCACCACTGATGCTGCCTGG - Intronic
1162337900 19:10072976-10072998 CTGCCTCACATGCTGTTGTCTGG - Intergenic
1162922730 19:13913046-13913068 CAGCCTCCCCTGCCCCAGTGAGG - Intronic
1163434745 19:17288763-17288785 CAGCCTCCCCTGTTGCTTCTGGG + Intergenic
1163648529 19:18503798-18503820 GAGCCTTCCCTGCTGCAGGCTGG + Intronic
1164752080 19:30664501-30664523 GAGGCTCCACTCCTGCTGTCTGG + Intronic
1165744913 19:38224757-38224779 TAACCTGCACTGCTGCTGTCAGG - Intronic
1166109987 19:40616008-40616030 CTGCCTCCCTCGCTTCTGTCTGG - Intronic
1166297589 19:41896592-41896614 CATGCTCCTCTGCTGCTCTCTGG + Intronic
1166385116 19:42376431-42376453 CTGGCACCCCTGCTGCTGACAGG + Exonic
1167466024 19:49651527-49651549 CCGCCGCCCCTGCTGCCGCCCGG + Exonic
1168522148 19:57060907-57060929 CACCCTCCCCTGCTCCAGTCTGG + Intergenic
924997964 2:381404-381426 GAGGCTGCCCTGCTGCTGCCTGG + Intergenic
925362796 2:3291125-3291147 CAGGCATCCCTGCTGCTGTGGGG - Intronic
925532974 2:4884346-4884368 CACCCTCCACAGCTGCTGGCCGG - Intergenic
926229742 2:10993262-10993284 CAGCCTCCCCGCCTGCTCCCTGG - Intergenic
926373984 2:12208831-12208853 CAGATTCCCCAGCTGATGTCTGG - Intergenic
926778010 2:16441144-16441166 CCACATCCCCTGCTTCTGTCGGG + Intergenic
927694399 2:25230420-25230442 CAGCTTCCCCTGCAGGTGCCAGG - Exonic
929894116 2:45943735-45943757 AAGCCTCCTCTCCTGCTTTCTGG + Intronic
929894131 2:45943797-45943819 CAGCCTCCCCTGCTGCTGTCTGG - Intronic
931385420 2:61793789-61793811 CGGCCACACCTGCTGCTGTGAGG + Intergenic
932667668 2:73709992-73710014 CACCCTCCTCTGCAGCTGCCAGG - Intergenic
933954158 2:87353316-87353338 CACCCTGCCCTGCTGCGCTCTGG + Intergenic
934238353 2:90249536-90249558 CACCCTGCCCTGCTGCGCTCTGG + Intergenic
934274836 2:91567174-91567196 CACCCTGCCCTGCTGCGCTCTGG - Intergenic
934624282 2:95834495-95834517 CACCCGCCCCTGCTGTTCTCAGG - Intergenic
934775116 2:96932380-96932402 CAGCCTCCACGGCTGCTGATAGG - Intronic
934780778 2:96968446-96968468 GAGCCTCCCCAGCCCCTGTCTGG + Intronic
935137546 2:100321370-100321392 CCGCCTCCCCTACACCTGTCCGG - Intronic
935205772 2:100895558-100895580 CAGCCACCCCTGCTGCTGGCAGG - Intronic
936144033 2:109967258-109967280 TAGTGTCCCCTGCTGCTTTCAGG + Intergenic
936180715 2:110265219-110265241 TAGTGTCCCCTGCTGCTTTCAGG + Intergenic
936200654 2:110404211-110404233 TAGTGTCCCCTGCTGCTTTCAGG - Intronic
936948211 2:117950453-117950475 CAGCCTCCCCCACAGGTGTCAGG + Intronic
937346757 2:121130737-121130759 CAGAGCCCCCTGCTTCTGTCAGG + Intergenic
937492799 2:122387497-122387519 CAGCTTCCCCTTCAACTGTCTGG - Intergenic
