ID: 929896568

View in Genome Browser
Species Human (GRCh38)
Location 2:45966072-45966094
Sequence CCTTGGGAGGCGTGGATGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 980
Summary {0: 1, 1: 0, 2: 0, 3: 45, 4: 934}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929896568 Original CRISPR CCTTGGGAGGCGTGGATGGC TGG Intronic
900092820 1:927816-927838 CCTTGGGCAGGGTGGGTGGCAGG + Intronic
900233157 1:1572698-1572720 CCTTGGGAGGCCGAGATGGGCGG - Intronic
900732034 1:4268420-4268442 CCATGGGAGGCGAGGGTGGAAGG + Intergenic
900910729 1:5595316-5595338 CCTTGGGAGGCTGAGATGGGAGG + Intergenic
901088217 1:6625052-6625074 CCTGGGGAGACGCGGGTGGCTGG + Intronic
901121957 1:6902883-6902905 CCTTGGGAGACTTGATTGGCAGG + Intronic
901189838 1:7403107-7403129 CCTTGGGAGGCCTAGGTGGGGGG + Intronic
901269902 1:7943770-7943792 ACTTGGGAGGCTGGGATGGGAGG + Intergenic
901542858 1:9932089-9932111 CTTTGGGAGGCGTGGGGGGGGGG + Intronic
901758527 1:11455914-11455936 CCTGGGGTGCCGAGGATGGCTGG + Intergenic
902048015 1:13540449-13540471 CCTTGAGAGGCTTGGGTGGGAGG - Intergenic
902296198 1:15468699-15468721 ACTTGGGAGGCTTGGGTGGAAGG + Intronic
902312232 1:15589940-15589962 CTTTGGGAGGCCAAGATGGCAGG + Intronic
902367602 1:15987492-15987514 CTTTGGGAGGCGGAGATGGGCGG - Intergenic
902550183 1:17214726-17214748 CCTTGGGAGGTGTGACAGGCAGG - Intronic
902972772 1:20066895-20066917 ACTTGGGAGGCTTGGGTGGCAGG + Intronic
903076397 1:20770556-20770578 CCTTGGGAGGCTTAGTTGGGAGG - Intronic
903122203 1:21223705-21223727 CCTTGGGAGGCCTTGGTGGGTGG - Intronic
903613004 1:24630507-24630529 CTTTGGGAGGTGTAGATGGGTGG + Intergenic
903777016 1:25799989-25800011 CCTGGGGAGGCTGGGGTGGCCGG + Intergenic
903880432 1:26504906-26504928 CTTTGGGAGGCCTAGATGGGCGG - Intergenic
903928285 1:26847453-26847475 CCTTGGGAGGCCAAGATGGGAGG - Intronic
903966930 1:27096565-27096587 CTTTGGGAGGCGGAGATGGGCGG - Intergenic
904522125 1:31103741-31103763 CTTTGGGAGGCTGGGATGGGAGG - Intergenic
904575415 1:31502172-31502194 CCTTGGGAGAAGAGGATGCCAGG - Intergenic
904633497 1:31861306-31861328 CCTTGGGAGGCCTAGGTGGATGG - Intergenic
904646429 1:31970715-31970737 CCTTGGGAGGCTGAGATGGGTGG - Intergenic
905396705 1:37670907-37670929 CTTTGGGAGGCGGGGGTGGGAGG + Intergenic
905729642 1:40288067-40288089 ACTTGGGAGGCTGGGATGGGAGG + Intronic
906095446 1:43220613-43220635 ACTTGGGAGGCTGGGATGGGAGG + Intronic
906133756 1:43480171-43480193 CTTTGGGAGGCCGGGATGGGAGG - Intergenic
906199992 1:43953760-43953782 CCTTGGGAGTTGGGGATGGAGGG + Intronic
906457847 1:46012749-46012771 CTTTGGGAGGCCAGGATGGAAGG + Intronic
906536593 1:46554302-46554324 CCTTGGGAGGGGTGGAGGGTTGG - Intergenic
906897787 1:49797686-49797708 CTTTGGGAGGCTTAGTTGGCAGG - Intronic
907037713 1:51230853-51230875 CTTTGGGAGGCTGGGATTGCAGG + Intergenic
907807812 1:57839022-57839044 CTTTGGGAGGCCTAGATGGGAGG - Intronic
909457495 1:75866735-75866757 CTTTGGGAGGCCGAGATGGCTGG + Intronic
910482531 1:87674226-87674248 CCTTGGGAGGAGTAGATGAAAGG + Intergenic
911339681 1:96621463-96621485 CTTTGGGAGGCCTAGATGGGTGG - Intergenic
912380153 1:109243149-109243171 CTTTGGGAGGCCTAGATGGGCGG - Intergenic
912542257 1:110425898-110425920 CGCTGGGAGGCGTAGATGGACGG - Intergenic
913133542 1:115864483-115864505 ACTTGGGAGGCCTGGGTGGGAGG + Intergenic
913253902 1:116937172-116937194 CCTTGGGAGCAGAGCATGGCTGG + Intronic
914047011 1:144101805-144101827 CCTTGGCTGGCTTGGCTGGCTGG + Intergenic
914047097 1:144102195-144102217 GCTTGTCAGGCTTGGATGGCTGG + Intergenic
914047155 1:144102431-144102453 TCTTGGGTGGCTTGGCTGGCTGG + Intergenic
914047667 1:144104659-144104681 CCTTGGCTGGCTTGGCTGGCTGG + Intergenic
914047843 1:144105435-144105457 GCTTGGCAGGCTTGGCTGGCTGG + Intergenic
914048067 1:144106474-144106496 CCTTGGCTGGCTTGGCTGGCTGG + Intergenic
914131114 1:144858965-144858987 CCTTGGCTGGCTTGGCTGGCTGG - Intergenic
914694385 1:150062955-150062977 CTTTGGGAGGCGGAGATGGGTGG - Intergenic
914802910 1:150973981-150974003 CGTTATGAGGTGTGGATGGCTGG - Intronic
915476124 1:156153876-156153898 CCTGGGCAGGGGTGGCTGGCCGG - Intronic
916062165 1:161107051-161107073 CTTTGGGAGGCTAGGATGGGAGG - Intronic
916525846 1:165608508-165608530 CTTTGGGAGGCCTAGATGGGTGG - Intergenic
916540652 1:165750824-165750846 CTTTGGGAGGCCTGGGTGGGAGG + Intronic
916731928 1:167574147-167574169 CTTTGGGAGGCCAAGATGGCTGG - Intergenic
917415757 1:174807851-174807873 CTTTGGGAGGCCTGGGTGGGAGG + Intronic
917841736 1:178985667-178985689 CTTTGGGAGGCCAAGATGGCTGG + Intergenic
917955368 1:180091114-180091136 ACTTGGGAGGCTAGGATGGGAGG - Intronic
919025390 1:192162524-192162546 CTTTGGGAGGCCTAGATGGGTGG - Intronic
919033617 1:192277669-192277691 CTTTGGGAGGCCTGGATGGGAGG - Intergenic
919906649 1:202083180-202083202 CTTTGGGAGGCCTAGATGGGTGG - Intergenic
920562559 1:206949055-206949077 CCTTGGTGGGCGTGGAGGACAGG + Intergenic
920695872 1:208180984-208181006 CTTTGGAAGGCTTGGAAGGCTGG - Intronic
921169723 1:212535939-212535961 CTTTGGGAGGCCGGGATGGGCGG + Intergenic
921233857 1:213102961-213102983 CTTTGGGAGGCCTAGATGGGAGG + Intronic
921272490 1:213485107-213485129 CTTTGGGAGGCCAGGATGGGAGG - Intergenic
921856062 1:219985646-219985668 CTTTGGGAGGCTGGGATGGGTGG - Intronic
921860772 1:220040022-220040044 ACTCGGGAGGCTGGGATGGCAGG + Intronic
921898192 1:220422949-220422971 ACTTGGGAGGCTGGGATGGGAGG + Intergenic
921969917 1:221136708-221136730 CTTTGGGAGGCCAAGATGGCTGG - Intergenic
922657251 1:227396552-227396574 CTTTGGGAGGCGGAGATGGGTGG - Intergenic
923017509 1:230138279-230138301 CCTTGGGAGGCCAAGATGGGCGG + Intronic
923532296 1:234821029-234821051 CCCTGGGAGGGGAGGATGGTGGG - Intergenic
923554137 1:234987337-234987359 CCTAGGCAGGGGTGGATGCCGGG + Intergenic
923556169 1:235002288-235002310 CTTTGGGAGGCCTAGATGGGCGG + Intergenic
924413519 1:243833014-243833036 CTTTGGGAGGCTGAGATGGCTGG + Intronic
924696149 1:246401963-246401985 CTTTGGGAGGCTGGGATGGGCGG - Intronic
1062897576 10:1116135-1116157 CCTGGGGCGGGGTGGATGACGGG - Intronic
1063130075 10:3170750-3170772 CTTTGGGAGGCCTGGGTGGGCGG + Intronic
1063239975 10:4158924-4158946 CCTTGGGAGGCCGAGATGGGCGG + Intergenic
1063535911 10:6883322-6883344 CCTTGGGTGGCAAGAATGGCAGG + Intergenic
1063807323 10:9660354-9660376 CCTTGGGAGGCCGAGATGGGTGG + Intergenic
1063911132 10:10831726-10831748 CTTTGGGAGGCCAAGATGGCTGG + Intergenic
1063989685 10:11546657-11546679 CTTTGGGAGGCCTGGCTGGGCGG - Intronic
1064054809 10:12088361-12088383 ACTTGGGAGGCTGGGATGGGAGG + Intronic
1064502155 10:15985215-15985237 CTTTGGGAGGCCAAGATGGCTGG - Intergenic
1064622678 10:17230402-17230424 CCCTCGGGGGCGGGGATGGCGGG + Intronic
1064720262 10:18221568-18221590 CCTTGGGAGGCTGGGGTGGGAGG + Intronic
1064990980 10:21256585-21256607 CTTTGGGAGGCTAGGATGGGAGG + Intergenic
1065244130 10:23740601-23740623 CCTTGGGAGGCCAAGATGGGAGG - Intronic
1065689353 10:28317282-28317304 CTTTGGGAGGCCAGGATGGGAGG + Intronic
1065712063 10:28528221-28528243 CTTTGGGAGGCGGAGGTGGCAGG + Intergenic
1067945292 10:50685112-50685134 CCTGGGGAGGAGAGGTTGGCCGG - Intergenic
1068213655 10:53954031-53954053 CTTTGGGAGGCCTAGATGGGCGG - Intronic
1068550521 10:58403119-58403141 CTTTGGGAGGCCTAGATGGGCGG + Intergenic
1069000203 10:63254647-63254669 ACTTGGGAGGCGGGGATGGGAGG - Intronic
1069020629 10:63484183-63484205 CCTTGGGATGGATGGATGGATGG + Intergenic
1069245659 10:66202028-66202050 CTTTGGGAGGCCAGGGTGGCTGG - Intronic
1069522940 10:69140315-69140337 CTTTGGGAGGCCAGGATGGGAGG - Intronic
1069573083 10:69506350-69506372 CCTGGGGAGGGCTGCATGGCTGG + Intronic
1069616387 10:69809019-69809041 CCTTGGGAGTAGAGGATGGGAGG - Intronic
1069704226 10:70447566-70447588 ACTTGGGAGGCTGAGATGGCAGG + Intronic
1069723520 10:70563847-70563869 GCCTGGGAGGCGCCGATGGCAGG - Intronic
1070178476 10:73992910-73992932 CTTTGGGAGGCTGGGATGGAAGG + Intergenic
1070259903 10:74844971-74844993 CCTTGGGAGGCCAGGGTGGGAGG + Intronic
1070295235 10:75155133-75155155 CTTTGGGAGGCAGGGATGGGAGG - Intronic
1070334243 10:75440138-75440160 CCTTGGGAGGTGTGTATGTGTGG + Intronic
1070377031 10:75842782-75842804 CTTTGGGAGGCCAGGATGGGAGG + Intronic
1070640153 10:78162607-78162629 CCTTGGGAGGCTGTGATGGCAGG + Intergenic
1070880592 10:79850105-79850127 CCTGGGGAGGAGAGGTTGGCCGG - Exonic
1071308287 10:84319374-84319396 CTTTGGGAGGCCTAGATGGGTGG - Intergenic
1071633714 10:87234207-87234229 CCTGGGGAGGAGAGGTTGGCCGG - Exonic
1071647162 10:87366423-87366445 CCTGGGGAGGAGAGGTTGGCCGG - Exonic
1071811322 10:89184851-89184873 CCTGGGGATGTGTGGGTGGCAGG + Intergenic
1072149090 10:92671118-92671140 CCTTGGGAGGCTGGGGTGGGAGG - Intergenic
1072219506 10:93315765-93315787 CCTTGGAGGGGGTGGTTGGCGGG + Intronic
