ID: 929897084

View in Genome Browser
Species Human (GRCh38)
Location 2:45970103-45970125
Sequence ACACAGAGACTGCACAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 0, 2: 5, 3: 36, 4: 361}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929897084_929897087 12 Left 929897084 2:45970103-45970125 CCTTCCCTGTGCAGTCTCTGTGT 0: 1
1: 0
2: 5
3: 36
4: 361
Right 929897087 2:45970138-45970160 CTTTCTGAAAACATGTCAACTGG 0: 1
1: 0
2: 0
3: 16
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929897084 Original CRISPR ACACAGAGACTGCACAGGGA AGG (reversed) Intronic
900843703 1:5078998-5079020 AGACAGAGACTCCACAGGAGGGG - Intergenic
901719953 1:11189152-11189174 GCCCAGAGACTGTACAGGCAAGG + Intronic
902697541 1:18150458-18150480 GCACAGTGACTGCACACGGCAGG - Intronic
902756380 1:18552006-18552028 TCACAGAGATGCCACAGGGAGGG + Intergenic
903621359 1:24700674-24700696 ACCCAGGGGCTCCACAGGGAAGG + Intergenic
904627075 1:31812760-31812782 ACACAGAAAATACACAGAGAAGG + Intronic
904772150 1:32886481-32886503 AGACACCGACTGCGCAGGGAAGG - Exonic
905132625 1:35772348-35772370 ACACAGAGGATGCTCAGGCAGGG - Intergenic
905625883 1:39490720-39490742 GCACCTAGACTGCACTGGGAAGG - Intergenic
905880952 1:41463503-41463525 CTGCAGAGACGGCACAGGGAAGG - Intergenic
906022976 1:42647219-42647241 ACACAGAGACTGAAAAGGAGTGG + Intronic
906673504 1:47677039-47677061 AGACAGAGTCTGGGCAGGGAAGG - Intergenic
906742527 1:48196618-48196640 GCACAGAAAGTGCACATGGAGGG - Intergenic
909304702 1:74058960-74058982 ACACAGACAGTGCAAAGGGTTGG - Intronic
910992233 1:93068195-93068217 ACACAGAGGATGCTCAGGCAGGG - Intergenic
912179642 1:107204460-107204482 ACCCTGAGACTTCACAGAGAGGG + Intronic
912276218 1:108261713-108261735 ACCCAGGAACTGCACAGGGCAGG + Intergenic
912292010 1:108432645-108432667 ACCCAGGAACTGCACAGGGCAGG - Intronic
912364069 1:109118548-109118570 ATAAAGGGACTGCACTGGGATGG + Intronic
913934048 1:125016003-125016025 ACACTGACACTTCACAGGGCAGG + Intergenic
915244235 1:154544863-154544885 GCGCAGAGACTGCACAGGGATGG - Exonic
915715374 1:157940129-157940151 ATACAGAGAAGGCACAGGGAAGG + Intergenic
916053908 1:161054498-161054520 ACACAGGGAATGCCCAGGGCAGG + Intronic
916222376 1:162457748-162457770 ACACAAAGACTGCGGAAGGAAGG + Intergenic
916590959 1:166189662-166189684 ACACAGAGAGTCCACATAGAGGG + Intergenic
917146705 1:171900033-171900055 AAAGAGAGACTGCACAGTGGGGG + Intronic
918430617 1:184456225-184456247 AAACACAGACTCCAAAGGGATGG - Intronic
919570441 1:199242392-199242414 ACACAGGGACTGCAGAGAGCAGG - Intergenic
920974823 1:210775964-210775986 ACACAGTGCCTGCACATGGTGGG + Intronic
921797716 1:219366720-219366742 CCACAGAGAGAGCACAGGGGAGG + Intergenic
922561690 1:226574501-226574523 TCACAGTGATTACACAGGGAAGG - Intronic
923466553 1:234252568-234252590 AAACAGATACTGCATAGGAAAGG + Intronic
1062888336 10:1036551-1036573 ACACAGAGTCTGAAGAGGAAAGG - Intergenic
1063179687 10:3586433-3586455 AGACTGAGACTTCACAGGGCTGG + Intergenic
1064471004 10:15635878-15635900 ACACAGAACCTGCGCATGGAAGG - Intronic
1065792122 10:29270154-29270176 GCACGAAGACTGCTCAGGGACGG - Intergenic
1067290480 10:44935920-44935942 CCACAGAGGCTGCCCAGGGGTGG + Exonic
1068069481 10:52178858-52178880 ACACACAGACTGAAAAGGAAGGG - Intronic
1068564721 10:58561411-58561433 ACACACAGACTGAACATGAAGGG - Intronic
1068654895 10:59564423-59564445 ACTCAGAGACTGTCCAAGGAAGG + Intergenic
1069051534 10:63799846-63799868 ACACGTAGAATGCTCAGGGAGGG + Intergenic
1069346572 10:67477065-67477087 ACACAGTCTCTGCACAGGAAGGG - Intronic
1072280660 10:93862665-93862687 ACCCAGAGAGGCCACAGGGATGG + Intergenic