938298186 2:130191641-130191663 CAGCCTGCCCTGCTGGCGTGGGG - Intergenic
939813672 2:146867724-146867746 GAGCCTCCCCTTTTGCTGTCAGG + Intergenic
940888426 2:159011820-159011842 CAGCCTGCCCTCCTGCTTCCTGG + Intronic
942225940 2:173816095-173816117 CAGCCTCCCATGCAGCTGGATGG - Intergenic
942567330 2:177280090-177280112 AAGCCAGCCCTGCTGATGTCTGG - Intronic
944206703 2:197164590-197164612 CCCCCTCCCCTGCTGCTGCGGGG + Intronic
944615010 2:201451416-201451438 CAGCTTCGGCTGCTGCTTTCAGG - Exonic
944838528 2:203603266-203603288 CAGCCTCCCCTACTGACGTGTGG - Intergenic
945393274 2:209291002-209291024 CATCCTCACCTCCTGCTGTGTGG + Intergenic
945810369 2:214542469-214542491 AAGCTTCTCCTGCTGCTGCCTGG + Intronic
946253959 2:218430054-218430076 CAGCCTTCCCTGCCTCTGCCTGG - Intronic
946402042 2:219473254-219473276 CACCGTGCCCTGCTGCTTTCAGG - Intronic
947119491 2:226800060-226800082 CAGACTCCCCTCGTGCTTTCGGG - Intergenic
947715568 2:232337392-232337414 CAGGCTCCCTTGGTGCTGCCGGG - Intronic
947954736 2:234178892-234178914 CAGGCTCTCCTGCTGCACTCTGG + Intergenic
947980581 2:234405321-234405343 TAGCCTCACCTGCAGCTGGCTGG - Intergenic
948116973 2:235500564-235500586 CAGCCTGCCCTGCAGGTTTCAGG + Intronic
948423040 2:237872236-237872258 CGGCCTGCCCTGGTGCTGCCGGG + Intronic
948486644 2:238285497-238285519 CAGCCTCCACTGCCACTGCCAGG + Intronic
948632276 2:239309888-239309910 CCCCCTCCCATGCTGCTGCCTGG + Intronic
948707364 2:239803373-239803395 CTGCCTCCATTGCTGCTGCCTGG + Intergenic
949072535 2:242034442-242034464 CAGCCTCCCCTGCAGGAGTGAGG + Intergenic
1168777860 20:462592-462614 CAGCCTCCCCCGCCGCCGGCCGG - Intergenic
1169875131 20:10289031-10289053 GAGGCTCCCGTGCTGCTGTGAGG - Intronic
1170746853 20:19107230-19107252 CAGAGTCACCTGCTGCTGTTAGG + Intergenic
1170843262 20:19940893-19940915 CAACCTCCCCAGCTATTGTCTGG + Intronic
1170897914 20:20432929-20432951 GAGCCTCCGCTCCAGCTGTCTGG + Intronic
1171365322 20:24618460-24618482 CAGCCTCTCCTTCTCTTGTCGGG + Intronic
1172442183 20:34973607-34973629 CAGCCTCTCCCGCTGCTGATGGG + Intergenic
1172833014 20:37852671-37852693 CACCCTCCCCTCCTGCAGTCAGG + Intronic
1173195025 20:40907035-40907057 CAGCCTGCCCTGCTGAAGTATGG + Intergenic
1173401149 20:42727098-42727120 AAGACTGCCCTGCTGCTGACAGG + Intronic
1173782921 20:45771583-45771605 CAGCCTCCACTGCTCCCGTGGGG - Intronic
1173828005 20:46059310-46059332 CAGCCACACCTGACGCTGTCTGG - Intronic
1173882143 20:46423535-46423557 TGGCTTCCCCGGCTGCTGTCTGG - Intronic
1174274040 20:49390646-49390668 CAGCCTCCCCTGCAGCTGGATGG + Intronic