1072577129 10:96710463-96710485 CTTTGGGAGGCAGGGATGGGTGG - Intronic
1073329012 10:102658787-102658809 CCTTGGGAGGGGTGGAGGTGGGG + Intergenic
1074326858 10:112458907-112458929 CTTTGGGAGGCCTAGATGGGTGG - Intronic
1074393656 10:113079075-113079097 CTTTGGGAGGCCAGGATGGGTGG - Intronic
1074516089 10:114171290-114171312 CTTTGGGAGGCCTAGATGGGAGG + Intronic
1074784274 10:116825264-116825286 CCTTGGGAGGCCTAGATGGGAGG + Intergenic
1074814078 10:117131702-117131724 TCTTGGGAAGCGAGGAGGGCCGG - Intronic
1074917546 10:117971952-117971974 CTTTGGGAGGCGGAGGTGGCAGG + Intergenic
1075092887 10:119453366-119453388 CCTTGGAAGGCTTGGAAGTCTGG + Intronic
1075367985 10:121909801-121909823 CTTTGGGAGGCGAGGGTGGGAGG + Intronic
1075532244 10:123239493-123239515 CCTTGGGAGGCTGAGATGGGTGG + Intergenic
1075692986 10:124412560-124412582 CCTTGGGAGGCCAAGATGGGAGG + Intronic
1076417685 10:130303110-130303132 CCTTGGGAGGCGAAGGTGGGAGG - Intergenic
1076527163 10:131119111-131119133 TGTTGGGAGGCCTGGACGGCCGG - Intronic
1077069293 11:660587-660609 CCTGGGGACACGGGGATGGCGGG + Intronic
1077095100 11:795825-795847 CCTTGGGGGTGGGGGATGGCTGG + Intronic
1078490847 11:11766999-11767021 CTTTGGGAGGCCGGGATGGGCGG + Intergenic
1079134595 11:17769281-17769303 CCTTGTGAGGAATGGATGGATGG + Intronic
1080362811 11:31535587-31535609 CTTTGGGAGGCCAAGATGGCAGG - Intronic
1081550443 11:44106870-44106892 CCTTGGGAGGCCAAGATGGGTGG - Intronic
1082103535 11:48194667-48194689 CTTTGGGAGGCCTAGATGGGTGG + Intergenic
1082259240 11:50064824-50064846 ACTTGGGAGGCTGAGATGGCAGG - Intergenic
1082836402 11:57653995-57654017 CCTTGGGAGGCCAGGGTGGGTGG - Intronic
1083543943 11:63535468-63535490 ACTTGGGAGGCGGAGATGGGAGG - Intergenic
1083851223 11:65368452-65368474 CTTTGGGAGGCCAGGATGGGAGG - Intergenic
1084063840 11:66692318-66692340 CCTTGGGAGGCTGAGATGGGAGG - Intronic
1084065922 11:66704545-66704567 CCTTGGGAGGTGGGGGTGGGGGG - Intronic
1084363473 11:68683926-68683948 CCTCGGGAGCCGTCGATGGCGGG - Intronic
1084422254 11:69066271-69066293 CCTTCCGAGGCCTGGAGGGCAGG - Intronic
1084484900 11:69442609-69442631 CCTGGGGAGTCATGGAAGGCTGG - Intergenic
1084967694 11:72752906-72752928 CCTTGGGAGGTGTGGCTGGGTGG - Intronic
1085070970 11:73545267-73545289 CTTTGGGAGGCCTAGATGGGTGG - Intronic
1085097014 11:73769506-73769528 CTTTGGGAGGCCGGGATGGGAGG + Intergenic
1085226286 11:74924083-74924105 CTTTGGGAGGCCAGGATGGGAGG - Intronic
1085280699 11:75328563-75328585 ACTTGGGATGGGTGAATGGCTGG - Intronic
1085330861 11:75649780-75649802 CTTTGGGAGGCCTAGATGGGTGG - Intronic
1085668642 11:78440305-78440327 CTTTGGGAGGCCTGGGTGGGTGG - Intronic
1086459845 11:86995710-86995732 CTTTGGGAGGCTTAGATGGGTGG + Intergenic
1086646762 11:89231738-89231760 CTTTGGGAGGCTGGGATGGGTGG + Intronic
1087253509 11:95929901-95929923 ACTTGGGAGGCTGTGATGGCAGG + Intergenic
1087759966 11:102095043-102095065 CTTTGGGAGGCCTGGTTGGGTGG + Intergenic
1088619483 11:111667190-111667212 CTTTGGGAGGCCGGGATGGGTGG - Intronic
1089313968 11:117577989-117578011 CTTTGGGAGGCTGGGATGGGTGG + Intronic
1089816911 11:121184030-121184052 CTTTGGGAGGCGAAGATGGGAGG - Intronic
1089991650 11:122866852-122866874 CTTTGGGAGGCTGGGATGGGAGG - Intronic
1090075096 11:123575651-123575673 CCTGGGGAAGCGTGGAGAGCAGG - Intronic
1090750744 11:129744387-129744409 CTTTGGGAGGCCGGGATGGGTGG + Intergenic
1090793850 11:130116884-130116906 CTTTGGGAGGCTGGGATGGGAGG + Intronic
1091107329 11:132934894-132934916 CTTTGGGAGGCCGGGATGGGGGG + Intronic
1091536873 12:1418955-1418977 CTTTGGGAGGCGTAGGTGGGAGG - Intronic
1091561991 12:1621786-1621808 CTTTGGGAGGCCGGGATGGGAGG - Intronic
1091732916 12:2894268-2894290 CCATGGGAGGCCGAGATGGCGGG + Intronic
1091737675 12:2936505-2936527 CCTTGGGAGGCCAAGATGGGCGG + Intronic
1092413976 12:8275499-8275521 CTTTGGGAGGCCAGGATGGTCGG + Intergenic
1093059215 12:14585195-14585217 CTTTGGGAGGCGGAGGTGGCCGG - Intergenic
1093441864 12:19208162-19208184 CTTTGGGAGGCCTAGATGGGTGG + Intronic
1093457499 12:19379280-19379302 CTTTGGGAGGCTGGGATGGGAGG + Intergenic
1093478278 12:19579028-19579050 CTTTGGGAGGCTGGGATGGGCGG + Intronic
1093623356 12:21318360-21318382 CTTTGGGAGGCGGAGATGGGTGG - Intronic
1094624795 12:32113492-32113514 CCTTGGGAGGCTGAGATGGGAGG - Intronic
1094642365 12:32288491-32288513 CCTTGGGAGGCTGAGATGGGAGG - Intronic
1094819479 12:34213374-34213396 CCTTGGGAGGCTGAGATGGGTGG + Intergenic
1095145568 12:38721983-38722005 CCTTGGCAGGCGTGGGATGCAGG + Intronic
1095153230 12:38820161-38820183 CTTTGGGAGGCGAAGATGGGGGG + Intronic
1095497142 12:42797132-42797154 CTTTGGGAGGCGAAGATGGGAGG - Intergenic
1095561559 12:43572066-43572088 CCTGAGGAGGCGGGCATGGCAGG - Intergenic
1096301367 12:50431022-50431044 CTTTGGGAGGCTTCGGTGGCTGG + Intronic
1096398957 12:51289369-51289391 CTTTGGGAGGCGGAGATGGGAGG + Intronic
1096502713 12:52074713-52074735 CTTTGGGAGGCTGAGATGGCCGG + Intronic
1096503846 12:52080937-52080959 TGTTGGGGGGTGTGGATGGCAGG + Intergenic
1096654909 12:53083362-53083384 TCTTGGGAGGCTAAGATGGCAGG + Intergenic
1096749713 12:53751239-53751261 CGTTGGGAGGTGCGGAAGGCCGG - Intergenic
1097000576 12:55873027-55873049 CTTTGGGAGGCGAAGATGGGCGG - Intergenic
1097111835 12:56665534-56665556 CATTGGGAGGCGGAGATGGGTGG - Intronic
1097449015 12:59713261-59713283 CTTTGGGAGGCCTAGATGGGTGG - Intronic
1097573978 12:61367995-61368017 CTTTGGGAGGCGAGGCTGGCAGG - Intergenic
1097849833 12:64400909-64400931 CCTTGGGAGGCCGAGATGGGTGG - Intergenic
1098300881 12:69053157-69053179 CAGTGGGAGGTGTGGAGGGCAGG + Intergenic
1099066367 12:77985057-77985079 CTTTGGGAGGCCTAGGTGGCTGG - Intronic
1099683644 12:85859295-85859317 CCTTGGGAGGCAGAGATGGGTGG + Intergenic
1100484459 12:95011484-95011506 ACTTGGGAGGCTAGGATGGGAGG - Intergenic
1100533136 12:95478962-95478984 ACTTGGGAGGCTGGGATGGGAGG + Intronic
1101329296 12:103744573-103744595 ACTTGGGAGGCTGGGATGGGAGG - Intronic
1101568119 12:105928765-105928787 CTTTGGGAGGCCTGGATGTCAGG - Intergenic
1101717789 12:107326146-107326168 CTTTGGGAGGCGGAGATGGGTGG - Intronic
1102690793 12:114759093-114759115 ACTTGGGAGGCGTAGGTGGGAGG + Intergenic
1102860176 12:116329696-116329718 CTTTGGGAGGCCTAGATGGGCGG - Intergenic
1103196013 12:119044341-119044363 CCTTGGGAGATGTGGAGGGCGGG + Intronic
1103357191 12:120330444-120330466 CTTTGGGAGGCTTAGATGGGAGG - Intergenic
1103374987 12:120448570-120448592 CTTTGGGAGGCGAAGATGGGCGG - Intronic
1103547167 12:121710604-121710626 CCTTGGGAGGCTGAGATGGGAGG - Intergenic
1103766401 12:123283370-123283392 ACTTGGGAGGCGGGGGTGGGAGG - Intergenic
1103776278 12:123368672-123368694 CTTTGGGAGGCCAAGATGGCAGG + Intergenic
1103840503 12:123859788-123859810 CTTTGGGAGGCCTGGGTGGGAGG + Intronic
1103957998 12:124589540-124589562 CTTTGGGAGGCCAGGATGGGAGG - Intergenic
1104103939 12:125641199-125641221 ACTGGGGATGCGTGCATGGCAGG + Intronic
1104183931 12:126410085-126410107 ACTTGGGAGGCGTAGGTGGGAGG + Intergenic
1104272433 12:127294109-127294131 CCTTGGGAGGCGGGGGATGCAGG + Intergenic
1104985639 12:132595322-132595344 CTTTGGGAGGCCAGGATGGGAGG + Intergenic
1105056007 12:133099577-133099599 CTTTGGGAGGCTTGGGTGGGAGG + Intronic
1105520794 13:21129209-21129231 CCTTGGGAGGCTTAGGTGGGAGG - Intergenic
1105734273 13:23251537-23251559 CTTTGGGAGGCCAGGATGGAAGG + Intronic
1105806042 13:23952078-23952100 CCTTCGGAGGAGCGGATGGAAGG - Intergenic
1106015906 13:25868824-25868846 CTTTGGGAGGCCTGGGTGGGCGG + Intronic
1106233235 13:27838979-27839001 CCTTGGGAGGCCAAGATGGGAGG - Intergenic
1106384063 13:29267315-29267337 CTTTGGAAGGCGTGGTTGGGAGG - Intronic
1107331255 13:39303585-39303607 CTTTGGGAGGCCTAGATGGGTGG + Intergenic
1107362049 13:39629618-39629640 CCTTGGGAGGCCAAGATGGGTGG - Intergenic
1107701316 13:43051219-43051241 CCTTGGGAGGCTGAGATGGGTGG - Intronic
1108248029 13:48536734-48536756 CTTTGGGAGGCGGAGATGGGCGG + Intergenic
1108319739 13:49277225-49277247 CTTTGGGAGGCGGGGGTGGGAGG + Intronic
1108370777 13:49765578-49765600 CTTTGGGAGGCATAGATGGGAGG - Intronic
1108508637 13:51135395-51135417 CTTTGGGAGGCCTAGATGGGAGG + Intergenic
1108623129 13:52203222-52203244 CTTTGGGAGGCTTAGATGGGAGG + Intergenic
1109289507 13:60456802-60456824 ACTTGGGAGGCTGAGATGGCAGG - Intronic
1110177376 13:72573364-72573386 CTTTGGGAGGCCTGGGTGGGTGG - Intergenic
1110221783 13:73081381-73081403 ACTTGGGAGACTTAGATGGCCGG - Intergenic
1110509712 13:76335037-76335059 CCTTGGGAGGCCTAGGTGGGTGG + Intergenic
1110642986 13:77847961-77847983 CTTTGGGAGGCGGAGATGGGCGG + Intergenic
1110923100 13:81114170-81114192 CCTTGGGAGGCTGGGGTGGGTGG - Intergenic
1111172436 13:84545245-84545267 ACTTGGGAGGCGGAGGTGGCAGG - Intergenic
1111253545 13:85638377-85638399 CCTTGGCAGGCGTGGGAGCCAGG - Intergenic