1072473607 10:95737139-95737161 ACACAGAGCCTGCACATAGTAGG - Intronic
1072566098 10:96617910-96617932 AGACACAGACTGCACAGAGAAGG + Intronic
1073689554 10:105792724-105792746 ACACAGAGACTAGAAATGGAAGG + Intergenic
1075211479 10:120494781-120494803 AAAGAAAGAATGCACAGGGAAGG - Intronic
1076252432 10:128995102-128995124 ACACAGATGCTGCACTGGGCTGG + Intergenic
1077208588 11:1356245-1356267 ACACAGATATTACAGAGGGAAGG + Intergenic
1077456963 11:2687110-2687132 ACACACAAACTGCACAGGGAGGG + Intronic
1077904850 11:6523278-6523300 GCAAGGGGACTGCACAGGGAAGG + Intronic
1080453540 11:32398395-32398417 AAACAGAGACTCTGCAGGGAAGG + Intronic
1080485624 11:32704209-32704231 ACACAGAGAATGCAGAGTGCAGG - Intronic
1080870308 11:36230919-36230941 ACATAGAGACTATACACGGAGGG - Exonic
1081568039 11:44271909-44271931 ACACACATACTGCACAGAAAAGG + Intronic
1082679390 11:56149960-56149982 TCCCAGAGACTGCACAGGGCAGG - Intergenic
1082970356 11:59013698-59013720 ACACAGAGATAACACAGAGAAGG + Intronic
1083203751 11:61135119-61135141 ACAGAGAAGCTGCACAGTGAGGG - Intronic
1083683588 11:64362426-64362448 GCACACAGACTGTACAGGGACGG - Intronic
1083755637 11:64790266-64790288 TCACACAGCCTGCACAGGGAAGG + Exonic
1084446891 11:69209016-69209038 ACGCAGAGCCTGCACACGGCGGG - Intergenic
1084589779 11:70084025-70084047 ACACAGTGTCTGCAAAGGCAAGG + Intronic
1084659544 11:70538780-70538802 ACACAGAGAAAGCACTGGGTGGG + Intronic
1085050993 11:73380175-73380197 GCACAGAGACGGCAGTGGGAGGG - Intronic
1086895843 11:92311806-92311828 ACAAAGACACTGGACAGTGAGGG - Intergenic
1087272390 11:96124712-96124734 AGAGAGAGACTGCACATGAACGG + Intronic
1087335972 11:96845392-96845414 AAGCAGAGACGACACAGGGAAGG + Intergenic
1087831143 11:102820883-102820905 ACACAGAGAAGGCAGAGGGATGG - Intergenic
1088597339 11:111450230-111450252 ACTCAGACACAGCTCAGGGAAGG + Intronic
1090606962 11:128431749-128431771 ACCCACAGACTTCACAGGAAAGG - Intergenic
1090676660 11:129004733-129004755 ACACAGAGACTGAAAAGAAAGGG - Intronic
1090886498 11:130881528-130881550 ACACACAGACTTCACAGCTACGG + Intronic
1091119015 11:133041444-133041466 GCAGAGAGACTGCAGAGGGTGGG - Intronic
1091353550 11:134916355-134916377 GCACAGAGCCTCCACAGGGTCGG + Intergenic
1093017686 12:14171157-14171179 ATCCAGTGACTGCCCAGGGAAGG + Intergenic
1093925797 12:24907214-24907236 GCACAGGGACTGAACAAGGAAGG - Intronic
1094485666 12:30924904-30924926 AAACAGACTCTGCACAGAGATGG + Intergenic
1095212893 12:39513826-39513848 ACACAGAGACTGAAAAGAGAAGG + Intergenic
1096511508 12:52132235-52132257 GCTCAGTGATTGCACAGGGAGGG + Intergenic
1097367829 12:58739677-58739699 ACACGTAGACGGCACAGGGAGGG - Intronic
1098741890 12:74183018-74183040 CCAGAGAGACTGCACAGAGATGG - Intergenic
1099770507 12:87047409-87047431 ACACTGAGACTCCAAAAGGAGGG + Intergenic
1100804651 12:98269168-98269190 ACACAGAGACTGAAAATGAAAGG + Intergenic
1101194023 12:102364252-102364274 ACACAAAGACAAAACAGGGATGG + Intergenic
1101837329 12:108304636-108304658 ACAGGGAGACTGCAGAGAGATGG - Intronic
1102099247 12:110265172-110265194 AAAGACAGACTGCAGAGGGAAGG + Intergenic
1102612764 12:114127280-114127302 ACTTAGAGAAAGCACAGGGATGG + Intergenic
1103050942 12:117779011-117779033 CCACTGAATCTGCACAGGGAGGG - Intronic
1103454475 12:121054027-121054049 ACAGAGCGTCTCCACAGGGAAGG - Intergenic
1103570782 12:121843454-121843476 TTACAGAGACTGGTCAGGGAGGG - Intronic
1103896897 12:124278973-124278995 ACAGAGAGGTTTCACAGGGATGG - Intronic
1104083781 12:125456699-125456721 ACAGAGAGACTGCAGTGGGGAGG - Intronic
1104642643 12:130477319-130477341 ACACAGAGACTGTCCAGGAAGGG - Intronic
1105403293 13:20114020-20114042 TCACAGAGATGGCAAAGGGAGGG + Intergenic
