ID: 929897514

View in Genome Browser
Species Human (GRCh38)
Location 2:45974853-45974875
Sequence TCCTAGAAGGTCCCCTGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 100}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929897514_929897516 -9 Left 929897514 2:45974853-45974875 CCTGTGCAGGGGACCTTCTAGGA 0: 1
1: 0
2: 0
3: 10
4: 100
Right 929897516 2:45974867-45974889 CTTCTAGGAGACCTTCTAGAAGG 0: 1
1: 0
2: 0
3: 9
4: 131
929897514_929897518 6 Left 929897514 2:45974853-45974875 CCTGTGCAGGGGACCTTCTAGGA 0: 1
1: 0
2: 0
3: 10
4: 100
Right 929897518 2:45974882-45974904 CTAGAAGGTGTCAGAAACCTAGG 0: 1
1: 1
2: 4
3: 11
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929897514 Original CRISPR TCCTAGAAGGTCCCCTGCAC AGG (reversed) Intronic
900156286 1:1204560-1204582 CCCCAGATGGACCCCTGCACTGG - Intronic
900996209 1:6124823-6124845 TCCTAGGAGGTCCCCTCGCCAGG - Intronic
902399838 1:16151789-16151811 GCCTAGAATGTCCCCTACAAGGG - Intronic
902760496 1:18577603-18577625 TGCCAGATGGTCACCTGCACAGG + Intergenic
913501253 1:119474681-119474703 TTCTAGAGAGTCCCCTGCAAGGG - Intergenic
913505830 1:119515524-119515546 TTCTAGAGAGTCCCCTGCATGGG - Intergenic
914093103 1:144521726-144521748 TCCCAGAGGCTGCCCTGCACAGG + Intergenic
914305423 1:146412158-146412180 TCCCAGAGGCTGCCCTGCACAGG - Intergenic
914596636 1:149160645-149160667 TCCCAGAGGCTGCCCTGCACAGG + Intergenic
917538908 1:175894877-175894899 TCCAAGAAGGTTCCAAGCACAGG + Intergenic
1063427621 10:5962213-5962235 TCCTAGTGAGTCACCTGCACAGG - Intronic
1065724031 10:28653158-28653180 TCCTAGAAGGGACCATGAACGGG - Intergenic
1067546276 10:47194711-47194733 TTCTACTGGGTCCCCTGCACAGG - Intergenic
1069780774 10:70954052-70954074 TCCAAGAAAGTCCCATGGACAGG - Intergenic
1070540831 10:77414013-77414035 TCTTAGAAGCACCCCTGCGCTGG + Intronic
1072134744 10:92534577-92534599 ACCTAGAAGGTGCCCTAGACAGG - Exonic
1073897435 10:108179399-108179421 TGGGGGAAGGTCCCCTGCACAGG - Intergenic
1074326123 10:112453119-112453141 TTCTAGAAGGTTCCCTCAACTGG + Intronic
1074394839 10:113089201-113089223 TCCTAGAAGGGACCCTGAGCTGG + Intronic
1076872653 10:133201323-133201345 TCCCAGCATCTCCCCTGCACTGG + Intronic
1076944630 10:133637750-133637772 TCCCGGAAGGCCCGCTGCACGGG + Intergenic
1076993581 11:288181-288203 TCCCACAGGGTCCCCAGCACAGG - Intergenic
1078949070 11:16108270-16108292 TCCTAGAAGGTCCTAGGAACAGG - Intronic
1082088691 11:48071160-48071182 CCATAGAATGTTCCCTGCACTGG - Intronic
1085729317 11:78982900-78982922 TCCTTGCTGGTCCCCTGCAAGGG + Intronic
1089138408 11:116267512-116267534 TCCTAGAAGGTCCCCCACAGTGG - Intergenic
1105353015 13:19633293-19633315 TCCTAGAAAGTCCCCAGCTCTGG + Intergenic