1111701739 13:91698142-91698164 CCTTGGGAGGCCAAGATGGGTGG - Intronic
1111717385 13:91896360-91896382 CTTTGGGAGGCGGAGGTGGCTGG - Intronic
1111731986 13:92088011-92088033 CTTTGGGAGGCCTAGATGGGAGG - Intronic
1112002220 13:95221470-95221492 CTTTGGGAGGCTCAGATGGCTGG - Intronic
1112402776 13:99089901-99089923 CCTTGGGAGGCTGAGATGGGCGG - Intergenic
1113381232 13:109808075-109808097 CTTTGGGAGGCTTGGGTGGGGGG - Intergenic
1113856166 13:113446456-113446478 TCCTGGGAGGCGTGGCCGGCTGG + Intronic
1114272314 14:21108761-21108783 CTTTGGGAGGCTTGGTTGGGTGG - Intergenic
1114717031 14:24837871-24837893 CCTGGTGAGCTGTGGATGGCTGG + Intronic
1114882061 14:26798419-26798441 CTTTGGGAGGCTTAGATGGGAGG + Intergenic
1115621938 14:35149321-35149343 ACTTGGGAGGCCTAGATGGGAGG - Intronic
1116030413 14:39564529-39564551 CCTTGGGAGGCCAAGATGGGCGG - Intergenic
1116303157 14:43212348-43212370 CTTTGGGAGGCCAAGATGGCAGG - Intergenic
1116421546 14:44738616-44738638 CCTTGGGAGGGGGCTATGGCAGG - Intergenic
1116731242 14:48624970-48624992 CTTTGGGAGGCGAGGCGGGCAGG + Intergenic
1117389132 14:55246690-55246712 CTTTGGGAGGCTGGGATGGGTGG - Intergenic
1117842560 14:59875160-59875182 CTTTGGGAGGCGGAGATGGGCGG - Intergenic
1118007561 14:61577284-61577306 CCTTGGGAGGGTTGCATGGTAGG - Intronic
1118236221 14:64007765-64007787 CTTTGGGAGGCTGGGGTGGCCGG + Intronic
1118265512 14:64290644-64290666 CTTTGGGAGGCCTAGGTGGCTGG - Intronic
1118522039 14:66596405-66596427 CCATGGGCACCGTGGATGGCAGG - Intronic
1118585041 14:67344633-67344655 CTTTGGGAGGCTGAGATGGCAGG + Intronic
1118921868 14:70156795-70156817 CCCTGGCAGGCATGAATGGCAGG + Intronic
1119385795 14:74257572-74257594 CCGTGGGATGCGAGGCTGGCGGG + Intronic
1119531368 14:75363436-75363458 CCCTGGAAGCTGTGGATGGCTGG - Intergenic
1119539434 14:75428584-75428606 CCTCGGGCGGCGGGGAAGGCGGG + Intronic
1120248843 14:82037584-82037606 ACTTGGGAGGCTAAGATGGCAGG - Intergenic
1120660900 14:87250011-87250033 CTTTGGGAGGCCGGGATGGGTGG + Intergenic
1120983154 14:90308997-90309019 CTTTGGGAGGCTGGGATGGGCGG + Intronic
1121029802 14:90648458-90648480 CCTTGGGAGGCTAAGATGGGAGG - Intronic
1121254777 14:92523353-92523375 CTTTGGGAGGCCAGGATGGGTGG - Intronic
1122406291 14:101503150-101503172 CCTAGGGAGACGAGGCTGGCAGG - Intergenic
1122447084 14:101777591-101777613 CCTTGGGAGGCCGAGATGGGTGG - Intronic
1122672270 14:103381930-103381952 CCTTGGGAGGCAGAGATGGGAGG + Intergenic
1122998414 14:105277995-105278017 CTTTGGGAGGCGGAGATGGGTGG - Intronic
1123043779 14:105501490-105501512 CTTTGGGAGGCCTGGATGGGAGG + Intergenic
1202903233 14_GL000194v1_random:54955-54977 CCTGGGGAGGCGTGGGTGAGGGG + Intergenic
1123416748 15:20100820-20100842 GCTTGGGTGGCTTGGCTGGCTGG + Intergenic
1123416843 15:20101201-20101223 GCTTGGGTGGCTTGGCTGGCTGG + Intergenic
1123416895 15:20101419-20101441 GCTTGGCTGGCTTGGATGGCTGG + Intergenic
1123416924 15:20101532-20101554 GCTTGGCTGGCTTGGATGGCTGG + Intergenic
1123416949 15:20101662-20101684 GCTTGGCCGGCTTGGATGGCTGG + Intergenic
1123417153 15:20102429-20102451 GCTTGGCTGGCTTGGATGGCTGG + Intergenic
1123417520 15:20104039-20104061 CCTTGGCTGGCTTGGCTGGCTGG + Intergenic
1123417634 15:20104521-20104543 GCTTGGCAGGCTTGGCTGGCTGG + Intergenic
1123417738 15:20104947-20104969 GCTTGGCAGGCTTGGCTGGCTGG + Intergenic
1123417776 15:20105102-20105124 CCTTGGCTGGCTTGGCTGGCTGG + Intergenic
1123447428 15:20341133-20341155 TCTTGGGTGGCTTGGCTGGCTGG - Intergenic
1123447974 15:20343592-20343614 GCTTGGGTGGCTTGGTTGGCTGG - Intergenic
1123447981 15:20343618-20343640 GCTTGGGTGGCTTGGCTGGCTGG - Intergenic
1123447989 15:20343648-20343670 GCTTGGGTGGCTTGGCTGGCTGG - Intergenic
1123447996 15:20343674-20343696 GCTTGGGTGGCTTGGCTGGCTGG - Intergenic
1123526087 15:21107926-21107948 GCTTGGGTGGCTTGGCTGGCTGG + Intergenic
1123526182 15:21108307-21108329 GCTTGGGTGGCTTGGCTGGCTGG + Intergenic
1123526234 15:21108525-21108547 GCTTGGCTGGCTTGGATGGCTGG + Intergenic
1123526263 15:21108638-21108660 GCTTGGCTGGCTTGGATGGCTGG + Intergenic
1123526288 15:21108768-21108790 GCTTGGCCGGCTTGGATGGCTGG + Intergenic
1123526895 15:21111317-21111339 CCTTGGCTGGCTTGGCTGGCTGG + Intergenic
1123527008 15:21111799-21111821 GCTTGGCAGGCTTGGCTGGCTGG + Intergenic
1123527074 15:21112077-21112099 CCTTGGCTGGCTTGGCTGGCTGG + Intergenic
1123540612 15:21285930-21285952 CCTTGGGAGGCTGAGATGGGAGG + Intergenic
1123997948 15:25732113-25732135 CTTTGGGAGGCCTAGATGGGAGG - Intronic
1125521772 15:40351978-40352000 CTTTGGGAGGCCTAGATGGGTGG - Intronic
1125673650 15:41491016-41491038 CTTTGGGAGGCCTGGGTGGGCGG + Intergenic
1125683968 15:41551674-41551696 CTTTGGGAGGCCTAGATGGGAGG + Intergenic
1125967086 15:43883339-43883361 CTTTGGGAGGCCTAGATGGGTGG - Intronic
1126445622 15:48740731-48740753 CCTTGGGAGGCTGAGATGGGAGG - Intronic
1126459896 15:48903872-48903894 ACTTGGGAGGCTTAGATGGGAGG - Intronic
1126636603 15:50786207-50786229 CTTTGGGAGGCCGGGATGGATGG - Intergenic
1127538795 15:59917016-59917038 CCTTGGGAGGCTGAGATGGGTGG + Intergenic
1127986566 15:64076947-64076969 CTTTGGGAGGCCTAGATGGGCGG - Intronic
1128071764 15:64801768-64801790 CTTTGGGAGGCCTAGATGGGAGG - Intergenic
1128459902 15:67859221-67859243 CTTTGGGAGGCTGGGATGGGAGG + Intergenic
1128907429 15:71480143-71480165 ACTTGGGAGGCTTGGGTGGGAGG - Intronic
1128975800 15:72152473-72152495 CTTTGGGAGGCCAGGATGGTCGG + Intergenic
1129406077 15:75319067-75319089 CCTTGGGAGGCTGGGGTGGGAGG - Intergenic
1129436679 15:75547050-75547072 CTTTGGGAGGCCTGGGTGGGTGG + Intronic
1129474341 15:75774859-75774881 CTTTGGGAGGCGTAGGTGGGTGG - Intergenic
1129691490 15:77716387-77716409 ACTTGCGAGGCTTGGATGGGAGG - Intronic
1131073108 15:89478074-89478096 TCCTGGGAGCCGGGGATGGCTGG + Intronic
1131818707 15:96249475-96249497 CCTTGGGAGGCCAAGATGGGAGG - Intergenic
1132675173 16:1118414-1118436 CCTGGGAAGGCGTGGCTGGCTGG + Intergenic
1132733038 16:1372415-1372437 CCTTGGAAGGCAGGGCTGGCTGG - Intronic
1133657683 16:7882012-7882034 CCTTGGGAGAAGTATATGGCTGG + Intergenic
1133945943 16:10348628-10348650 CTTTGGAAGGCTTGGATGGGTGG - Intronic
1134448509 16:14348618-14348640 CTTTGGGAGGCCTAGATGGGCGG - Intergenic
1134511034 16:14846947-14846969 CTTTGGGAGGCCAGGATGGGAGG + Intronic
1134973158 16:18549230-18549252 CTTTGGGAGGCCAGGATGGGAGG - Intronic
1135015020 16:18918015-18918037 CTTTGGGAGGCTGGGATGGGTGG + Intronic
1135408147 16:22213034-22213056 CTTTGGGAGGCGGAGATGGGTGG + Intronic
1135672578 16:24387758-24387780 CTTTGGGAGGCCAAGATGGCAGG + Intergenic
1136294958 16:29296260-29296282 CCTTGGGAAGGATGGGTGGCAGG - Intergenic
1136351512 16:29711633-29711655 CTTTGGGAGGCCTAGATGGGTGG - Intergenic
1136822839 16:33336470-33336492 GCTTGGGTGGCTTGGCTGGCTGG + Intergenic
1136823215 16:33338102-33338124 GCTTGGGTGGCTTGGCTGGCTGG + Intergenic
1137493143 16:48949829-48949851 CCTGGGGAGGAATGGAGGGCAGG - Intergenic
1137713488 16:50583410-50583432 CCTTGGTAGGGGTGGCTGGAAGG - Intronic
1137736845 16:50731059-50731081 ACTTGGGAGGCTGGGATGGAAGG + Intronic
1138373490 16:56546162-56546184 CCTTGGGAGGCTGAGATGGGAGG - Intergenic
1138442648 16:57044412-57044434 CCTGGGGTGGCTTGGCTGGCTGG - Intronic
1138969885 16:62131635-62131657 ACTTGGTAGTCATGGATGGCTGG - Intergenic
1139027723 16:62839502-62839524 CCTTGGGAGGCGAAGGTGGGAGG + Intergenic
1139344992 16:66297016-66297038 ACCTGGGAGGCTGGGATGGCAGG + Intergenic
1139377136 16:66506782-66506804 CTTTGGGAGGCCAGGATGGGCGG - Intronic
1139920389 16:70456061-70456083 ACTTGGGAGGCTGGGATGGGAGG + Intronic
1140986165 16:80159942-80159964 CCTTGGGAGGCTGAGATGGGTGG + Intergenic
1141489347 16:84361450-84361472 CCTTGGGAGGCCGAGGTGGCTGG + Intergenic
1141524278 16:84601695-84601717 CTTTGGGAGGCCAGGATGGGGGG - Intronic
1141675862 16:85517038-85517060 CTTTGGGAGGCCGAGATGGCTGG - Intergenic
1141988347 16:87594434-87594456 CCTTGGGTGGGGTGGGGGGCCGG + Intergenic
1142100852 16:88270269-88270291 CCTTGGGAAGGATGGGTGGCAGG - Intergenic
1142101687 16:88275504-88275526 CCTTCCGGGGCGTTGATGGCGGG + Intergenic
1142202068 16:88765915-88765937 CCTTGGGAGGCCTGGGTGGGCGG - Intronic
1203138649 16_KI270728v1_random:1746263-1746285 GCTTGGGTGGCTTGGCTGGCTGG - Intergenic
1203138736 16_KI270728v1_random:1746624-1746646 CCTTGGCTGGCTTGGCTGGCTGG - Intergenic
1203139019 16_KI270728v1_random:1747906-1747928 GCTTGGGTGGCTTGGCTGGCTGG - Intergenic
1203144746 16_KI270728v1_random:1792559-1792581 GCTTGGCTGGCTTGGATGGCTGG + Intergenic
1203144771 16_KI270728v1_random:1792675-1792697 GCTTGGGTGGCTTGGCTGGCTGG + Intergenic
1142623089 17:1177374-1177396 CCTGGGGTGGCCTGGATGGTGGG - Intronic
1143252579 17:5534116-5534138 CTTTGGGAGGCCGGGATGGGTGG + Intronic