1105778492 13:23685105-23685127 GCACAGGGACTGCATAGGCAAGG - Intergenic
1105854260 13:24361085-24361107 ACACAGAGACTGGAGCTGGAGGG - Intergenic
1106396665 13:29387194-29387216 GCACAGTGGCTGCACATGGAAGG + Intronic
1106433952 13:29707804-29707826 ACACAGTGCCTGGACAGAGAGGG - Intergenic
1106549253 13:30757371-30757393 AGAAAGAGATGGCACAGGGAAGG - Intronic
1106577093 13:30984997-30985019 AAACACAGACTCCAAAGGGATGG + Intergenic
1106627986 13:31440853-31440875 ACACAGAGAGTACAAAGGGAGGG - Intergenic
1106758495 13:32845384-32845406 GCACAGAGCCTGCACACAGAAGG - Intergenic
1107337928 13:39375387-39375409 GCATAGAGAGTGAACAGGGATGG + Intronic
1110160709 13:72374702-72374724 ACATAGAGACTGCACAGAGAGGG - Intergenic
1110222271 13:73086246-73086268 ACACAGAAACTGGGCAGGCATGG - Intergenic
1110323505 13:74187006-74187028 ACACAGGGTCTGCACATAGAAGG + Intergenic
1110401955 13:75102229-75102251 ACTCAGGGACTACTCAGGGATGG + Intergenic
1110638258 13:77791188-77791210 CCACAGTCTCTGCACAGGGAAGG - Intergenic
1112707564 13:102087807-102087829 ACACAGAGAAGGCACAGAGTTGG - Intronic
1113349563 13:109515026-109515048 AAACAGAGATTCAACAGGGAGGG - Intergenic
1113432361 13:110261919-110261941 ACACAGTGGCTGCACAGGGCAGG + Intronic
1114229863 14:20771255-20771277 ACACACAGACTCCACAGAAATGG + Intergenic
1115474175 14:33798483-33798505 ACACAGCGTCTGAACATGGAGGG - Intronic
1116441941 14:44963423-44963445 AAAGAGTCACTGCACAGGGAAGG - Exonic
1118476495 14:66121983-66122005 ACTGAGAGACTCCACAGGGCTGG - Intergenic
1118615572 14:67572444-67572466 ACACACAGACCCCACAAGGAAGG + Intronic
1118991931 14:70804937-70804959 CCACAGGGACTGAGCAGGGAAGG - Intronic
1119649429 14:76373340-76373362 AAACAGAGGCTGTACAGGGGTGG - Intronic
1121035940 14:90703726-90703748 ACATAGAAACTCAACAGGGAAGG + Intronic
1121078350 14:91087951-91087973 ACAATGAGACAGCCCAGGGATGG + Intronic
1121584796 14:95055868-95055890 TCACAGTGACCACACAGGGAGGG + Intergenic
1122362479 14:101175573-101175595 ACTGAGGGACTGCACAGGCACGG - Intergenic
1123221989 14:106865843-106865865 ACACAGACACAGCGCAGGTAAGG + Intergenic
1123720107 15:23053013-23053035 ACACACAGACTGAAAAGGAAGGG - Intergenic
1123795246 15:23764341-23764363 ACACACAGTCTGCACATGAATGG - Intergenic
1124129966 15:26974568-26974590 AGACAGAGACAGCAGAGGGAGGG + Intronic
1124377490 15:29137497-29137519 ACTCAAAGACTGCAGACGGAAGG + Intronic
1124692197 15:31833240-31833262 AGGCAGAGAATGCCCAGGGATGG + Intronic
1124930111 15:34111592-34111614 ACACAGAGACTATACAAGGAGGG - Intergenic
1126103424 15:45133384-45133406 ACACCGACCCTGCCCAGGGATGG + Intronic
1126572080 15:50163554-50163576 CCACAGAGACTGAACTGGGTTGG + Intronic
1126858577 15:52862176-52862198 CCACACAGACTTCAGAGGGAGGG - Intergenic
1127466156 15:59246776-59246798 ATACAGAAACTGCCCAGGTATGG + Intronic
1127662145 15:61110106-61110128 ACACACAGACTGGCCAGGCATGG + Intronic
1127821948 15:62666092-62666114 ACTCAGAGACAGCTCAGGGCTGG - Intronic
1129002623 15:72346923-72346945 ACAGGGAGGCTGCAGAGGGACGG - Intronic
1129168188 15:73791213-73791235 ACACAGAGCCTGGACAGCAAAGG - Intergenic
1129804774 15:78446653-78446675 ACAGAGAGACTGAACTGGAAAGG - Intronic
1130068457 15:80626643-80626665 ACCCAGGGCCTGCACAGGGCAGG - Intergenic
1131543979 15:93300164-93300186 ACACATACACTGCACAGAAAAGG - Intergenic
1132746743 16:1439388-1439410 CCACCGAGGCTGCCCAGGGAAGG + Intronic
1135192615 16:20367311-20367333 AGACAGAGGCTGCACAGCAAGGG - Intronic
1135503603 16:23017676-23017698 ACACAGTGAGGGCACTGGGAAGG + Intergenic
1135686550 16:24502496-24502518 ACACAGAAAACGCACATGGATGG + Intergenic
1137038902 16:35591774-35591796 ACAAAGTCACTGCACAGGGAAGG + Intergenic