1175403876 20:58714999-58715021 GAGCCTTCCATGCTGCTGGCTGG - Intronic
1176052317 20:63126379-63126401 CAGCCCTACCTGCTGCTGCCAGG - Intergenic
1176130445 20:63494577-63494599 CAGCCTCCCACGCGGCTGGCCGG - Intronic
1178222906 21:30681270-30681292 GAACCTCCCCTGCTTCTCTCAGG - Intergenic
1178852739 21:36226845-36226867 CAGCCTCCCAAGGTGCTGGCTGG + Intronic
1179067563 21:38040287-38040309 CCTCCTCTCCTGCTGATGTCAGG - Intronic
1179080967 21:38170393-38170415 CAGCCTCCTCTGCTGGTGAGAGG - Intronic
1179861489 21:44191801-44191823 CATCCTCACCTCCTGCTGTGCGG - Intergenic
1179999544 21:44989117-44989139 CTGCCTGCCCTGCTGCTCCCCGG + Intergenic
1180035872 21:45248935-45248957 CTGCCCCCTCTCCTGCTGTCAGG - Intergenic
1180071690 21:45440016-45440038 CAGCCTCCGCTGGCGCTTTCTGG - Intronic
1180499377 22:15918744-15918766 CAGCCCCCACAGCTGCTTTCAGG + Intergenic
1180535672 22:16391537-16391559 GGGCCGCCCCTGCTGCTGGCAGG - Intergenic
1180855900 22:19044578-19044600 CTGCTTGCTCTGCTGCTGTCGGG - Intronic
1180985753 22:19903164-19903186 CAGCCTCTCCTGCAGCTGCCAGG - Intronic
1182370308 22:29805923-29805945 CCACCTCCCCTCCTGCTGTGAGG + Intronic
1182494756 22:30698119-30698141 AAACCCACCCTGCTGCTGTCAGG - Intronic
1182698508 22:32212204-32212226 CAGCCCCCACTGCAGCTGTGAGG - Intergenic
1182926124 22:34126858-34126880 CAGCCTCCCATTCTGCTCCCGGG + Intergenic
1183320764 22:37163812-37163834 CTTCGTCCCCTGCTGCTTTCAGG - Intronic
1183385988 22:37514930-37514952 CAGCCTCACTTGCTGCTGGAGGG + Intronic
1183406174 22:37631723-37631745 CAGCTTCCCCCGATGCTGTGTGG - Intronic
1183569025 22:38638230-38638252 CTGCCTCCCCTGCAGCAATCTGG - Intronic
1183579570 22:38715870-38715892 CTCCCTCTCCTGCTGATGTCTGG + Intronic
1183602468 22:38847975-38847997 CTGCCTCACCTGCTGCTGAGTGG + Intergenic
1184103199 22:42352434-42352456 CAGCCTCCCCTGCGCCCGCCCGG + Intergenic
1185043629 22:48518092-48518114 CAGGCAGCCCTGCTGCTTTCCGG + Intronic
1185109332 22:48892273-48892295 CAGCCTCACCTCCTGCCTTCTGG - Intergenic
949927753 3:9055543-9055565 CTCCCTCCCCTGCAGCTGTGGGG - Intronic
950658814 3:14453915-14453937 CAGCCACCCTAGCTGCTATCTGG - Intronic
950868748 3:16211062-16211084 CAGCCTCGCCTGCTGTGCTCTGG + Intronic
951919839 3:27842289-27842311 CAGCCACCATTGCTGCTGTTGGG + Intergenic
953710395 3:45265028-45265050 CATTCTCCCCAGCTGCTGGCGGG - Intergenic
953789666 3:45937670-45937692 CAGCCTCCGCTGCTCTTCTCAGG + Intronic
953920198 3:46946548-46946570 CAGCCTCACCTGATGCTGTCAGG + Intronic
954263999 3:49459497-49459519 CTTCCTCACCTGCTGCTGCCAGG - Intergenic