1143355132 17:6322074-6322096 CCTTGGGAGGCTGAGATGGGTGG + Intergenic
1143533070 17:7517252-7517274 CTTTGGGAGGCCGAGATGGCTGG - Intergenic
1143553659 17:7647416-7647438 CTTTGGGAGGCCAAGATGGCAGG + Intronic
1143799776 17:9369027-9369049 ACTTGGGAGGCTGGGATGGGAGG - Intronic
1144337717 17:14286797-14286819 ACTTGGGAGGCTTAGATGGGAGG - Intergenic
1144573118 17:16412838-16412860 CTTTGGGAGGCGGAGGTGGCCGG + Intergenic
1144746514 17:17618990-17619012 CTTTGGGAGGCTGGGATGGGAGG + Intergenic
1144797074 17:17899263-17899285 CCTTGTGAGCCCTGGATGCCCGG + Intronic
1144844409 17:18208895-18208917 GCTTGCAGGGCGTGGATGGCAGG - Exonic
1144923608 17:18784401-18784423 CTTTGGGAGGCCAGGATGGGTGG + Intronic
1145107258 17:20129116-20129138 CTTTGGGAGGCCAGGATGGAAGG - Intronic
1145189679 17:20828082-20828104 CTTTGGGAGGCGTAGGTGGGTGG + Intergenic
1145819372 17:27819730-27819752 ACTTGGGAGGCTTAGATGGGAGG + Intronic
1145891283 17:28417808-28417830 CTTTGGGAGGCCGGGATGGGAGG + Intergenic
1146059810 17:29598655-29598677 CCTTGGGAGGCTGAGATGGGAGG - Intronic
1146171532 17:30638071-30638093 CTTTGGGAGGCCTTTATGGCAGG - Intergenic
1146218521 17:30998293-30998315 CTTTGGGAGGCTGAGATGGCAGG + Intronic
1146261546 17:31425448-31425470 ATTAGGGAGGCGTGGGTGGCTGG + Intronic
1146292550 17:31620684-31620706 CTTTGGAAGGCGGGGATGGGTGG - Intergenic
1146344994 17:32054094-32054116 CTTTGGGAGGCCTTTATGGCAGG - Intergenic
1147246981 17:39128461-39128483 CTTTGGGAGGCCTGGGTGGGCGG - Intronic
1147413248 17:40269400-40269422 ACTTGGGAGGCTAGGATGGGAGG + Intronic
1147897184 17:43758440-43758462 CTTTGGGAGGCTTGGAAGACTGG - Intronic
1147926079 17:43946760-43946782 CCTTGGGAAGCTGAGATGGCAGG - Intergenic
1148502935 17:48105604-48105626 ACTTAGGAGGCTTGGGTGGCAGG + Intronic
1149320555 17:55476808-55476830 CTTTGGGAGGCGGAGATGGGTGG - Intergenic
1150132199 17:62675286-62675308 CCCTGGCAGGCGAGGCTGGCAGG - Intronic
1150577383 17:66442298-66442320 CTTTGGGAGGCCTGGGTGGGTGG - Intronic
1150674314 17:67231807-67231829 CTTTGGGAGGCGGAGATGGGTGG + Intronic
1150783635 17:68144191-68144213 CCTTGGGAGGCCAAGATGGGAGG - Intergenic
1151194922 17:72424627-72424649 CAGTGGGAGGAGGGGATGGCAGG - Intergenic
1151353242 17:73543768-73543790 CCTTGGGATTCCTGGAGGGCGGG - Intronic
1151957007 17:77385460-77385482 CCTTGGGAGGCCGAGATGGATGG - Intronic
1152073599 17:78146029-78146051 CTTTGGGAGGCCTGGATGGGCGG - Intergenic
1152307864 17:79531636-79531658 CCTTGGGAGGCGGCCAAGGCTGG - Intergenic
1152378010 17:79928654-79928676 CCTTGGGAGGTGAGGGTGGGAGG - Intergenic
1153182652 18:2453036-2453058 CTTTGGGAGGCCTAGATGGGAGG - Intergenic
1153648168 18:7214051-7214073 CCTGGGGAAGCCTGGAGGGCAGG - Intergenic
1153648778 18:7220565-7220587 CTTTGGGAGGCCTAGATGGGTGG - Intergenic
1153835654 18:8961922-8961944 CTTTGGGAGGCTGGGATGGGAGG - Intergenic
1153876667 18:9378726-9378748 CCTTGGGAGGCCAAGATGGGTGG + Intronic
1154156408 18:11947749-11947771 CCTGGGGCGGCGTGGAAGGGAGG - Intergenic
1155169337 18:23255666-23255688 ACTTGGGAGGCGGAGATGGGAGG - Intronic
1155180963 18:23346025-23346047 CCTTGGGAGGCTGAGATGGGAGG + Intronic
1155907256 18:31467095-31467117 CTTTGGGAGGCCAGGATGGGAGG + Intronic
1155974130 18:32109642-32109664 CTTTGGGAGGCTGAGATGGCTGG + Intronic
1156366821 18:36437224-36437246 ACTTGGGAGGCTTGGGTGGGAGG - Intronic
1156870731 18:41942145-41942167 CTTTGGGAGGCCAAGATGGCAGG + Intergenic
1158028292 18:52930206-52930228 CCTTGGGAGGCCAAGGTGGCAGG - Intronic
1158361599 18:56680111-56680133 CTTTGGGAGGCTGGGATGGGCGG + Intronic
1158728927 18:60001878-60001900 CTTTGGGAGGCCTAGATGGGCGG - Intergenic
1159249404 18:65854195-65854217 CCTTGGGAGGCTGAGATGGGAGG + Intronic
1159443960 18:68517149-68517171 CTTTGGGAGGCCGAGATGGCTGG - Intergenic
1159973949 18:74687102-74687124 CTTTGGGAGGCCAGGATGGGAGG + Intronic
1160596469 18:79978600-79978622 GCTTGGGAGGCGGAGATGGGAGG - Intronic
1160773703 19:844856-844878 CTTTGGGAGGCTGGGATGGGAGG + Intronic
1160791197 19:924634-924656 CCTTGGGAGGCGGAGGTGGGCGG - Intergenic
1161079811 19:2305182-2305204 CCTTCTGGGGCGTGGAAGGCAGG + Intronic
1161647265 19:5461119-5461141 CTTTGGGAGGCCTAGGTGGCTGG + Intergenic
1161805968 19:6443180-6443202 CCTTGGGAGGCCTAGGTGGGTGG - Intronic
1161813871 19:6487168-6487190 CCTTGGGAGGCTGGGATGGGAGG - Intergenic
1161952948 19:7477731-7477753 CTTTGGGAGGTGTGGAGGGAAGG + Intronic
1162431509 19:10631643-10631665 CCCTTGTAGGCGTGGATAGCGGG - Exonic
1162442045 19:10698801-10698823 CTTTGGGAGGCCTAGATGGGTGG + Intergenic
1162526092 19:11207546-11207568 ACTTGGGAGGCTTGGGTGGGAGG + Intronic
1162637876 19:11984685-11984707 TTTTGGGAGGCGTAGATGGGGGG - Intergenic
1163082009 19:14950834-14950856 ACTTGGGAGGCTGAGATGGCAGG + Intronic
1164431320 19:28191434-28191456 CTTTGGGAGGCGGAGATGGGTGG - Intergenic
1165042135 19:33076136-33076158 ACTTGGGAGGCTGGGATGGGAGG + Intergenic
1165105676 19:33468505-33468527 CCGAGGCAGGCGAGGATGGCGGG + Intronic
1165284937 19:34833542-34833564 ACGTGGGAGACGTGGATGACAGG + Intergenic
1165467097 19:35981427-35981449 ACTTGGGAGGCAAGGATGGGAGG - Intergenic
1165639954 19:37376082-37376104 CTTTGGGAGGCCAAGATGGCGGG + Intronic
1165759203 19:38310688-38310710 CATTGGGAGGCGCAGGTGGCTGG - Intronic
1165781358 19:38436151-38436173 CCTTGGGAGGCCAAGATGGGTGG - Intronic
1166354919 19:42221248-42221270 CTTTGGGAGGCCTGGGTGGGAGG + Intronic
1166834012 19:45656023-45656045 CTTTGGGAGGCTGGGATGGGAGG - Intergenic
1167004246 19:46765268-46765290 CTTTGGGAGGCGTAGGTGGGAGG + Intronic
1167058387 19:47127945-47127967 CTTTGGGAGGCATGGACGGGAGG - Intronic
1167160464 19:47764236-47764258 CCCTGTGAGGCGTGGACGGCAGG + Intergenic
1167213910 19:48151247-48151269 GCTTGGGAGGCGTGGTGGGCTGG + Exonic
1167281163 19:48569605-48569627 CTTTGGGAGGCCTAGATGGGAGG - Intronic
1167324235 19:48813950-48813972 CTTTGGGAGGCCGGGATGGGTGG + Intronic
1167437805 19:49490045-49490067 CCTGGGGAAGAGTGGCTGGCAGG - Intronic
1167652739 19:50741962-50741984 CTTTGGGAGGCCTAGATGGGTGG - Intergenic
1167836679 19:52078046-52078068 CCTTGGGAGGCCAAGATGGGTGG + Intronic
1167865955 19:52328071-52328093 CTTTGGGAGGCCGAGATGGCTGG + Intergenic
1167899740 19:52610914-52610936 CTTTGGGAGGCGGAGATGGGTGG - Intronic
1168114479 19:54214060-54214082 CTTTGGGAGGCGGAGATGGGAGG + Intronic
1168219430 19:54949857-54949879 CTTTGGGAGGCCTAGATGGGAGG + Intronic
1168487406 19:56775856-56775878 CCTTGGGAGGCCGAGATGGGCGG + Intronic
1168533211 19:57146585-57146607 CTTTGGGAGGCTGGGATGGGAGG - Intergenic
1202686527 1_KI270712v1_random:55024-55046 GCTTGGCAGGCTTGGCTGGCTGG + Intergenic
1202686894 1_KI270712v1_random:56698-56720 TCTTGGCTGGCTTGGATGGCTGG + Intergenic
1202687187 1_KI270712v1_random:57965-57987 GCTTGGGTGGCTTGGCTGGCTGG + Intergenic
925139480 2:1540073-1540095 CTCTGGGAGGCGTGGAGAGCTGG - Intronic
925225451 2:2180210-2180232 CCTTGGGGGGCTTGGAAGGAGGG - Intronic
925234451 2:2265863-2265885 CCTAAGGAGGCATGGATGGAGGG + Intronic
925344406 2:3160385-3160407 CCTTGGGTGGCATGGCTCGCAGG - Intergenic
925993691 2:9274564-9274586 CTTTGGGAGGCCGAGATGGCCGG - Intronic
926020198 2:9487940-9487962 ACTTGGGAGGCGAAGATGGGAGG - Intronic
926180298 2:10636956-10636978 CCTTGGGAGGCCCAGATGGGTGG + Intronic
926206075 2:10835201-10835223 GCTTGGGAGGCCTGGAAGGACGG - Intronic
926718425 2:15941969-15941991 CCGTGGGGGGCGCGGAAGGCGGG - Exonic
927113021 2:19877764-19877786 CTTTGGGAGGCCTGGGTGGAAGG + Intergenic
927788132 2:25988309-25988331 CTTTGGGAGGCCAGGGTGGCTGG - Intergenic
928695080 2:33841108-33841130 CTTTGGGAGGCCTAGATGGGCGG + Intergenic
928987534 2:37196068-37196090 CTTTGGGAGGCCTAGATGGGAGG - Intronic
929048148 2:37810900-37810922 CCTTGGGAGGCCGAGATGGGCGG + Intergenic
929118386 2:38464165-38464187 CTTTGGGAGGCCGGGATGGGCGG + Intergenic
929249631 2:39738453-39738475 ACTTGGGAGGCTGGGATGGGAGG + Intronic
929249998 2:39742790-39742812 CGTGGGGAGGGGTGGATAGCAGG + Intronic
929314625 2:40462563-40462585 CCTTGGGAAGCCTGGGTGGGAGG + Intronic
929491813 2:42403842-42403864 CTTTGGGAGGCCTAGATGGGGGG - Intronic
929677819 2:43955222-43955244 CCTTGGGAGGCAGAGGTGGCAGG + Intronic
929896568 2:45966072-45966094 CCTTGGGAGGCGTGGATGGCTGG + Intronic
929982237 2:46692304-46692326 CTTTGGGAGGCCTAGATGGGAGG - Intergenic
930078568 2:47428089-47428111 CTTTGGGAGGCGAGGCTGGCAGG + Intronic
930145536 2:47999115-47999137 CTTTGGGAGGCGGAGATGGGAGG - Intergenic
931411401 2:62035628-62035650 ACTTGGGAGGCTTGGGTGGGAGG + Intronic
931736859 2:65203096-65203118 ACTTGGGAGGCTGGGGTGGCAGG + Intergenic
931867936 2:66432355-66432377 CCTTGGGAGGCTGCGCTGGCTGG - Intergenic
932187466 2:69711084-69711106 CTTTGGGAGGCTGGGATGGGTGG + Intronic
932751291 2:74373335-74373357 CCTTGGGAGTGGTGGCTGGGCGG - Intronic