1137081866 16:36071905-36071927 ACATAAAGACTACACAGAGAGGG + Intergenic
1138386836 16:56641301-56641323 GCACAGAGACAGCAGTGGGAAGG - Intronic
1138502299 16:57454768-57454790 ATACAGAAACTGCACAGGCAAGG + Intronic
1139138246 16:64231401-64231423 ACACATAGTCAGCACAGGGCTGG + Intergenic
1139392102 16:66611615-66611637 AGACAGAGGCTGGCCAGGGAGGG + Intronic
1142062092 16:88036820-88036842 CCACAGACACAGAACAGGGAAGG - Intronic
1142969408 17:3601174-3601196 CCACAGAAACAGCCCAGGGAGGG - Intergenic
1143824187 17:9590846-9590868 CCACAGAGACTATCCAGGGATGG - Intronic
1144023831 17:11260458-11260480 ACACAGAGACGGCCAAGTGAGGG - Intronic
1144051435 17:11500354-11500376 TTACAGAGACTGCAATGGGAAGG - Intronic
1145328450 17:21850819-21850841 ACACACTGACAGCACAGGGTGGG - Intergenic
1145768735 17:27477517-27477539 ACAAAGAAACTGCAAAGGTATGG - Intronic
1146262912 17:31433407-31433429 ACACAGAAGGTGCCCAGGGAAGG + Intronic
1146447562 17:32944470-32944492 ACACAGAGAAGGGACAGGGCAGG + Intronic
1147322135 17:39652962-39652984 ACACAGACACTGCTCTAGGAAGG + Intronic
1148856323 17:50580985-50581007 ACACAGAGTGGGCACAGAGAGGG + Intronic
1150666016 17:67139268-67139290 ATACACAGACTACCCAGGGAAGG + Intronic
1151269370 17:72981877-72981899 ACACAGACACTTCACAGAAAGGG + Intronic
1151761370 17:76104970-76104992 GCACAGAGCCTGGAGAGGGATGG + Intronic
1151799397 17:76368835-76368857 TCACAGAATCAGCACAGGGATGG + Intronic
1152012654 17:77727855-77727877 CCACAGGGTCAGCACAGGGATGG + Intergenic
1152566673 17:81103406-81103428 CCCCAGAGAGTGCTCAGGGAGGG + Intronic
1153406864 18:4750526-4750548 GCACGGTGACTGCACAGGAAAGG - Intergenic
1153498021 18:5720267-5720289 ACACAGAGGCGGCACAGGGGAGG + Intergenic
1153784757 18:8524767-8524789 ACAGAGAGCCAGCACAGGCAGGG - Intergenic
1153873810 18:9346789-9346811 ACACAAAACCTGCACATGGATGG - Intronic
1156482890 18:37447374-37447396 CTACAGACACTGCACAGGGAAGG + Intronic
1156976931 18:43233898-43233920 ACACAGAGATGGCAGAAGGAAGG - Intergenic
1158251104 18:55488575-55488597 TCCCAGAGACTACACAGGGCAGG + Intronic
1159113826 18:64090674-64090696 AAAGAGAGACTGCAGAGGAAAGG - Intergenic
1160246196 18:77162148-77162170 AGACACAGACTCCACAGGGTGGG + Intergenic
1160310755 18:77787583-77787605 GCAAAGGGACTGCAGAGGGAGGG + Intergenic
1160476755 18:79197413-79197435 ACAAAAAGAGTGCAGAGGGAAGG + Intronic
1160511818 18:79457199-79457221 TCCCAGAGACCACACAGGGAAGG + Intronic
1160780527 19:875989-876011 ACACAGCGACGGCCCAAGGAGGG + Intronic
1160900794 19:1427300-1427322 ACCCAGGGGCTGCCCAGGGACGG - Intronic
1160984281 19:1830818-1830840 ACAGACAGACCGCACAGGGCAGG + Intronic
1161067850 19:2247371-2247393 AAACGGTGACTGCCCAGGGAGGG + Intronic
1161267050 19:3369160-3369182 ACACAAAGAAGGCAAAGGGAGGG - Intronic
1161693944 19:5754778-5754800 GCACAGAGACAGCACAAGGGCGG - Intronic
1162149285 19:8633481-8633503 AAGCTGAGGCTGCACAGGGAAGG + Intergenic
1163220145 19:15913207-15913229 ACAGAGAGAACGCACTGGGAGGG + Exonic
1163442011 19:17327121-17327143 ATGCAGAGACTGCACAGAGCTGG - Intronic
1164479975 19:28603698-28603720 AGACAGAGAGGGCATAGGGATGG - Intergenic
1166718216 19:44982635-44982657 TGACAGAGACTGTCCAGGGAAGG - Intronic
1167051559 19:47082079-47082101 ACAGAGAGAAAGCACAGAGAAGG + Intronic
1167499239 19:49836147-49836169 ACACAGACACTGCTCAGAGATGG - Intronic
1168327555 19:55545995-55546017 CCACAGAGACGGGACAGGGAGGG - Intergenic
926199198 2:10781097-10781119 CCACAGAGACAGGACAGGGCCGG + Intronic
926524735 2:13964953-13964975 ACACAGAGACTGAAAATGCAGGG - Intergenic
926552469 2:14316782-14316804 AGACAGAGACTCCACAGGCCTGG - Intergenic
926703024 2:15816776-15816798 GCACAGAGAGTGCTCAGTGAAGG - Intergenic