954623131 3:52006908-52006930 CATCTTCCCCAGATGCTGTCAGG - Intergenic
954658284 3:52211381-52211403 CTGCCACCCATGCTGCTGGCTGG + Exonic
956438822 3:69260415-69260437 CACCCTCCGCAGCTGCTGGCTGG - Intronic
956727472 3:72168273-72168295 CAGCCTCACCTCCGGCTGTGCGG - Intergenic
956869505 3:73402885-73402907 CAGCCTCTCCAGCTGATGTTAGG - Intronic
957292804 3:78298420-78298442 CAGCCTCCTCTGATTCTCTCAGG + Intergenic
957886777 3:86297879-86297901 CAGCCTCCGCTGCTGATACCCGG + Intergenic
959378458 3:105613379-105613401 CTGACTCCCCTGCTTCTCTCAGG + Intergenic
959612039 3:108305928-108305950 CAGCCCCAGGTGCTGCTGTCTGG + Intronic
959946076 3:112126601-112126623 CAGTATCTCCTGCAGCTGTCAGG + Intronic
960939093 3:122922060-122922082 CAGCCTCCACGGCTGCTACCTGG - Exonic
962712725 3:138101411-138101433 CAGCCTCCCCCGCTGGGCTCTGG + Intronic
963752553 3:149197901-149197923 CAGGCTCACCTCCTGCTGTGTGG + Intronic
964003561 3:151806027-151806049 CTGCCTCCTCTGCTTTTGTCAGG + Intergenic
966760486 3:183413691-183413713 CTGCCTCCTCTGCTTTTGTCAGG + Intronic
966830366 3:184002791-184002813 CAGGCTACCCTGCTGTTGTCCGG - Intronic
967126972 3:186432911-186432933 CAGACTCCCCTCCTCCTGTGGGG + Intergenic
967320402 3:188189695-188189717 CAGCGTCACCTGCTTCAGTCTGG + Intronic
967933096 3:194704910-194704932 CAGCTTCCCCCGCAGATGTCTGG + Intergenic
967948529 3:194822961-194822983 CAGCATCCAATGCTGCTCTCAGG + Intergenic
968233137 3:197015964-197015986 CATCCTCCCCCGCTGCGGCCAGG + Intronic
968920624 4:3520599-3520621 CAGCCTCACCTGCTGCCATAGGG + Intronic
969256929 4:6008491-6008513 CAGCCGCCACTGCTGCCGCCTGG + Intergenic
969409995 4:7021875-7021897 CACCTTCCCCTGCTGCCCTCAGG - Intronic
969579786 4:8058037-8058059 CAGCCCCCGCTTCTGCTGTGAGG - Intronic
970102195 4:12537489-12537511 CATGCAGCCCTGCTGCTGTCTGG - Intergenic
970599125 4:17627080-17627102 CAGCCTCCCGAGTAGCTGTCAGG + Exonic
971043351 4:22778815-22778837 CACCCTCCACAGCTGCTGGCCGG + Intergenic
975489828 4:74976253-74976275 CATTCTCCCCTGCTGGTGCCAGG + Intronic
975650496 4:76588397-76588419 CAGGCTCCCTGACTGCTGTCTGG + Intronic
976555122 4:86441825-86441847 AAGCCTCTCCTGCTGCTTCCTGG + Intronic
976775429 4:88700766-88700788 CAGCCTACCCTGCAGATTTCGGG - Intronic
977953151 4:102997045-102997067 CAGCCTCCCATAGTGCTGACAGG + Intronic
979644628 4:123053693-123053715 CAGCCCCTCCTGCTGCAGTCTGG - Intronic
981004551 4:139861670-139861692 CAGCCTCTCCAACTCCTGTCGGG + Intronic
981138284 4:141237765-141237787 CAGTTGCCCCTGCTGCTGACAGG - Intergenic