1113436592 13:110296977-110296999 TCCTAGAAGGTGGCATGCCCTGG - Intronic
1113552135 13:111200793-111200815 TGCCAGAAGGGGCCCTGCACTGG - Intronic
1114659192 14:24334086-24334108 TCCCAGAAGGCACCCTCCACCGG - Intronic
1121308643 14:92923181-92923203 TCCCGCAAGCTCCCCTGCACGGG - Exonic
1121412830 14:93759812-93759834 TCCTAGAAGCTCCTCTGCCAGGG - Intronic
1122061286 14:99138358-99138380 ACCTTGAAGGTCTCATGCACTGG + Intergenic
1202918011 14_KI270723v1_random:3082-3104 TCCCGGAAGGCCCGCTGCACGGG + Intergenic
1125460783 15:39904819-39904841 TCCAAGACAGTCACCTGCACAGG + Intronic
1126682319 15:51214384-51214406 ACCTGGAAGCTCCCCTGCAGAGG + Intronic
1129552839 15:76472214-76472236 CCCTAAAAAGTCCCCTGCAAAGG + Intronic
1138558169 16:57785088-57785110 TCTTCGACGGTGCCCTGCACTGG - Intronic
1141024104 16:80527901-80527923 TCCTAGAAGGAATCCTGGACTGG - Intergenic
1141205611 16:81931240-81931262 CCCTATAAGGTCCCATTCACAGG + Intronic
1141615184 16:85206270-85206292 TCCAAGAAGGTCTCCGGCCCGGG - Intergenic
1145249596 17:21289918-21289940 TCCCAGCTGGTCCCCTGCCCAGG + Intronic
1149072024 17:52555050-52555072 TCCTAGAAGTTCCTCTCCATAGG - Intergenic
1150918031 17:69456218-69456240 TCCTAGAAGGTCCACTAAACAGG - Intronic
1154267377 18:12890915-12890937 TCATAGAAGGTCACATTCACAGG - Intronic
1157298207 18:46461115-46461137 TCTTAGAAGGAGCCCTGGACTGG + Exonic
1161218332 19:3105878-3105900 TCCTGGCAGGTGCCCTGCAGTGG + Intronic
1161273871 19:3404761-3404783 TCCCAGAGCGTCCCCAGCACGGG + Intronic
1163420749 19:17212337-17212359 TCCGAGGACGGCCCCTGCACTGG + Exonic
1164472427 19:28547212-28547234 TCACAGAATGTCCCCTGCCCAGG - Intergenic
1166759457 19:45215660-45215682 TCCGAGAAGGTCACCTACAAAGG + Intronic
1167873146 19:52390202-52390224 TCCTTCAGTGTCCCCTGCACTGG + Intergenic
1168317754 19:55491452-55491474 TCCGAGACGGTCCCCTGCCATGG - Intronic
925299814 2:2803828-2803850 TCCCAGAAGTCCCCTTGCACTGG - Intergenic
925602837 2:5626625-5626647 TCCAAGAGGCTGCCCTGCACAGG - Intergenic
929897514 2:45974853-45974875 TCCTAGAAGGTCCCCTGCACAGG - Intronic
933949000 2:87312252-87312274 TCAGAGAAGTTCCCCTGCACTGG + Intergenic
933978403 2:87530018-87530040 TCCAAGAGGGGCCCCAGCACTGG - Intergenic
936315430 2:111420783-111420805 TCCAAGAGGGGCCCCAGCACTGG + Intergenic
936331197 2:111549344-111549366 TCAGAGAAGTTCCCCTGCACTGG - Intergenic
946281582 2:218669922-218669944 TCTTAAAAGTTCCCCTGAACAGG + Intronic
948838105 2:240635997-240636019 TCCTAGGAGGGCCCATGCCCAGG + Intergenic
1169155062 20:3322752-3322774 CCCAAGCAGGTACCCTGCACAGG - Intronic
1171781972 20:29427741-29427763 TCCTGGAAGGCCCGCTGCACGGG + Intergenic
1173452234 20:43175219-43175241 GCTAAGAAGGTCCCCTCCACGGG + Intronic