927206394 2:20613779-20613801 ACACACAGAGTACACAGGGATGG + Intronic
927570916 2:24159024-24159046 AGACAGAGACTGCAGAGATAAGG - Intronic
928170906 2:29002522-29002544 CCAGAGAGGCTGTACAGGGATGG - Exonic
928446480 2:31337822-31337844 ACACAGACAGGGCACAGGGCAGG + Intronic
928823621 2:35392164-35392186 AAACAGAGACTGCAGGGGCAGGG + Intergenic
928917943 2:36493510-36493532 ACACACAGACCCAACAGGGATGG + Intronic
929559154 2:42945084-42945106 ACAGCAAGGCTGCACAGGGAGGG + Intergenic
929800736 2:45099175-45099197 ACACAGTTACTGAAGAGGGATGG - Intergenic
929897084 2:45970103-45970125 ACACAGAGACTGCACAGGGAAGG - Intronic
932483240 2:72062575-72062597 CTACAGAGAATGCACAGTGAGGG + Intergenic
934887467 2:98037632-98037654 AAAGAGAGACTGCAAAGGAAAGG - Intergenic
935703392 2:105834516-105834538 ACACAGAGACTGGAAGGGAAAGG - Intronic
935915116 2:107941242-107941264 CCATAAAGACTGCTCAGGGAGGG - Intergenic
935981085 2:108628353-108628375 TGACAGTGACTGCACATGGATGG - Intronic
936690117 2:114876922-114876944 AGAGAGAGACTGCAGAGGAAAGG - Intronic
938009244 2:127815428-127815450 ATATAAAGAATGCACAGGGATGG - Intergenic
938263388 2:129910531-129910553 ACACAGGCACTGCTCAGGAAGGG + Intergenic
938762898 2:134441646-134441668 ACACTGGGAGAGCACAGGGACGG - Intronic
939247545 2:139645230-139645252 ACACAAACTCTGCACAGGAAGGG + Intergenic
939691838 2:145272971-145272993 ACAAACAGACAGCACAAGGAGGG + Intergenic
939966872 2:148618913-148618935 ACTCTGAGACTGCAGAGGCAGGG - Intergenic
944029374 2:195215451-195215473 GCACAGACACTGCTCAGGGCAGG - Intergenic
945203230 2:207305825-207305847 ACACAGTGAATGCTCAGTGAGGG - Intergenic
946103134 2:217344278-217344300 AGACAGAGACTGAAATGGGAAGG + Intronic
947041666 2:225928902-225928924 ACACAGAGGCTGCAAAGATAGGG + Intergenic
947352687 2:229262858-229262880 ACACAGAAGCGGCACAGAGAAGG - Exonic
947607052 2:231493219-231493241 ACACCCAGCCTGTACAGGGAAGG + Intergenic
948082417 2:235217197-235217219 ACACAGAAAATGCAGGGGGAGGG - Intergenic
948880207 2:240852927-240852949 ACACACAGTCAGCACAGGGCAGG + Intergenic
1168868535 20:1109311-1109333 ACACACAGACTGCCCCAGGATGG + Intergenic
1169217768 20:3803331-3803353 GGACAGCGACTGCACGGGGAGGG + Intronic
1170271360 20:14530364-14530386 TCACAGAGCCTGCAAAGGGATGG + Intronic
1170297542 20:14844810-14844832 ACTCAGAAAATCCACAGGGAAGG - Intronic
1172461013 20:35118747-35118769 ACTCAGTGGCTGCACAGAGATGG + Intronic
1172765730 20:37349796-37349818 ACACAGAGAAGGCAAAGAGAGGG - Intronic
1173392224 20:42645470-42645492 ACACAGTGAAGGCTCAGGGAAGG - Intronic
1173459760 20:43233774-43233796 ACACAGTGACTGCATTGGGCAGG - Intergenic
1174329940 20:49810119-49810141 TTACAGAGACTGGTCAGGGAGGG + Intergenic
1174786294 20:53436396-53436418 GCTCAGAGGCTGCCCAGGGAAGG + Intronic
1174961575 20:55163163-55163185 ACACAGAGACTTCAACGGGAAGG - Intergenic
1175252734 20:57619223-57619245 ACACAGAGTGTGCCCCGGGAGGG - Intronic
1175402911 20:58710812-58710834 AGACAGAGACAGCACAGGCACGG - Intronic
1175570650 20:60018467-60018489 ACACATAGACTGAACATGAAGGG - Intronic
1175915413 20:62423655-62423677 CCACAGTGACTTCACTGGGAAGG - Intronic
1178354723 21:31901023-31901045 ACACAGAGAATGCCATGGGAAGG - Intronic
1178491781 21:33057118-33057140 GCCCTGAGACTGCACAGGGGTGG - Intergenic
1178752712 21:35319681-35319703 CCACGGAGACTGCATTGGGATGG + Intronic
1179770946 21:43616341-43616363 ACACAGAAATAGCACAGTGAAGG + Intronic
1179982366 21:44903018-44903040 ACATATAGACGGCACAGCGACGG - Intronic
1180139062 21:45880351-45880373 CCACAGAGGCGGCACAGGGCTGG - Intronic
1180207932 21:46273865-46273887 GCAGAGAGACGGGACAGGGAAGG + Intronic