982287334 4:153748768-153748790 CATCCTCTCCTGCTGCAGGCTGG + Exonic
982682197 4:158444835-158444857 CAGCAACTCCTGCTGCTGGCAGG - Intronic
982784228 4:159523342-159523364 CAGCCACCCCGTCTGCCGTCTGG + Intergenic
983316080 4:166134344-166134366 CATTTTCCCCTGCTGTTGTCAGG - Intergenic
983940241 4:173529421-173529443 CAGCCCCCTCTGCGGCTGCCGGG - Exonic
985438980 4:189964590-189964612 CAGCCTCCACTGCTGATACCTGG + Intergenic
985509652 5:305614-305636 CATCCTTCCCTGCTGGTGTGTGG + Intronic
985701866 5:1378302-1378324 CAGCCTCCCATGCTCCTTACTGG + Intergenic
985886454 5:2683905-2683927 CAGCCCTCCCTGCTGCTGCCAGG + Intergenic
985993484 5:3583132-3583154 CAGCCTCACCTACTGCTCACTGG + Intergenic
986333845 5:6738187-6738209 CAGCCTTCCCTACTGCTGACTGG + Intronic
987636171 5:20545197-20545219 CAGCCTCTGCTGCTGCTTTCAGG + Intronic
988537648 5:32083425-32083447 CAGCCTCTCCAGGTGATGTCGGG - Intronic
988556096 5:32237421-32237443 TAGCCTCTTCTGCTTCTGTCTGG - Intronic
989243296 5:39224422-39224444 GAGCTTCATCTGCTGCTGTCTGG - Intronic
989336584 5:40324333-40324355 AATGATCCCCTGCTGCTGTCTGG + Intergenic
989956594 5:50367612-50367634 CAGCCTCCGCTGCTGATACCCGG + Intergenic
990881228 5:60541400-60541422 CAGTCTCCCCTGCTGGTGGTAGG + Intergenic
992590912 5:78294845-78294867 CTGCCTCCCCTTCCGCAGTCCGG - Intergenic
994043714 5:95285027-95285049 CAGCCGCCCCCGCCGCTGACAGG - Intergenic
994509839 5:100689087-100689109 CACCCTCCACAGCTGCTGTCCGG + Intergenic
994994518 5:107042933-107042955 TAGCCTCCCCAGCTTCTGGCAGG - Intergenic
996470288 5:123852535-123852557 CAGCCCCTCCTGCTGCAGACCGG - Intergenic
996479234 5:123955123-123955145 AAGCTTCCTCTGCTGCTCTCAGG - Intergenic
998565643 5:143213694-143213716 CAGCCTGCCCTCCCGCTGTTTGG + Intronic
999447795 5:151654650-151654672 CACCCTCCCCTTCTCCTCTCAGG + Intergenic
999711775 5:154324228-154324250 CAGTGTCCCCAGCTGCTGGCAGG + Intronic
999720244 5:154394154-154394176 CACCCTCCCCTGCAGAAGTCAGG + Intronic
1000160630 5:158594020-158594042 CTGCCTCCCCTGCTGATGCCAGG + Intergenic
1000627245 5:163553361-163553383 CAGCCTCCCCTACTATTGACAGG + Intergenic
1001102164 5:168823361-168823383 GTGCCTCCCCTGCTGCTGCCTGG - Intronic
1001823076 5:174724885-174724907 CTGCGGCCACTGCTGCTGTCGGG + Exonic
1002159703 5:177307917-177307939 CAGCCTCTCCTTGAGCTGTCGGG + Exonic
1003280227 6:4684768-4684790 CAGGCACCCCTGCTGCTGTGAGG - Intergenic
1004881921 6:20017240-20017262 TTGCCTGCCCTGCTGCTGGCTGG - Intergenic
1006421495 6:33936826-33936848 CAGCTTCCCTTGCTGCTGCTAGG + Intergenic
1006744220 6:36330264-36330286 CTGGCTCCCCTGCTGCTTCCAGG + Exonic