933067726 2:77818926-77818948 CCTTGGGAGGCTGAGATGGGAGG - Intergenic
933666233 2:84967438-84967460 CTTTGGGAGGCGGAGATGGGCGG - Intergenic
933883831 2:86699301-86699323 CTTTGGGAGGCGGAGATGGGCGG + Intronic
933958793 2:87396040-87396062 CCTTGGCTGGCTTGGCTGGCTGG - Intergenic
933958976 2:87396845-87396867 GCTTGGCTGGCTTGGATGGCCGG - Intergenic
933959073 2:87397283-87397305 GCTTGGCTGGCTTGGATGGCCGG - Intergenic
933959135 2:87397571-87397593 GCTTGGCAGGCTTGGCTGGCTGG - Intergenic
933959169 2:87397708-87397730 GCTTGGCTGGCTTGGATGGCCGG - Intergenic
933959468 2:87398954-87398976 TCTTGGCTGGCTTGGATGGCTGG - Intergenic
933959505 2:87399120-87399142 GCTTGGCTGGCGTGGATGGCTGG - Intergenic
933960565 2:87405907-87405929 TCTTGGGTGGCTTGGCTGGCTGG - Intergenic
933960756 2:87406793-87406815 TCTTGGGTGGCTTGGCTGGCTGG - Intergenic
933960834 2:87407141-87407163 GCTTGGCAGGCTTGGCTGGCCGG - Intergenic
933961041 2:87408090-87408112 TCTTGGCAGGCTTGGCTGGCTGG - Intergenic
933961062 2:87408189-87408211 GCTTGGCAGGCTTGGCTGGCTGG - Intergenic
933961259 2:87409075-87409097 TCTTGGCAGGCTTGGCTGGCTGG - Intergenic
933961280 2:87409174-87409196 GCTTGGCAGGCTTGGCTGGCTGG - Intergenic
933961553 2:87410407-87410429 TCTTGGCAGGCTTGGCTGGCTGG - Intergenic
933961691 2:87411048-87411070 TCTTGGCAGGCTTGGCTGGCTGG - Intergenic
933961713 2:87411151-87411173 GCTTGGCAGGCTTGGCTGGCTGG - Intergenic
933961830 2:87411697-87411719 TCTTGGCAGGCTTGGCTGGCTGG - Intergenic
933962067 2:87412883-87412905 GCTTGGCAGGCTTGGCTGGCCGG - Intergenic
933962279 2:87413841-87413863 TCTTGGCAGGCTTGGCTGGCTGG - Intergenic
933962300 2:87413940-87413962 GCTTGGCAGGCTTGGCTGGCTGG - Intergenic
933962407 2:87414408-87414430 TCTTGGGTGGCTTGGCTGGCTGG - Intergenic
933962717 2:87415716-87415738 TCTTGGGTGGCTTGGCTGGCTGG - Intergenic
933962836 2:87416288-87416310 TCTTGGGTGGCTTGGCTGGCTGG - Intergenic
933962903 2:87416605-87416627 GCTTGGGTGGCTTGGCTGGCTGG - Intergenic
933962934 2:87416753-87416775 GCTTGGGTGGCTTGGCTGGCTGG - Intergenic
933963275 2:87418203-87418225 GCTTGGTTGGCTTGGATGGCTGG - Intergenic
933963407 2:87418752-87418774 TCTTGGGTGGCTTGGCTGGCTGG - Intergenic
933963511 2:87419172-87419194 TCTTGGGTGGCTTGGCTGGCTGG - Intergenic
933963591 2:87419542-87419564 GCTTGGCAGGCTTGGCTGGCCGG - Intergenic
933963807 2:87420535-87420557 TCTTGGCAGGCTTGGCTGGCTGG - Intergenic
933963829 2:87420638-87420660 GCTTGGCAGGCTTGGCTGGCTGG - Intergenic
933964016 2:87421480-87421502 GCTTGGCAGGCTTGGCTGGCTGG - Intergenic
933964267 2:87422640-87422662 TCTTGGCAGGCTTGGCTGGCTGG - Intergenic
933964518 2:87423881-87423903 TCTTGGCAGGCTTGGCTGGCTGG - Intergenic
933964750 2:87424918-87424940 TCTTGGGTGGCTTGGCTGGCTGG - Intergenic
933964865 2:87425427-87425449 TCTTGGGTGGCTTGGCTGGCTGG - Intergenic
933965128 2:87426638-87426660 TCTTGGCAGGCTTGGCTGGCTGG - Intergenic
933965264 2:87427288-87427310 TCTTGGCAGGCTTGGCTGGCTGG - Intergenic
933965285 2:87427387-87427409 GCTTGGCAGGCTTGGCTGGCTGG - Intergenic
933965720 2:87429280-87429302 GCTTGGCTGGCTTGGATGGCCGG - Intergenic
933965915 2:87430129-87430151 TCTTGGCAGGCTTGGCTGGCTGG - Intergenic
933965937 2:87430232-87430254 GCTTGGCAGGCTTGGCTGGCTGG - Intergenic
934080083 2:88460248-88460270 ACTTGGGAGGCTTAGGTGGCAGG - Intergenic
934242956 2:90288194-90288216 CCTTGGCTGGCTTGGCTGGCTGG - Intergenic
934243170 2:90289149-90289171 TCTTGGCAGGCTTGGCTGGCTGG - Intergenic
934243192 2:90289252-90289274 GCTTGGCAGGCTTGGCTGGCTGG - Intergenic
934243397 2:90290223-90290245 GCTTGGCAGGCTTGGCTGGCTGG - Intergenic
934243894 2:90292399-90292421 GCTTGGCTGGCTTGGATGGCCGG - Intergenic
934243954 2:90292667-90292689 GCTTGGCTGGCGTGGCTGGCTGG - Intergenic
934244034 2:90292998-90293020 TCTTGGCTGGCTTGGATGGCTGG - Intergenic
934244071 2:90293164-90293186 GCTTGGCGGGCGTGGATGGCTGG - Intergenic
934244897 2:90297799-90297821 TCTTGGGTGGCTTGGCTGGCTGG - Intergenic
934244968 2:90298135-90298157 GCTTGGGTGGCTTGGCTGGCTGG - Intergenic
934263765 2:91498842-91498864 GCTTGGGTGGCTTGGCTGGCTGG + Intergenic
934263841 2:91499204-91499226 TCTTGGGTGGCTTGGCTGGCTGG + Intergenic
934264779 2:91504267-91504289 GCTTGGCTGGCGTGGATGGTTGG + Intergenic
934266363 2:91511308-91511330 GCTTGGCAGGCTTGGCTGGCTGG + Intergenic
934268049 2:91518812-91518834 CCTTGGCTGGCTTGGGTGGCTGG + Intergenic
934270238 2:91528567-91528589 CCTTGGCTGGCTTGGCTGGCTGG + Intergenic
934503436 2:94875443-94875465 CCTGGGGAGGCGTGGATGAGGGG - Intronic
934857308 2:97737451-97737473 CCTGGGGTGGCGGGGAAGGCGGG - Exonic
934948254 2:98557851-98557873 CCTTGGCAGGCGGGGGTGGAGGG - Intronic
934995131 2:98950587-98950609 CCTTGGGAGGCCGAGACGGCTGG + Intergenic
935913154 2:107919422-107919444 CTTTGGGAGGCCTTGATGGGTGG - Intergenic
935932416 2:108142198-108142220 CTTTGGGAGGCCTAGATGGGCGG + Intergenic
936120782 2:109742176-109742198 CTTTGGGAGGCCGGGATGGGCGG + Intergenic
936223915 2:110629284-110629306 CTTTGGGAGGCCGGGATGGGCGG - Intergenic
936374596 2:111929842-111929864 CTTTGGGAGGCCTAGGTGGCCGG - Intronic
936764253 2:115826475-115826497 CTTTGGGAGGCCTAGGTGGCTGG + Intronic
936950300 2:117971252-117971274 ACTTGGGAGGCTGAGATGGCAGG + Intronic
937200064 2:120196567-120196589 CTTTGGGAGGCCTAGATGGGTGG + Intergenic
937316827 2:120937035-120937057 CCTTGGAAGGAGGGGATGGAGGG - Intronic
937754701 2:125522617-125522639 ATTTGGGAGGCTTAGATGGCAGG + Intergenic
937885855 2:126899644-126899666 TCTTGGCAGGTGTGGAGGGCTGG - Intronic
938025918 2:127948031-127948053 CTTTGGGAGGCCAAGATGGCTGG - Intronic
938148163 2:128855574-128855596 CTTTGGGAGGCTGGGATGGGAGG + Intergenic
938905543 2:135832725-135832747 CTTTGGGAGGCGGAGATGGGAGG - Intronic
939003124 2:136758558-136758580 CCTGGGGAGGCGGGGCCGGCTGG - Intergenic
939702676 2:145413247-145413269 CCTTGGGAGGCATGGAGGAGAGG - Intergenic
939934117 2:148268323-148268345 CTTTGGGAGGCCTGGGTGGGGGG - Intronic
941397453 2:164990981-164991003 ACTTGGGAGGCTGAGATGGCAGG + Intergenic
941843454 2:170111402-170111424 ACTTGGGAGGCGGTCATGGCTGG + Intergenic
942681725 2:178483833-178483855 CTTTGGGAGGCCAAGATGGCAGG + Intronic
942739696 2:179161163-179161185 CTTTGGGAGGCTGAGATGGCAGG - Intronic
942826946 2:180189991-180190013 CTTTGGGAGGCTGAGATGGCAGG + Intergenic
942891847 2:180999625-180999647 TTTTGGGAGGGGTGGAGGGCGGG - Intronic
945225964 2:207530735-207530757 CCTTGCGAAGCGGGCATGGCAGG - Intronic
945246069 2:207718145-207718167 CCTTGGGAGGCCAGGGTGGGTGG - Intronic
945333502 2:208565621-208565643 CTTTGGGAGGCGAGGGTGGGTGG + Intronic
946034970 2:216734565-216734587 CCTTGGGAGGCCGAGATGGGCGG - Intergenic
947215894 2:227749752-227749774 CTTTGGGAGGCCTAGATGGGTGG - Intergenic
947279641 2:228436348-228436370 CTTTGGGAGGCCTAGATGGGAGG + Intergenic
947827222 2:233114597-233114619 CCTTGGGACGTGTGGATGCCTGG + Intronic
948313412 2:237007778-237007800 CCTTGGGATGTGTGTGTGGCTGG + Intergenic
948995487 2:241576214-241576236 CCAGGGGAGGGGTGGAGGGCTGG - Intergenic
1168906086 20:1404981-1405003 CTTTGGGAGGCGGAGATGGGAGG - Intergenic
1169187515 20:3631191-3631213 CCTTGGGAGGCTGAGATGGGAGG - Intronic
1169390295 20:5185314-5185336 CCTTGGGAGGCTGAGATGGGAGG + Intronic
1169539844 20:6587606-6587628 ACTTGGGAGGCTTAGATGGGAGG - Intergenic
1169864200 20:10182584-10182606 ACTTGGGAGGCTGGGATGGGAGG + Intergenic
1170100288 20:12691553-12691575 CTTTGGGAGGCCTAGATGGGAGG + Intergenic
1170580773 20:17697959-17697981 CTTTGGGAGGCCAGGATGGGCGG + Intronic
1170772412 20:19344596-19344618 GCTTGGGAGGCGGGGAGGACTGG + Intronic
1170831076 20:19841189-19841211 CCTTGGGAGGCTGGGGTGGAAGG - Intergenic
1171372046 20:24668548-24668570 CCTGGGGAGGCGGGGATGCCTGG - Intergenic
1171427779 20:25059003-25059025 CCCTGGGGGGCGGGGACGGCGGG + Intergenic
1171480052 20:25447885-25447907 CTTTGGGAGGCCTAGATGGGTGG + Exonic
1171878258 20:30598154-30598176 CCTTAGGAGGGGAGGAGGGCAGG - Intergenic
1172508821 20:35485127-35485149 CTTTGGGAGGCCTAGGTGGCCGG + Intronic
1172545860 20:35760844-35760866 ACTTGGGAGGCTTAGATGGGAGG + Intergenic
1172682117 20:36724682-36724704 CTTTGGGAGGCGGAGATGGATGG + Intronic
1172730454 20:37082751-37082773 CTTTGGGAGGCGAAGATGGGTGG + Intronic
1172790416 20:37501381-37501403 CCTTGGGAGGCCGAGATGGGTGG + Intronic
1173070756 20:39762725-39762747 ACTTGGGAGGCTGAGATGGCAGG + Intergenic
1173161755 20:40658113-40658135 CCTTGGGAGGTGTGGTTAGAGGG - Intergenic
1173196570 20:40918830-40918852 ACTTGGGAGGCTGGGATGGGAGG + Intergenic
1173610696 20:44365275-44365297 ACTTGGGAGGCTTAGATGGAAGG - Intronic
1174015621 20:47485790-47485812 CTTTGGGAGGCTGGGATGGGAGG + Intergenic
1174045739 20:47731434-47731456 CTTTGGGAGGCAGGGATGGGCGG - Intronic
1174635700 20:51997750-51997772 CTTTGGGAGGCCTAGATGGGAGG - Intergenic