1180592953 22:16956269-16956291 ACACAGCGCCTTCACAGAGAGGG - Intergenic
1180597718 22:16989698-16989720 ACACAGCTGCTGCCCAGGGAGGG + Intronic
1181036834 22:20173822-20173844 GCTCAGAGACTCCACAGTGAGGG - Intergenic
1183629049 22:39022208-39022230 ATGCAGAGGCTGCACAGGGCTGG + Intronic
1183632536 22:39041998-39042020 ACACAGAGACTGGACAGGGCTGG + Intronic
1183638361 22:39078400-39078422 ATACAGAGACTGGACAGGGCTGG + Intronic
1183981502 22:41543229-41543251 ACACAGGCACAGCACAGAGAAGG + Intronic
1184404400 22:44291952-44291974 ATAGAGAGACTGCAGAGAGAGGG - Intronic
1184731415 22:46373049-46373071 GCACAGAAACTGCGCAGGGAGGG + Exonic
1184981769 22:48100437-48100459 ACCCAGTGGCTGGACAGGGAGGG - Intergenic
1185050363 22:48551104-48551126 TCACTGAGACACCACAGGGAGGG - Intronic
1185284059 22:49992363-49992385 GAACAGAGACTGCAGAGGCAGGG - Intergenic
949120535 3:378710-378732 ACACAGCCAGTCCACAGGGATGG - Intronic
950636330 3:14317774-14317796 CAGCAGAGAGTGCACAGGGATGG - Intergenic
952081283 3:29760420-29760442 AGAGAGAGATTGAACAGGGAGGG + Intronic
952934582 3:38386211-38386233 ACACAGAGACAACACAGGTAAGG - Intronic
953107453 3:39898109-39898131 ACCCACAGACTGCAAAGGCAAGG - Intronic
953570181 3:44065270-44065292 ACTCAGAGCCTGCAGAGAGAAGG + Intergenic
953924855 3:46977624-46977646 AGACAAAGCCTGCACAGTGAGGG + Intronic
954686050 3:52370841-52370863 CCCCAGAGACTGCACAGGGAGGG + Intronic
957315713 3:78573521-78573543 ATACAAAGACTGTACAGGAAAGG - Intergenic
958501216 3:94911433-94911455 AAACATGGACTGAACAGGGAAGG + Intergenic
958928212 3:100181368-100181390 ACACAGGGAAAGCTCAGGGAAGG - Intergenic
959416856 3:106086502-106086524 TCACAGAGGATGCACAGTGAGGG - Intergenic
959667436 3:108937286-108937308 ACCCAGGGATTGCACAGGGTGGG - Intronic
961752598 3:129105954-129105976 GCACAGTGCCTGCACAGAGAAGG + Intronic
961865474 3:129950600-129950622 ACACTGAGGCAGCACAGGGCAGG - Intergenic
962508353 3:136071964-136071986 AAACAGAGAGTGATCAGGGAGGG - Intronic
964274038 3:154989195-154989217 ACACAGAGACTGAAAATGAAGGG + Intergenic
966159420 3:176952212-176952234 CTACAGAGTCTGCACAGGGGAGG + Intergenic
966250807 3:177863396-177863418 CCCCAGAGCCTACACAGGGAAGG - Intergenic
966460156 3:180167550-180167572 ACACACAGACAACACAGGGTGGG + Intergenic
966749288 3:183306594-183306616 CCACAGAGGATCCACAGGGATGG + Intronic
967203079 3:187092367-187092389 ACACATAGACTGTACATGAAGGG - Intergenic
969094998 4:4726011-4726033 TCACAGAGTGTTCACAGGGAAGG + Intergenic
969686835 4:8680282-8680304 AGAGAGAGACAGCAGAGGGAGGG + Intergenic
969705152 4:8787671-8787693 GCCCAGAGACTGCAATGGGACGG + Intergenic
972023494 4:34345448-34345470 ACAGAGTGAGTGCACAGTGAAGG - Intergenic
975072307 4:70157298-70157320 GCACAGAGATGGCACAGAGAAGG + Intronic
978073080 4:104494870-104494892 ACACAGCGACTGGAGACGGACGG - Exonic
979279263 4:118846928-118846950 ACACAGACACAACTCAGGGAGGG + Intergenic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
979601883 4:122594336-122594358 GCACAGAGCCTTCAGAGGGAGGG - Intergenic
981325641 4:143444231-143444253 AGACAGAGACTAGACAGAGATGG - Intronic
981767302 4:148266008-148266030 ACACTGAGATTGGACGGGGAGGG + Intronic
982628867 4:157805744-157805766 ACACAGAGGCAGCAGAGAGAAGG - Intergenic
982808991 4:159802921-159802943 AAAGAGAGACTGCAGAGGCATGG - Intergenic
983332836 4:166353435-166353457 ACATTGAGACTGCTCAGGGAAGG - Intergenic
986553750 5:8988675-8988697 ACACAGAGACTGAAAATGAAGGG - Intergenic
988456079 5:31388412-31388434 ACACTGAGAAGCCACAGGGAAGG - Intergenic
989630296 5:43475334-43475356 ACAGAGAGGGTACACAGGGAGGG + Intronic
990613910 5:57487668-57487690 ATACAAAGACTTCACAGGGACGG - Intergenic