1007091709 6:39188898-39188920 CAGGCTCCCCTGCTGCTCAGAGG + Intergenic
1007735259 6:43978323-43978345 GAGCCCTCCCTGCTGCTGTGAGG - Intergenic
1007770193 6:44185992-44186014 CAGCCTCCCCTTCTGGTTTCTGG + Intergenic
1007968802 6:46029862-46029884 GAGCTTCCCCTGCTCCTGTTAGG + Intronic
1010463736 6:76143007-76143029 CAGCCTCCACTGCTGATACCCGG - Intergenic
1011555710 6:88569912-88569934 CAGTCTCCACAGCTGCTTTCAGG + Intergenic
1013299082 6:108786359-108786381 CAGCATCTCTTCCTGCTGTCGGG + Intergenic
1014151188 6:118057408-118057430 CAGCCTCCCCTCCTCCTGCTTGG - Intronic
1015510525 6:134033919-134033941 CAACCTCTTCTGCTGCTTTCTGG + Intronic
1016321051 6:142846134-142846156 CACACTCCCCTGCCGCTCTCAGG - Intronic
1017012579 6:150072487-150072509 CAGCCTCTGCTCCTGCTGCCAGG + Intergenic
1017765165 6:157601044-157601066 CAGCCTCTCCATCTGCAGTCAGG - Intronic
1018864592 6:167736979-167737001 CAGCCTCCCCACCTGCTTCCCGG - Intergenic
1018980318 6:168596571-168596593 CATCCTCAGCTGCTGCTCTCCGG + Intronic
1019123759 6:169825535-169825557 CAGCCTTCCCTGTGGGTGTCAGG - Intergenic
1019283113 7:210460-210482 CAGCTTCCCCTGGTGCTGCGTGG + Intronic
1019503782 7:1380366-1380388 CGGCCACCCTTGCTGGTGTCTGG - Intergenic
1020079699 7:5280919-5280941 CTCCTTCCTCTGCTGCTGTCTGG - Intronic
1020213419 7:6171620-6171642 CACCATCTCCTGCTGCTGCCAGG + Intronic
1021456332 7:20832880-20832902 CAGCCTCCCCAGTAGCTGGCTGG - Intergenic
1021971414 7:25968950-25968972 CAGCAGCCCCTGCTGATGGCGGG - Intergenic
1023675776 7:42628344-42628366 CAGCCTCCCCTCAGGGTGTCTGG + Intergenic
1023982430 7:45077864-45077886 CAGCCTCTCCTGATGCTTCCAGG - Intergenic
1024242737 7:47448022-47448044 CAGCCTCCCCTCCTTCTGCCAGG - Intronic
1024291491 7:47807619-47807641 CAGCGTCCCATGCTGTTGTGGGG + Intronic
1024416344 7:49112036-49112058 CAGCCTCCCCTGTAGCTGGGAGG + Intergenic
1025102920 7:56150689-56150711 CAGCCACCCCGTCTGCCGTCTGG + Intergenic
1025875314 7:65476123-65476145 CTGCCTCCTCTGCTTTTGTCAGG + Intergenic
1026269287 7:68822466-68822488 CAACCTCCCCTTCTCATGTCAGG + Intergenic
1027357196 7:77369356-77369378 CTGCTGCCACTGCTGCTGTCAGG - Intronic
1028920318 7:96303579-96303601 CAGACTCCCTTGCTGCTATGCGG + Intronic
1030177803 7:106672586-106672608 CAGCCTCCACTGGTGATATCCGG + Intergenic
1030788616 7:113695046-113695068 CAGGCTCCCCACCTGCTGCCAGG - Intergenic
1031509241 7:122627752-122627774 CTGTCCCTCCTGCTGCTGTCAGG + Intronic
1032398360 7:131606888-131606910 CCACCTCCCCTGTTGGTGTCGGG + Intergenic