1174770072 20:53291226-53291248 CCTTGGGAGGCCGAGATGGGTGG + Intronic
1175283348 20:57820145-57820167 CCATGGGAGGCCTGGGAGGCTGG + Intergenic
1176195647 20:63835467-63835489 CCTGGGGAGGCCTGGGTGGGAGG - Intergenic
1176622597 21:9069722-9069744 CCTGGGGAGGCGTGGGTGAGGGG + Intergenic
1177162618 21:17564247-17564269 CTTTGGGAGGCGGAGATGGGAGG + Intronic
1177922452 21:27169403-27169425 CGTTGGGAGGCTTGGGTGGGTGG + Intergenic
1177998256 21:28129911-28129933 CTTTGGGAGGCCTAGATGGGTGG - Intergenic
1178009358 21:28264997-28265019 CTTTGGGAGGCTTAGATGGGAGG + Intergenic
1178306375 21:31494155-31494177 CTTTGGGAGGCCAGGGTGGCTGG - Intronic
1178434858 21:32549155-32549177 CCATGGGAGGTGAGGCTGGCCGG - Intergenic
1178474712 21:32927532-32927554 ACTTGGGAGGCTGGGATGGAAGG + Intergenic
1178557138 21:33602081-33602103 CCTTGGGAAGCCAGGATGGGAGG - Intronic
1178636723 21:34309988-34310010 CTTTGGGAGGCCGAGATGGCCGG - Intergenic
1178862934 21:36304438-36304460 CTTTGGGAGGCTTAGATGGGAGG - Intergenic
1178979843 21:37254386-37254408 CTTTGGGAGGCTAGGATGGGAGG + Intronic
1179217770 21:39381980-39382002 CTTTGGGAGGCCAGGATGGGTGG - Intronic
1179327295 21:40360375-40360397 CTTTGGGAGGCCTAGATGGGCGG - Intronic
1179571858 21:42283205-42283227 CCTTCTGAGGGGGGGATGGCGGG + Intronic
1179770329 21:43610495-43610517 ACTTGGGAGGCTGGGATGGGAGG + Intronic
1180553934 22:16561053-16561075 CCTTGGCTGGCTTGGATGGCTGG - Intergenic
1180554456 22:16563687-16563709 GCTTGGAAGGCTTGGCTGGCTGG - Intergenic
1180554818 22:16565251-16565273 TCTTGGGTGGCTTGGCTGGCTGG - Intergenic
1180554838 22:16565338-16565360 GCTTGGCAGGCTTGGCTGGCTGG - Intergenic
1180554899 22:16565592-16565614 GCTTGGCTGGCTTGGATGGCTGG - Intergenic
1180555155 22:16566664-16566686 GCTTGGGTGGCTTGGCTGGCCGG - Intergenic
1180555381 22:16567639-16567661 GCTTGGCTGGCTTGGATGGCTGG - Intergenic
1180791498 22:18577739-18577761 CCTTGGGGGGCGGGGGTCGCGGG - Intergenic
1180905772 22:19410023-19410045 CCTGGGGAGGCCTGGTTGGAGGG + Intronic
1180938135 22:19639408-19639430 TCTTGGGAGGCCAGGCTGGCTGG + Intergenic
1181163224 22:20969670-20969692 CCTTGGGAGGCCGAGATGGGCGG - Intronic
1181229019 22:21410018-21410040 CCTTGGGAGGCTTGAATGACAGG - Intergenic
1181249632 22:21524847-21524869 CCTTGGGAGGCTTGAATGACAGG + Intergenic
1181254874 22:21555989-21556011 CTTTGGGAGGCGGGGATGGGTGG + Intronic
1181616492 22:24058494-24058516 CCTTGGGAGGAGTGCCTGCCAGG + Intronic
1181949849 22:26545966-26545988 ACTTGGGAGGCTTAGATGGGAGG + Intronic
1182202994 22:28592405-28592427 CTTTGGGAGGCCTAGATGGGAGG + Intronic
1182286215 22:29249514-29249536 CTTTGGGAGGCTGAGATGGCCGG - Intronic
1182661600 22:31929127-31929149 CCTTGGGAGGGCAGGAGGGCAGG - Intergenic
1182760885 22:32721438-32721460 CCTTGGGATGGATGGATGGATGG - Intronic
1182830208 22:33298963-33298985 CTTTGGGAGGCCTGGGTGGGCGG + Intronic
1182846222 22:33433351-33433373 CTTTGGGAGGCCGGGATGGGCGG + Intronic
1183110894 22:35647738-35647760 CTTTGGGAGGCCTAGATGGATGG + Intergenic
1183187070 22:36298251-36298273 CCTTGAGAGGAGTGGACAGCTGG - Intronic
1183557047 22:38537093-38537115 CTTTGGGAGGCCTAGATGGTTGG - Intronic
1183782735 22:40009133-40009155 CCTTGGGAGGCAGGCAGGGCAGG + Intronic
1183902369 22:41016051-41016073 CTTTGGGAGGCCTAGATGGGTGG - Intergenic
1184293528 22:43510206-43510228 CCTAGGGAGGTGTGCAGGGCAGG + Intergenic
1184613673 22:45622985-45623007 ACTTGGGAGGCTTAGATGGGAGG - Intergenic
1185065700 22:48630824-48630846 CCTCGGGGGGCCTGGCTGGCTGG - Intronic
1185067603 22:48639940-48639962 CCTTGGGCGGCGGGGTTGGGGGG - Intronic
949874877 3:8619823-8619845 CCTTGGCAAACGTGAATGGCAGG + Exonic
950209849 3:11114790-11114812 CTTTGGGAGGCGGAGATGGGAGG - Intergenic
950270974 3:11614601-11614623 CCGTGGGAAACCTGGATGGCTGG - Intronic
950730787 3:14955072-14955094 CTTTAGGAGGCCGGGATGGCTGG - Intronic
950735574 3:15005293-15005315 ACTTGGGAGGCGTAGATGGGAGG - Intronic
950799610 3:15539477-15539499 CCCTGGGAGGTGTGGTTGACTGG - Intergenic
950889849 3:16394121-16394143 CTTTGGGAGGCCAGGATGGGAGG + Intronic
951401381 3:22236438-22236460 ACTTGGGAGGCTTAGATGGGAGG - Intronic
951531990 3:23706521-23706543 CCTTGGGAGGCCAAGATGGGAGG + Intergenic
952317904 3:32247702-32247724 CTTTGGGAGGCCTAGATGGATGG - Intronic
953040732 3:39252902-39252924 CCTGGGGAGGAGTGGCTGGGAGG + Intergenic
953776990 3:45827944-45827966 CTTTGGGAGGCCAAGATGGCAGG - Intronic
954170638 3:48799307-48799329 CTTTGGGAGGCCTAGATGGGAGG + Intronic
954179737 3:48872371-48872393 CCTTGGGAGGCCAGGATGGGTGG - Intronic
954697577 3:52435839-52435861 CCTTGGGTGGGGTGGAAGCCAGG + Exonic
954739076 3:52732436-52732458 CCTTGGGAGGCCGAGATGGGCGG - Intronic
955216253 3:56986966-56986988 CCTTGGGAGGCCATGATGGGAGG + Intronic
955278621 3:57572475-57572497 CTTTGGGAGGCGGAGATGGGAGG + Intronic
955351616 3:58197694-58197716 CTTTGGGAGGCCTCGATGGATGG - Intronic
955369122 3:58335827-58335849 CCTTGGGAGGCAGGCAGGGCAGG - Intronic
955806809 3:62745189-62745211 ACTTGGGAGGCTGGGATGGGAGG - Intronic
955828842 3:62980045-62980067 CCTTGGGAGGCTGGGGTGGGAGG - Intergenic
955944610 3:64180774-64180796 CCTTGGGAGGCCAAGATGGGTGG - Intronic
956161519 3:66358733-66358755 CTTTGGGAGGCCCGGATGGGAGG - Intronic
957183865 3:76916580-76916602 CTTTGGGAGGCCTGGGTGGGAGG - Intronic
957653060 3:83034887-83034909 CCTTGGCAGGCGTGGAATCCAGG - Intergenic
958610500 3:96418132-96418154 TCTTGGGAGGCTTGGGTAGCAGG - Intergenic
958718404 3:97815787-97815809 CTTTGGGAGGCTGAGATGGCAGG - Intergenic
958876114 3:99619200-99619222 CTTTGGGAGGCTGGGGTGGCAGG + Intergenic
958975312 3:100660707-100660729 CTTTGGGAGGCGGGGGTGGGTGG + Intronic
960622053 3:119646528-119646550 ACTTGGGAGGCTGGGATGGGAGG + Intronic
960828734 3:121821207-121821229 CTTTGGGAGGCTGAGATGGCAGG - Intronic
960891750 3:122455797-122455819 CTTTGGGAGGCCTAGATGGGAGG - Intronic
961046385 3:123711561-123711583 CCCTGTGAGACGTGGATGGCAGG - Intronic
961381182 3:126497505-126497527 ACCTGGCAGGCGTGGAAGGCTGG + Intronic
961833656 3:129639003-129639025 CTTTGGGAGGCGGAGATGGGTGG + Intergenic
961891519 3:130134114-130134136 CTTTGGGAGGCCAGGATGGTCGG + Intergenic
962108922 3:132421681-132421703 CTTTGGGAGGCCTGGGTGGGTGG - Intronic
963638606 3:147831104-147831126 CTTTGGGAGGCGGGGATGGGGGG - Intergenic
963755447 3:149231054-149231076 ACTTGGGAGGCTGGGGTGGCAGG + Intergenic
963920554 3:150900978-150901000 ACAAGGGAGACGTGGATGGCAGG - Intronic
964489058 3:157215358-157215380 CCTTGGGAGGCCTAGGTGGGAGG - Intergenic
964882523 3:161439879-161439901 CTTTGGGAGGCCTAGGTGGCAGG + Intergenic
965876125 3:173322502-173322524 CTTTGGGAGGCGGAGATGGGAGG - Intergenic
966715813 3:183012123-183012145 ACTTGGGAGGCTGGGATGGGAGG - Intergenic
966739024 3:183214741-183214763 CTTTGGGAGGCGGAGATGGGTGG + Intronic
966901209 3:184487273-184487295 CTTTGGGAGGCCTAGATGGGCGG - Intronic
967300576 3:188008616-188008638 ACTTGGGAGGCTGGGGTGGCAGG - Intergenic
967944631 3:194793944-194793966 CTTTGGGAGGCGGAGGTGGCAGG + Intergenic
968021884 3:195399425-195399447 CTTTGGGAGGCTGGGATGGGAGG - Intronic
968085213 3:195871068-195871090 CCCTGAGAGGCGTGGAAAGCAGG - Intronic
968147451 3:196311304-196311326 ACTTGGGAGGCGGAGATGGGAGG + Intronic
968633927 4:1667985-1668007 CCTTGGGAGGCGCGGCTAGGAGG + Intronic
968778122 4:2557707-2557729 CTTTGGGAGGCTGGGATGGACGG + Intronic
968825463 4:2893170-2893192 CTTTGGGAGGCGAAGATGGGTGG - Intronic
969666255 4:8559033-8559055 TCTCTGGTGGCGTGGATGGCAGG + Intronic
969751105 4:9111966-9111988 CTTTGGGAGGCCAGGATGGTCGG - Intergenic
971192465 4:24440556-24440578 CTTTGGGAGGCCGGGATGGGCGG + Intergenic
972394412 4:38646416-38646438 CTTTGGGAGGCTTAGATGGGCGG - Intergenic
972734101 4:41823459-41823481 CTTTGGGAGGCTTGGGTGGGTGG + Intergenic
973213593 4:47643814-47643836 CCTTTGGAAGTGGGGATGGCTGG - Intronic
973730773 4:53820324-53820346 CCTTGGGAGGCCAAGATGGGAGG - Intronic
974038054 4:56834381-56834403 CTTTGGGAGGCGGAGATGGGAGG + Intergenic
974142587 4:57906186-57906208 CTTTGGGAGGCCGGGATGGGTGG + Intergenic
974247315 4:59336344-59336366 CTTTGGGAGGCGTAGGTGGGCGG - Intergenic
974408994 4:61514274-61514296 CCTTGGGAGATCTGTATGGCAGG + Intronic
974597507 4:64033619-64033641 CCTTGGGAGGCGGAGGTGGGAGG - Intergenic
975170296 4:71225106-71225128 CTTTGGGAGGCCTGGGTGGGTGG + Intronic
975670752 4:76778463-76778485 CTTTGGGAGGCCGGGATGGATGG - Intronic
975906306 4:79216782-79216804 CCTAAGGAGTGGTGGATGGCTGG + Intergenic
976245774 4:83004740-83004762 CCTTGGGAGGCCAAGGTGGCAGG - Intronic
977211799 4:94226945-94226967 CTTTGGGAGGCTGAGATGGCAGG - Intronic
977606707 4:98992296-98992318 CTTTGGGAGGCGGGGGTGACAGG + Intergenic
978559553 4:110018007-110018029 CTTTGGGAGGCCAGGATGGGGGG + Intergenic