990687338 5:58320534-58320556 ACAGAGAGACTGCAAATTGATGG + Intergenic
992161308 5:74006351-74006373 AAACAAACACTGCACAGGGCTGG - Intergenic
992758227 5:79929319-79929341 ACACCGTGACTGCAAAGTGATGG - Intergenic
993515412 5:88827335-88827357 GCACACAGACTGGTCAGGGAAGG + Intronic
996105768 5:119500732-119500754 AAAAAGAGACTGCACAGGAATGG + Intronic
996282284 5:121745074-121745096 CCACAAAGAAGGCACAGGGAAGG - Intergenic
997361699 5:133299405-133299427 AAGCAGAGACAGCACAGGGTGGG - Intronic
997791699 5:136767822-136767844 ACAAAGAAAGTGCACAGGGTGGG + Intergenic
999357209 5:150946600-150946622 CCACAGTGACTGCGAAGGGAGGG + Intergenic
999945574 5:156591670-156591692 ACACATAGACTACACAGAGGGGG + Intronic
1000244930 5:159441504-159441526 TCTTAGAAACTGCACAGGGAAGG + Intergenic
1000363712 5:160471933-160471955 ACACAGCTGCTACACAGGGAAGG + Intergenic
1000542346 5:162555660-162555682 ACAGAGTGACTGCAGAGGCATGG - Intergenic
1002576219 5:180175577-180175599 ACACAGGGACTGCTCAGGCTCGG - Intronic
1002586187 5:180250130-180250152 ACACAGAGTCAGCACTGGGGAGG - Intronic
1003025519 6:2551767-2551789 ACAACGAGACTCCACAAGGAAGG - Intergenic
1004142429 6:13031286-13031308 AGACAAACACTGCATAGGGATGG - Intronic
1004432119 6:15554830-15554852 CTACAGAGACTGCACAGCAAGGG - Intronic
1004551703 6:16654247-16654269 AAAGAGAGACTGCTCAGGGCCGG + Intronic
1005072063 6:21871055-21871077 GCACTGAGACTGAGCAGGGAGGG + Intergenic
1005392021 6:25343683-25343705 GCACACAAACTGCACAGTGAAGG - Intronic
1008139996 6:47821302-47821324 TGATAGAGACTGCACAGGGAGGG + Intronic
1008350517 6:50484291-50484313 AGACAGAGAAGGAACAGGGAGGG + Intergenic
1010772729 6:79850273-79850295 ACACAGAGACTGAAAATGAAGGG + Intergenic
1011626244 6:89285911-89285933 TCACAGAGACCCCAGAGGGAGGG - Intronic
1012443738 6:99287771-99287793 CCACAGAGACAGCAAAGGCAGGG + Intronic
1012710539 6:102597762-102597784 AGACACAGACTGCCCTGGGATGG + Intergenic
1013638506 6:112051143-112051165 TCAGTGAGACTGCAGAGGGATGG + Intergenic
1015483454 6:133741665-133741687 ACACGGAGAGAGCAAAGGGAAGG + Intergenic
1015487092 6:133784758-133784780 ACACAGAGAAAGCAGAAGGAAGG - Intergenic
1018658275 6:166061530-166061552 AGACAGAGATGTCACAGGGATGG - Intergenic
1018806994 6:167269535-167269557 GGAAAGAGACTGCAGAGGGAAGG + Intergenic
1018961686 6:168454043-168454065 ACACAGAGATAGTACAGAGATGG - Intronic
1019071077 6:169345568-169345590 ACACAGAGCATGCAGAGGGAAGG - Intergenic
1019384407 7:746514-746536 ACACAGACGCTGGACAGGGCAGG - Intronic
1019999939 7:4749913-4749935 GCAGGGAGACTGCAGAGGGACGG - Intronic
1020077859 7:5270420-5270442 ACACAGAGGTTGGTCAGGGAAGG - Intergenic
1020141639 7:5615041-5615063 ACAGGGAGAATCCACAGGGATGG - Intergenic
1020365474 7:7376152-7376174 ATAAACACACTGCACAGGGAAGG - Intronic
1020435815 7:8161328-8161350 ACAGAGAGACAGCACAGACAAGG + Intronic
1020468041 7:8503361-8503383 ACAAAGAGGCCGCACAGGGGAGG - Intronic
1023028977 7:36076715-36076737 ACAGAGACACAGCACAGTGAAGG - Intergenic
1023089965 7:36608375-36608397 CCACAGAGCCTGCAAAGGAAGGG - Intronic
1023840812 7:44096540-44096562 AGGCACAGACTGCACAAGGAGGG - Intergenic
1023882615 7:44328959-44328981 ACACAGTAACTGCACAAAGAAGG - Intronic
1023982239 7:45076936-45076958 CCACAATGACGGCACAGGGAGGG - Intergenic
1024172871 7:46808593-46808615 CTACAGAGAATGCACAGTGAGGG + Intergenic
1024196750 7:47066655-47066677 ACACATGGACTTCACAGGTACGG + Intergenic
1024267261 7:47616267-47616289 ACACAGGTACCACACAGGGAGGG - Intergenic
1024577880 7:50779767-50779789 TCCCAGACACTGCACAGGAAAGG + Intronic
1025201028 7:56961750-56961772 ACACAGAGGTTGGTCAGGGAAGG + Intergenic
1025670915 7:63615182-63615204 ACACAGAGGTTGGTCAGGGAAGG - Intergenic