1032516012 7:132506793-132506815 CATCATCCCATGCTGCTCTCCGG + Intronic
1032548845 7:132765872-132765894 CACACCCCCCTGCTCCTGTCGGG - Intergenic
1032850871 7:135794055-135794077 CAGCCTCCCTTGCAGCTAGCGGG - Intergenic
1034100579 7:148446411-148446433 GAGCCTCCCCAGGTGCTCTCCGG - Intergenic
1034707457 7:153158422-153158444 CAGATTCCCCTGGTGCTGGCTGG + Intergenic
1035746051 8:1962698-1962720 CAGCATCCCCAGCTGCTGTGGGG + Intergenic
1037076992 8:14732523-14732545 CAGTCCCACCTGCAGCTGTCAGG + Intronic
1037902338 8:22695212-22695234 CAGCCTGCCCTGATTCTGACCGG - Intergenic
1037992583 8:23331262-23331284 CAGCCTCTGCTGCTCCTGCCTGG + Intronic
1038865765 8:31437228-31437250 CACCCCCCTCTGCTGCTGTCAGG - Intergenic
1039316139 8:36374698-36374720 CAGGCTGCCCTGCTGCTGAAGGG - Intergenic
1039800655 8:40951844-40951866 CAGCATCTTCTGCTGCTGCCTGG - Intergenic
1043989896 8:86739922-86739944 CAGCCTCCACAGCTGCCCTCTGG + Intronic
1045098719 8:98825296-98825318 GAGCCTCCCCTGCGGCCGGCAGG - Intronic
1045289071 8:100816346-100816368 CAGGCTCCCTTGCAGCTGTGTGG - Intergenic
1047210970 8:122840012-122840034 CAGCCTCTTCTGCTGGGGTCAGG - Intronic
1047634393 8:126744471-126744493 CAGCATCCCCTGTGGGTGTCAGG + Intergenic
1049341594 8:142115348-142115370 CTGCCTTCCCTGCAGCTCTCTGG + Intergenic
1049441026 8:142609899-142609921 CAGCCTCCCCTGCCTTTGTGGGG - Intergenic
1049441070 8:142610055-142610077 CAGCCTCCCCTGCCTTTGTGGGG - Intergenic
1049441085 8:142610107-142610129 CAGCCTCCCCTGCCTTTGTGGGG - Intergenic
1049441100 8:142610159-142610181 CAGCCTCCCCTGCCTTTGTGGGG - Intergenic
1049466529 8:142753472-142753494 CAGCCTCCCCAGGTTGTGTCTGG + Intergenic
1049612915 8:143563759-143563781 CAGCCTTCCCCACTTCTGTCAGG + Intergenic
1049944508 9:580990-581012 CACCCTCCGCAGCTGCTGGCTGG + Intronic
1050353422 9:4761496-4761518 CAGCCTCCCACACTGCTCTCAGG + Intergenic
1050489553 9:6173410-6173432 CAGCCTCCCTTGCTGCAGGTGGG + Intergenic
1050537192 9:6641156-6641178 CGTCCTCCCCTGGTTCTGTCCGG + Intronic
1051066036 9:13104216-13104238 CAGCCTCCCGAGTAGCTGTCTGG + Intergenic
1053201732 9:36156638-36156660 CAGGCTCACCTCCTGCTGTGCGG - Intronic
1053424848 9:38004040-38004062 CTGCCTGCCCTGCTCCTGCCTGG + Intronic
1055925621 9:81507514-81507536 CACCCTCCGCAGCTGCTGGCCGG - Intergenic
1056811808 9:89770989-89771011 CAGCCTCCGCGGGTGCAGTCAGG - Intergenic
1057049810 9:91915061-91915083 GAGCCGCCCCTGCTGTTCTCGGG - Intronic
1057118164 9:92545390-92545412 CACCCTCCGCAGCTGCTGGCCGG - Intronic
1057179181 9:93020685-93020707 GAGCCTCCTGTGCTGCTGTGTGG + Intronic