980042175 4:127952160-127952182 CTTTGGGAGGCCTGGGTGGGCGG + Intronic
980051063 4:128040959-128040981 CTTTGGGAGGCGGAGGTGGCTGG + Intergenic
980052827 4:128055123-128055145 CTTTGGGAGGCGGGGACGGGCGG + Intergenic
980572201 4:134634617-134634639 CTTTGGGAGGCCTAGATGGGTGG - Intergenic
980622320 4:135324156-135324178 CTTTGGGAGGCCAGGATGGGTGG + Intergenic
980818712 4:137983401-137983423 CTTTGGGAGGCCTGGCAGGCAGG + Intergenic
980915069 4:139026342-139026364 CTTTGGGAGGCTGGGATGGGTGG - Intronic
980940926 4:139273326-139273348 ACTTGGGAGGCTTTGATGGGAGG - Intronic
981013633 4:139951449-139951471 CCTGTGGAGGCCTGGAGGGCAGG + Intronic
981437399 4:144741623-144741645 CTTTGGGAGGCCTGGGGGGCTGG - Exonic
981692803 4:147528465-147528487 CCTTGGGAGGCTGGGGTGGGAGG - Intronic
982009582 4:151093659-151093681 CTTTGGGAGGCTGGGATGGGTGG + Intergenic
982179078 4:152733314-152733336 CTTTGGGAGGCCTAGATGGGAGG - Intronic
982225836 4:153165574-153165596 CTTTGGGAGGCTTAGATGGGAGG - Intronic
982680677 4:158425328-158425350 CTTTGGGAGGCCAGGATGGGAGG - Intronic
982863105 4:160479305-160479327 ACTTGGGAGGCTGAGATGGCAGG + Intergenic
983254282 4:165379802-165379824 GCTTGGGAGGCTGGGGTGGCGGG + Intronic
983874658 4:172862453-172862475 CCTTGGGAGGCCAAGATGGGTGG + Intronic
984502248 4:180571085-180571107 CGGTGGGTGACGTGGATGGCTGG - Intergenic
984629497 4:182045937-182045959 GCTTGGGAGGCCAGGATGGGAGG + Intergenic
985176411 4:187207827-187207849 CCTTGGGAGGCTGAAATGGCAGG - Intergenic
985341615 4:188960678-188960700 CAATGGGAGGTGTGGATGCCGGG - Intergenic
985851119 5:2389687-2389709 CCTGGGGAGGCAGGGAGGGCAGG - Intergenic
985906010 5:2837367-2837389 CCTTGGGAGGCGGAGGTGGGCGG + Intergenic
987286753 5:16465230-16465252 TCTTGGGAGACATGGACGGCTGG + Exonic
987884726 5:23799223-23799245 CTTTGGGAGGCGGAGATGGGTGG - Intergenic
988450600 5:31339126-31339148 CTTTGGGAGGTGGAGATGGCCGG + Intergenic
988527246 5:31998082-31998104 CCTTGGGAGGCTGAGATGGATGG - Intronic
988866014 5:35335932-35335954 CCTTGGGCAGCCTGGCTGGCAGG - Intergenic
990374862 5:55159258-55159280 CTTTGGGAGGCCTAGATGGGAGG - Intronic
990391414 5:55325591-55325613 CTTTGGGAGGCCAAGATGGCTGG - Intronic
990473496 5:56139826-56139848 ACTTGGGAGGCCTGGGTGGGAGG + Intronic
992191237 5:74294205-74294227 CCTTGGCAGAGGTGGGTGGCAGG - Intergenic
992329976 5:75706670-75706692 CCTTGGGAGGCTGGGGTGGGAGG - Intronic
992841063 5:80695575-80695597 CTTTGGGAGGCTAGGATGGGTGG - Intronic
995090057 5:108163642-108163664 CTTTGGGAGGCCTAGATGGGCGG - Intronic
995277139 5:110289746-110289768 TCTTGGGAGGCTTTGATGGCAGG + Intronic
995769064 5:115650606-115650628 CTTTGGGAGGCGGAGATGGGTGG - Intergenic
995787664 5:115847372-115847394 CGTTGGGAGGCCTAGATGGGAGG + Intronic
995900564 5:117060946-117060968 CCTTGGGAGGCCTAGGTGGGTGG - Intergenic
996872471 5:128206783-128206805 ACTTGGGAGGCTTAGGTGGCAGG - Intergenic
997124917 5:131216391-131216413 ACTTGGGAGGCGGAGATGGAAGG + Intergenic
998150475 5:139754321-139754343 ACTTGGGAGGCTTAGATGGTAGG + Intergenic
998426648 5:142034558-142034580 ACTTGGGAGGCTGAGATGGCAGG - Intergenic
998491110 5:142547193-142547215 CCTTGGGAGGCCGAGATGGGTGG - Intergenic
998668030 5:144321096-144321118 CCTTGGGAGGCCGAGATGGGTGG - Intronic
998792376 5:145778746-145778768 CCCTTGGAGGCGTGGAAGCCAGG + Intronic
999304442 5:150510516-150510538 CCTTGGGACGGGAGGGTGGCAGG + Intronic
999407249 5:151317206-151317228 CTTTGGGAGGCCTAGATGGGTGG + Intronic
1000723245 5:164734868-164734890 CTTTGGGAGGCCAGGGTGGCTGG - Intergenic
1001596651 5:172902971-172902993 CCTGGGGAGGTGTGGGTGGGGGG - Intronic
1001940193 5:175734743-175734765 CCTTGGGAGGCTGAGGTGGCAGG + Intergenic
1002037228 5:176481287-176481309 CCTTGGGAGGCGGAGGTGGGTGG - Intronic
1002385741 5:178865508-178865530 CTTTGGGAGGCCGAGATGGCTGG - Intronic
1003307683 6:4944525-4944547 CCTGGGGAGGCCTGGCTGCCTGG - Intronic
1003769656 6:9284958-9284980 CCTTGGGAGGCTGAGATGGGAGG - Intergenic
1004141559 6:13022771-13022793 CCTTGGGAGGCTGAGATGGGTGG + Intronic
1004458713 6:15816100-15816122 CTTTGGGAGGCTGGGACGGCCGG + Intergenic
1004482250 6:16031997-16032019 ACTTGGGAGGCTGGGATGGGAGG + Intergenic
1004546050 6:16599209-16599231 CCTTGGAAGGCAATGATGGCTGG - Intronic
1005011058 6:21336139-21336161 CTTTGGGAGGCGGAGATGGGCGG + Intergenic
1005283780 6:24302772-24302794 CTGTGGGAGGAGTGGAGGGCTGG - Intronic
1005335489 6:24792053-24792075 CTTTGGGAGGCCTAGATGGGAGG - Intergenic
1006078622 6:31550927-31550949 CTTTGGGAGGCTAGGCTGGCAGG - Intronic
1006304399 6:33210355-33210377 CTTTGGGAGGTGAGGATGGGAGG + Intronic
1006565488 6:34952951-34952973 CTTTGGGAGGCCGGGATGGGTGG - Intronic
1006766048 6:36508177-36508199 CTTTGGGAGGCTGGGATGGGAGG - Intronic
1007004493 6:38347751-38347773 CATTGGGAGGCCTGGGTGGGTGG + Intronic
1008098828 6:47369531-47369553 CCTTGGGAGGCCAAGATGGGTGG - Intergenic
1008502140 6:52193855-52193877 CTTTGGGAGGCCAGGATGGGAGG + Intergenic
1008947506 6:57115014-57115036 CTTTGGGAGGCCTAGATGGGAGG + Intronic
1008963842 6:57294234-57294256 CTTTGGGAGGCGTAGGTGGGTGG + Intergenic
1010971257 6:82265531-82265553 CTTTGGGAGGCCTGGGTGGGTGG - Intergenic
1011003775 6:82621266-82621288 CCTTGGGAGGCCAAGATGGGCGG + Intergenic
1011083666 6:83515723-83515745 CTTTGGGAGGCTGGGATGGGAGG - Intronic
1011312065 6:85990247-85990269 CTTTGGGAGGCGGAGATGGGCGG - Intergenic
1011362804 6:86546506-86546528 CCTTGGGAGGCCGAGATGGGTGG - Intergenic
1011672862 6:89700757-89700779 CCTTGGGGAGAGTGGATGGCAGG - Exonic
1013021453 6:106224630-106224652 CTTTGGGAGGCCTGGGTGGGCGG + Intronic
1013229050 6:108144786-108144808 CTTTGGGAGGCCTGGACGGGTGG + Intronic
1013291263 6:108720722-108720744 CTTTGGGAGGCCAGGATGGGTGG - Intergenic
1013367739 6:109447939-109447961 CCTGGGGAGGCCTGGCTGACAGG + Exonic
1013846500 6:114459241-114459263 CCTTGGTAGGCGTGGTTGGGAGG + Intergenic
1014098543 6:117484590-117484612 CCTTGGGAGGCCGGGGTGGGTGG - Intronic
1014756227 6:125304099-125304121 ACTTGGGAGGCTTAGATGGGAGG + Intergenic
1014966556 6:127760539-127760561 CTTTGGGAGGCTTGGGTGGGAGG + Intronic
1015096248 6:129417638-129417660 CAGTGGGCGCCGTGGATGGCAGG - Intronic
1015230136 6:130905525-130905547 ACTTGGGAGGCTAGGATGGGAGG - Intronic
1015301205 6:131654684-131654706 CTTTGGGAGGCCAAGATGGCAGG - Intronic
1015796667 6:137019370-137019392 CTTTGGGAGGCCAAGATGGCAGG - Intronic
1015858322 6:137649338-137649360 GCTTGGGAGGCTGGGATGGGAGG - Intergenic
1015981481 6:138843931-138843953 CCTTGGGAGGCCAGGGTGGGCGG - Intronic
1016472556 6:144389840-144389862 CTTTGGGAGGCCAGGATGGGCGG - Intronic
1016558069 6:145361951-145361973 CTTTGGGAGGCGAAGATGGGTGG + Intergenic
1016955495 6:149622745-149622767 CCTTGGGAGGCCTGGCAGGGGGG + Intronic
1017748425 6:157467791-157467813 CTTTGGGAGGCCGGGATGGGCGG - Intronic
1018252409 6:161883894-161883916 CCTTGGGAGGCCAAGATGGGCGG - Intronic
1018919402 6:168161036-168161058 CATTGGGGGGCGTGGTTGTCTGG + Intergenic
1019350734 7:552818-552840 CCCGGGGAGGCCGGGATGGCTGG - Intronic
1019697865 7:2457609-2457631 ACTTGGGAGGCTGGGATGGGAGG - Intergenic
1019855357 7:3600789-3600811 CTTTGGGAGGCCGAGATGGCCGG - Intronic
1019890492 7:3942147-3942169 CTTTGGGAGGCTTGGGTGGGCGG - Intronic
1019973108 7:4558045-4558067 CCTTGGGAGGCTGAGATGGCAGG - Intergenic
1020051485 7:5084865-5084887 ACTTGGGAGGCGGGGGTGGGAGG + Intergenic
1020099880 7:5388794-5388816 CCTTGGGGGGCGCGGGCGGCGGG + Exonic
1020293137 7:6738222-6738244 CTTTGGGAGGCCAAGATGGCTGG - Intergenic
1021621063 7:22551432-22551454 CCTTGGGAGGCCTGAAAGGAAGG - Intronic
1021782504 7:24119767-24119789 CCTTGGGCAGAGTGGCTGGCAGG + Intergenic
1022153402 7:27633548-27633570 CCTTGGGAGGCTAAGATGGGAGG + Intronic
1022160971 7:27710818-27710840 CTTTCGGAGGCGAGGATGGGAGG + Intergenic
1023518465 7:41027221-41027243 TCTTGGAAGGCGTGGATGCAGGG - Intergenic
1023758178 7:43439740-43439762 CAGTGGGAGGCTTGGAGGGCGGG - Intronic
1024188048 7:46974673-46974695 ACTTGGGAGGCCTAGATGGGTGG + Intergenic
1024190954 7:47009301-47009323 CCTTGGGAGGCTGAGATGGGTGG + Intergenic
1025859404 7:65312309-65312331 CTTTGGGAGGCCTAGATGGGTGG + Intergenic
1026324797 7:69299804-69299826 CCATGGGAGGCGCGGAGGTCTGG - Intergenic
1026395928 7:69954388-69954410 ACTTGGGAGGCTGAGATGGCGGG - Intronic
1026676853 7:72435462-72435484 CCGAGGGAGGCGTGGATGAATGG - Intronic
1026866774 7:73828981-73829003 CTTTGGGAGGCCAGGATGGGAGG - Exonic
1026886622 7:73952892-73952914 CCTTGGGAGGCTGAGATGGGAGG - Intergenic
1026929714 7:74217068-74217090 CTTTGGGAGGCGGGGACGCCTGG + Intronic
1027312397 7:76962750-76962772 CTTTGGGAGGCTGGGATGGGAGG - Intergenic
1027448224 7:78299059-78299081 CTTTGGGAGGCCGGGATGGGTGG - Intronic
1028972882 7:96878079-96878101 CTTTGGGAGGCCAGGATGGATGG - Intergenic