1026517823 7:71087912-71087934 ACACAAAGAATGCCCAAGGAAGG - Intergenic
1026868629 7:73837515-73837537 ACAGAAAGACTGCCCTGGGAAGG - Intronic
1027379927 7:77596826-77596848 ACAAAGAGACTGCTCTGGTAGGG - Intronic
1028447587 7:90942644-90942666 ACATAGAGACTGCACAATGAAGG - Intronic
1029284435 7:99456107-99456129 ACACATGGCCTGCCCAGGGAGGG - Intronic
1029633312 7:101767145-101767167 ACACAGAGTCTGCCCAGGCCGGG + Intergenic
1029707190 7:102282252-102282274 TCACGAAGACTGCACAGAGAAGG + Intronic
1032692665 7:134304594-134304616 ACACAGAGACACCACAGGTGTGG + Intronic
1034833437 7:154329983-154330005 ACACATGGACGACACAGGGAGGG + Intronic
1035025288 7:155820936-155820958 GCACAGAGATTGCTGAGGGATGG - Intergenic
1035346804 7:158205724-158205746 ACACAGCCACTGCAGGGGGATGG - Intronic
1035726328 8:1826303-1826325 ACACACAAACTGCAGAGGAAAGG - Intronic
1037598720 8:20375429-20375451 ACACAGAACCTGCCCTGGGAAGG + Intergenic
1038187905 8:25292345-25292367 ACACAGAGCCTGGCCATGGAGGG - Intronic
1038347356 8:26744631-26744653 ACAGAAGGAATGCACAGGGAAGG + Intergenic
1038488923 8:27955598-27955620 AAACAGAGACAGACCAGGGAGGG + Intronic
1039000101 8:32970555-32970577 ACACAAAGCCTACCCAGGGAGGG + Intergenic
1039121763 8:34156047-34156069 ACACAGAGACTAAAAAGGAAAGG - Intergenic
1040595873 8:48837149-48837171 ACACAGAGACCGCAAGAGGAGGG - Intergenic
1041729506 8:61050630-61050652 ACACAGAGGGTCCTCAGGGAGGG + Intergenic
1041813431 8:61938334-61938356 CTACAGAGAATGCACAGTGAGGG + Intergenic
1042698161 8:71581437-71581459 ACACAGGGCCTGCTCAAGGAAGG + Intronic
1043395026 8:79827630-79827652 ACACACAGCCTGCAGAGGGGAGG - Intergenic
1044430611 8:92102849-92102871 ACACTTACACTGCACAGGGCCGG + Intronic
1045439913 8:102198987-102199009 ACACAGAGACTAGCCAGGAAAGG + Intergenic
1045481753 8:102598250-102598272 ACACAGTGACTGTATGGGGAAGG - Intergenic
1045483328 8:102610512-102610534 TCACAGAGATGGCACAGGAATGG - Intergenic
1045967703 8:108044382-108044404 ACTCTGAGAGTGCACAGAGAGGG - Intronic
1045986570 8:108256201-108256223 TCACAGAGAAAGCACAGGCAAGG + Intronic
1046890173 8:119414181-119414203 ACATAGTGACAGCACAGGAATGG - Intergenic
1047927195 8:129693358-129693380 ACACAGACACAGCAGAAGGAAGG + Intergenic
1048318210 8:133377423-133377445 ACACAGAGACTGCAGACAGGAGG + Intergenic
1049299102 8:141860472-141860494 AGGCAGAGCCTGCACAGAGAGGG - Intergenic
1049813448 8:144586698-144586720 GCTCAGAGCCTGCCCAGGGAAGG + Intronic
1050152289 9:2628749-2628771 AAAGATAGACTACACAGGGAGGG + Intronic
1050176747 9:2876498-2876520 ACACGGAGAAAGCACAGAGAAGG - Intergenic
1050483440 9:6109348-6109370 ACACACAGCATGCACAGGGAGGG + Intergenic
1056938243 9:90934275-90934297 ACGCAGCGACTGCACAGTGAAGG - Intergenic
1056981471 9:91315842-91315864 ACACACAGACTTTACAAGGATGG - Intronic
1058827992 9:108792337-108792359 AGAGAGAGGGTGCACAGGGATGG - Intergenic
1061163749 9:128910844-128910866 ACACGGAGGCTGCAGAGGGGAGG - Intronic
1062384106 9:136302267-136302289 ACACAGAGAATCCACAGGACTGG + Intronic
1187843671 X:23514541-23514563 TCACAGAGACTGCATCAGGAGGG - Intergenic
1188122224 X:26321734-26321756 ACACATAGACTGAAAAGTGAAGG + Intergenic
1190331654 X:49239585-49239607 AGACAGAGACTGCATAAGCAAGG - Intronic
1190409719 X:50124529-50124551 ACAAAGATACTGTACAGGGGAGG + Intergenic
1194966917 X:100298682-100298704 ACACAGAGAGTTTGCAGGGAAGG - Intronic
1195957346 X:110345565-110345587 CAACAGACACTGCAGAGGGAGGG + Intronic
1198241291 X:134789222-134789244 ACAGAGAAACTGCACATGAAAGG - Exonic
1199810874 X:151347231-151347253 ACACAGTTTCTGCACAGTGAAGG + Intergenic
1200068593 X:153517083-153517105 ACACAGAGACTGCACACAGGTGG - Intergenic