1057222424 9:93264401-93264423 CAGCCTCCCCAGCTGGAGTGCGG + Intronic
1057306748 9:93916774-93916796 CAGCCTTCCCAGCTGCTTTGTGG + Intergenic
1058305746 9:103438815-103438837 CAGCCTCCGCTGCTGATACCCGG - Intergenic
1059308704 9:113374018-113374040 CAGCCACCCCTGCACCTGGCAGG - Exonic
1059389959 9:113992812-113992834 CAGCTTCTCCTGCTGGAGTCAGG + Intronic
1060121861 9:120999029-120999051 CACCCTCCCCTGCTGTTCTAAGG - Intronic
1060221068 9:121764391-121764413 CTGCATGCCCTGCTGCTTTCTGG - Intronic
1060434895 9:123584856-123584878 CTGCCTCCCCTGCTGGGGTGTGG + Intronic
1060559751 9:124533214-124533236 CAGCCTGCTCTGATGCTGTCAGG - Intronic
1060795027 9:126507474-126507496 CAGCCTCCTTAGCTGGTGTCTGG - Intergenic
1060934022 9:127505651-127505673 CCCCCTCCCCTGCTGCTTTGCGG - Exonic
1061285489 9:129620249-129620271 CCGCCTCCCCTGCTGTCGGCCGG - Exonic
1061499200 9:130992576-130992598 CGGCCTCGCTTGCTGCTGTGCGG - Intergenic
1061695856 9:132372886-132372908 CAGCCTCCCTCGGTGCTATCAGG - Intergenic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1062049845 9:134441723-134441745 CAGCCTCCCTTGGTGGAGTCAGG + Intergenic
1062071096 9:134555396-134555418 CAGCCGTCCCTGCAGCTGTGCGG - Intergenic
1062186710 9:135222204-135222226 CTGCCACCCCTGCTGGTGGCTGG - Intergenic
1185908738 X:3962762-3962784 CAGCCTACCCTGCTGAGGTTGGG + Intergenic
1185908761 X:3962955-3962977 CAGCCTACCCTGCTGAGGTTGGG + Intergenic
1186150694 X:6671864-6671886 CAGCATCCCCTGCTGGACTCTGG + Intergenic
1187995771 X:24924825-24924847 CACCATCCCCTGCTACAGTCAGG - Intronic
1188583458 X:31743973-31743995 CAGCCTCCCATGCAGCTGGCAGG + Intronic
1189467209 X:41286314-41286336 CAGCCTCCCCTGCAGCTGAGTGG - Intergenic
1192216943 X:69165474-69165496 CCGCCCGCCCCGCTGCTGTCTGG - Exonic
1192588370 X:72339138-72339160 CAGGCTGTCCTGCTGCTGGCAGG + Intronic
1194245888 X:91511466-91511488 CAGCCTCCGTTGCTGATGCCAGG + Intergenic
1195218083 X:102720559-102720581 CAGCCTTCCTTCCAGCTGTCTGG + Intergenic
1195251373 X:103051479-103051501 CGACCTCCCCTGGTGCGGTCCGG + Intergenic
1197033369 X:121845971-121845993 AAGCTTCTGCTGCTGCTGTCTGG - Intergenic
1197672727 X:129296455-129296477 CAGCCTCCCATGTTGCTGGGGGG - Intergenic
1198256134 X:134925785-134925807 CACCCTCCGCAGCTGCTGGCCGG - Intergenic
1198641266 X:138758649-138758671 CAGCCTACCCTGAAGCTTTCTGG + Intronic
1199038183 X:143078482-143078504 CAGCCCCCACAGCTGCTTTCAGG + Intergenic
1199770294 X:150970888-150970910 AAGCCCTCCCTGCTGCTGTAGGG - Intergenic
1200564859 Y:4752715-4752737 CAGCCTCCGCTGCTGATGCCAGG + Intergenic