1029276837 7:99410471-99410493 CCTTGGGAGGCTGAGATGGGAGG - Intronic
1029478944 7:100801514-100801536 CCTTGGGAGGCTGGGAGGGGAGG + Intergenic
1029543966 7:101200717-101200739 GCTGGGGAGGCGTGGGTGCCTGG - Intronic
1029620172 7:101685341-101685363 CTTTGGGAGGCAGAGATGGCTGG + Intergenic
1030024927 7:105314086-105314108 CTTTGGGAGGCGAGGCTGGCCGG + Intronic
1030115056 7:106056619-106056641 CTTTGGGAGGCTGGGATGGATGG - Intergenic
1031044797 7:116875782-116875804 CTTTGGGAGGCTGGGATGGGAGG - Intronic
1031206419 7:118764023-118764045 GCTTGGGAGGCTTGAATGGAGGG + Intergenic
1032462030 7:132118945-132118967 CCCTGGGAGAGGTGGCTGGCAGG - Intergenic
1033160020 7:138987171-138987193 CTTTGGGAGGCCAGGATGGGTGG + Intergenic
1033198953 7:139351949-139351971 CAGTGGGAGGCCTGGATGGGAGG + Intronic
1033389769 7:140915677-140915699 CTTTGGGAGGCCAGGATGGGTGG - Intronic
1034117708 7:148599104-148599126 CTTTGGGAGGCGTAGGTGGGTGG - Intronic
1034198758 7:149267370-149267392 CCTGGGCAGGAGTGGGTGGCTGG + Intronic
1035839631 8:2796450-2796472 CCTTGGGAGGCCGAGATGGGCGG + Intergenic
1036374312 8:8187377-8187399 CTTTGGGAAGCCAGGATGGCCGG - Intergenic
1036440368 8:8776585-8776607 CTTTGGGAGGCGGAGGTGGCTGG + Intergenic
1036876594 8:12478258-12478280 CTTTGGGAAGCCAGGATGGCCGG + Intergenic
1037121300 8:15290470-15290492 CCTTGGGCCCCCTGGATGGCTGG - Intergenic
1037138610 8:15493504-15493526 CTTTGGGAGGCAGGGATGGGAGG - Intronic
1037869616 8:22480850-22480872 CTTTGGGAGGCCTAGATGGGAGG + Intronic
1037963874 8:23118468-23118490 CTTTGGGAGGCGGAGATGGGCGG + Intergenic
1038209058 8:25498461-25498483 CTTTGGGAGGCCTGGGGGGCGGG - Intronic
1038855384 8:31325522-31325544 CCTTGGGAGGCCAGGGTGGGAGG - Intergenic
1039294695 8:36137682-36137704 CCTTGGGAGGCGAAGGTGGGAGG + Intergenic
1039459326 8:37730230-37730252 CTTTGGGAGGCCTAGGTGGCTGG + Intergenic
1039474466 8:37832443-37832465 CCTTGGGAGGCGGAGGTGGGAGG - Intronic
1039476007 8:37839756-37839778 CCTTGGAAGGCAGGGATGGTGGG + Intronic
1039831797 8:41221280-41221302 CCTCGGGAGGCCAGGATGGGAGG - Intergenic
1039945324 8:42123820-42123842 CCCTGGGAGGGGAGGGTGGCTGG - Intergenic
1039964610 8:42274799-42274821 CTTTGGGAGGCTGGGATGGCGGG - Intronic
1040472284 8:47744169-47744191 CCTTGGCAGGGGTGGAGGGTGGG + Intergenic
1040497371 8:47978272-47978294 CTTTGGGAGGCCGAGATGGCTGG + Intergenic
1041458264 8:58083673-58083695 CCAGGGGAGGCGTGGATGGTGGG - Intronic
1042243173 8:66685030-66685052 CTTTGGGAGGCCTAGATGGGTGG - Intronic
1042342931 8:67699172-67699194 CCTTGGGAGGCCGAGATGGGTGG + Intronic
1042583151 8:70304736-70304758 CCTTGGGAGGCCAAGATGGGTGG - Intronic
1043029036 8:75107712-75107734 CTTTGGGAGGCCTAGATGGGTGG + Intergenic
1043046645 8:75332478-75332500 ACTTGGGAGGCTGGCATGGCAGG - Intergenic
1043524324 8:81080011-81080033 CTTTGGGAGGCCTTGATGGGAGG - Intronic
1044508793 8:93051280-93051302 CTTTGGGAGGCTGAGATGGCAGG - Intergenic
1044578823 8:93801643-93801665 CTTTGGGAGGCTGAGATGGCAGG - Intronic
1044664551 8:94622149-94622171 CTTTGGGAGGCTAGGGTGGCTGG - Intergenic
1044774283 8:95671491-95671513 CCTTGGGAGGCTTAGGTGGGTGG + Intergenic
1045229473 8:100288815-100288837 CTTTGGGAGGCCAGGATGGGCGG + Intronic
1045280893 8:100748838-100748860 ACTTGGGAGGCGGAGATGGGAGG + Intergenic
1045463303 8:102445621-102445643 CTTTGGGAGGCCGAGATGGCCGG - Intergenic
1045464849 8:102460400-102460422 ACTTGGGAGGCTGGGATGGGAGG + Intergenic
1045490910 8:102668533-102668555 CCTTGAGAGGCTTGGATGGGAGG + Intergenic
1045491649 8:102674784-102674806 CTTTGGGAGGCAGGGATGGGAGG - Intergenic
1045827314 8:106413969-106413991 CTTTGGGAGGCTGGGATGGGTGG - Intronic
1046470604 8:114668651-114668673 ACTTGGGAGGCTTGGATGGGAGG + Intergenic
1046508699 8:115171354-115171376 CTTTGGGAGGCCTAGATGGGTGG + Intergenic
1047085129 8:121507501-121507523 ATTTGGGGGGGGTGGATGGCTGG - Intergenic
1047603759 8:126453551-126453573 CTTTGGGAGGCGGAGATGGGCGG + Intergenic
1047626518 8:126662143-126662165 ACTTGGGAGGCTGAGATGGCAGG - Intergenic
1048799428 8:138182419-138182441 GTGTGGCAGGCGTGGATGGCAGG - Intronic
1049100291 8:140574368-140574390 GCTTGGGAGGCTGGGATGGGAGG - Intronic
1049402610 8:142436305-142436327 CCTTGGAAGGTGTGGGTGCCTGG - Intergenic
1049585469 8:143430708-143430730 CCGTGGGAGGCGGGGCCGGCCGG - Intergenic
1050078875 9:1893891-1893913 CCTTGGCAGGAATGAATGGCTGG - Intergenic
1051071487 9:13173457-13173479 CTTTGGGAGGCGGAGATGGGTGG + Intronic
1051216049 9:14798915-14798937 CTTTGGGAGGCCAGGATGGGTGG - Intronic
1051391192 9:16565697-16565719 CCTTGGGAGGCTGAGATGGGAGG + Intronic
1052341027 9:27364196-27364218 CCTGGGGAGCTGTGCATGGCTGG + Intronic
1053031988 9:34788284-34788306 CCTTGGGAGGCTGAGATGGAAGG - Intergenic
1053356366 9:37449139-37449161 CCTTGGGAGGCCTAGGTGGGAGG + Intronic
1053750525 9:41249800-41249822 CTTTGGGAGGCCAGGATGGGGGG - Intergenic
1054715881 9:68557407-68557429 CTTTGGGAGGCCTAGATGGGAGG + Intergenic
1056195861 9:84227976-84227998 CTTTGGGAGGCGGGGGTGGGTGG - Intergenic
1056387557 9:86111764-86111786 CCTTGGGAGGCTGGGGTGGGTGG - Intergenic
1056756640 9:89385868-89385890 CCTTGGCAGGGGTGGGTGGGCGG - Intronic
1056795432 9:89655649-89655671 TCTTGGAAGGCGAGGAGGGCAGG + Intergenic
1057133884 9:92672970-92672992 CTTTGGGAGGCCGAGATGGCCGG + Intergenic
1057186151 9:93058621-93058643 CCTGGGCGGGCGTGGAGGGCGGG + Intergenic
1057278946 9:93696962-93696984 CTTTGGGAGGCCGGGATGGGTGG + Intergenic
1057353633 9:94318944-94318966 CCTGGGGAGGAGAGGTTGGCCGG + Exonic
1057569101 9:96190264-96190286 CCTTGGCAGGGGTGGTTGGAAGG + Intergenic
1057625077 9:96669549-96669571 CTTTGGGAGGCCTAGATGGGTGG + Intergenic
1057654118 9:96938648-96938670 CCTGGGGAGGAGAGGTTGGCCGG - Exonic
1057782829 9:98063784-98063806 CTTTGGGAGGCCTAGATGGGAGG - Intronic
1058449258 9:105080829-105080851 CTTTGGGAGGCCTAGATGGGTGG - Intergenic
1059087700 9:111321864-111321886 CTTTGGGAGGCCTAGATGGGTGG - Intergenic
1059219396 9:112598831-112598853 CTTTGGGAGGCCTGGGTGGGAGG + Intronic
1059564812 9:115373304-115373326 CTTTGGGAGGCCTAGATGGGAGG + Intronic
1059952148 9:119477240-119477262 CTTTGGGAGGCCTAGATGGGTGG - Intergenic
1060105137 9:120868838-120868860 CCTCGGGAGGCGGGCCTGGCGGG - Intronic
1060323129 9:122584592-122584614 CTTTGGGAGGCGGGGGTGGGGGG + Intergenic
1060758685 9:126230622-126230644 CCTTGGCAGGCCTGTGTGGCTGG - Intergenic
1060990782 9:127847691-127847713 CCTTGGGAGGCTGAGATGGGTGG - Intronic
1061566612 9:131444883-131444905 CCTTGGAAGCCGAGGGTGGCTGG + Intronic
1061733380 9:132634812-132634834 CTTTGGGAGGCTGGGATGGGGGG - Intronic
1061765546 9:132878889-132878911 ACTTGGGAGGCGAGGGTGGGTGG - Exonic
1061772442 9:132936358-132936380 CCTTGGGAGGCCTTGGTGGGAGG - Intronic
1062024073 9:134332432-134332454 GCTGGGGAGGCGGGGATTGCTGG + Intronic
1062501278 9:136853037-136853059 CCTAGGCAGGCTGGGATGGCTGG + Intronic
1203745790 Un_GL000218v1:40151-40173 TCTGGGGAGGCGTGGATGAGGGG + Intergenic
1203564323 Un_KI270744v1:79331-79353 CCTGGGGAGGCGTGGATGAGGGG - Intergenic
1185665449 X:1761805-1761827 CTTTGGGAGGCTGAGATGGCTGG - Intergenic
1185840660 X:3387040-3387062 CTTTGGGAGGCCTGGATGGGTGG - Intergenic
1185873512 X:3683591-3683613 CTTTGGGAGGCCTAGATGGTGGG + Intronic
1186214297 X:7282442-7282464 CCTTGGGAGGCCAAGATGGGAGG - Intronic
1186262295 X:7792220-7792242 CCTTGGGAGGCTGAGATGGGAGG - Intergenic
1186361513 X:8846780-8846802 CTTTGGGAGGCGAAGATGGGCGG + Intergenic
1187425127 X:19170699-19170721 CCTTGGGAGGCCAAGATGGGAGG + Intergenic
1187544341 X:20232889-20232911 CTTTGGGAGGCGAAGATGGGTGG + Intronic
1187681189 X:21769448-21769470 CCTTGGCAGGGGTGGCTGGAAGG + Intergenic
1187900803 X:24025443-24025465 CCCAGGGAGGCGGGGCTGGCCGG + Intronic
1190055950 X:47181203-47181225 CCTTGGGAGGCCTGAAGGGCAGG - Exonic
1190084976 X:47387498-47387520 CTTTGGGAGGCTGGGATGGGCGG - Intronic
1190218438 X:48495474-48495496 CCTGGGGTGGGGTGGACGGCTGG - Intergenic
1190317375 X:49159657-49159679 CCTTGGGAGGCAGAGATGGGCGG + Intergenic
1191635845 X:63375612-63375634 CTTTGGGAGGCGTAGGTGGGTGG - Intergenic
1192070902 X:67940436-67940458 CCTTGGGAGGCTGAGATGGGAGG - Intergenic
1192395661 X:70778561-70778583 CCTTGGGAGGCTGAGATGGGAGG - Intronic
1192779406 X:74278729-74278751 CCTTGGGAGGCCGAGATGGGAGG - Intergenic
1193481318 X:82032561-82032583 CTTTGGGAGGCCGGGATGGGTGG - Intergenic
1198076176 X:133195205-133195227 CCTTGGGAGGCTGAGATGGGAGG - Intergenic
1198184226 X:134237674-134237696 CCTCGGGAGGCAACGATGGCAGG + Intronic
1198829716 X:140736676-140736698 CTTTGGGAGGCCTAGATGGGCGG - Intergenic
1198881135 X:141282456-141282478 CTTTGGGAGGCTGGGATGGGTGG - Intergenic
1201159117 Y:11155163-11155185 CCTGGGGAGGCGTGGATGAGGGG + Intergenic
1201885513 Y:18877531-18877553 ACTTGGGAGGCTGGGATGGGAGG - Intergenic