1178661006 21:34507606-34507628 CCCCAGAATGTCCCTTGCACAGG + Intergenic
1179245345 21:39628700-39628722 TCCCATTAGGTCCCCTGTACAGG - Intronic
1179821639 21:43940444-43940466 TCCCAGGAGTTCCCCTGCAAAGG - Intronic
1184042632 22:41953040-41953062 TCCTACACGCTCCCCTGCCCTGG + Intergenic
1184789006 22:46687751-46687773 TCCCTGGAGGTCCCCTGCCCAGG + Intronic
1184956088 22:47887268-47887290 TCCTAGGAGGTCAACTGCAGAGG + Intergenic
1185097739 22:48820940-48820962 TCCTGGAAGCTCCTCGGCACTGG + Intronic
957083525 3:75658656-75658678 TCCCGGAAGGCCCGCTGCACGGG - Intergenic
957686907 3:83514214-83514236 TCCTAGAAGGTTCCCTTTACAGG + Intergenic
961493550 3:127274323-127274345 TCTTGGAAGGCCCCCTGCCCTGG + Intergenic
962400004 3:135050181-135050203 TCCTAGAAGATCCCCTCAATCGG - Intronic
968565267 4:1309367-1309389 CCCTAAAAGCTCCCCTCCACTGG - Intronic
969060227 4:4428203-4428225 TCCTATAAGGCCCCCAGAACTGG - Intronic
970155488 4:13137477-13137499 TCCAAGAAGGTCCCCAGGAGAGG + Intergenic
971418218 4:26452893-26452915 GACTAGAAGGGCCCCCGCACTGG + Intergenic
976599729 4:86927150-86927172 GCCTAGAATGTACCCTGCCCAGG + Intronic
985448016 4:190038260-190038282 TCCCGGAAGGCCCGCTGCACGGG + Intergenic
989120335 5:37998374-37998396 TCATAGAAAGACCCCTGCAGAGG + Intergenic
990334582 5:54759602-54759624 TCCAGGAAGGTCACCTGCATGGG - Intergenic
991696786 5:69280410-69280432 TCCTGGGTGGTCCTCTGCACAGG - Exonic
997197226 5:131988224-131988246 TCCTTGATGGCCCCCTGCAGCGG - Exonic
1001002076 5:168017020-168017042 TCCTAGAAGGCACCCTGCTCTGG + Intronic
1003148931 6:3532407-3532429 TCCACGAAGTTCTCCTGCACAGG + Intergenic
1003569597 6:7247278-7247300 TCCTAGGAGCTCCCCTGAAGCGG + Intronic
1004074868 6:12335943-12335965 TCATCCAAGGTCACCTGCACTGG + Intergenic
1007614737 6:43173133-43173155 TCCTTGAAGGTCCCCTTCCTGGG + Intronic
1007720967 6:43885314-43885336 TCCTAGAAGGGCCCCTGAGTGGG + Intergenic
1016615135 6:146039260-146039282 TCATAGAAGGTCCCCAGAAAAGG + Intronic
1019298099 7:289743-289765 TCCTCGCAGGCTCCCTGCACTGG - Intergenic
1019772903 7:2894948-2894970 GCCAACAAGGTCCTCTGCACAGG - Intergenic
1022895893 7:34750200-34750222 CCCTACAAGTTACCCTGCACAGG + Intronic
1023186484 7:37538503-37538525 TCCAAAAAGGTCCCATTCACAGG - Intergenic
1023834351 7:44059623-44059645 TCGTAGAAGGTCTCCTGCTCTGG - Exonic
1023847710 7:44132019-44132041 TTCTAGAAGGTTCACTGCAAAGG + Intergenic
1024236444 7:47402516-47402538 TCCTGGAAGGATCCCTGCAAGGG - Intronic
1034338963 7:150340464-150340486 TCCTGGAAGGCCCACTGCACGGG + Exonic
1034558981 7:151867606-151867628 TCAAAGAAGGTCCCATTCACAGG + Intronic
1036727330 8:11231577-11231599 TCCTAAAATGTCCCCAGCAGTGG + Intergenic
1047443720 8:124901297-124901319 TTCTAGAAGGTCCCCTCAAGTGG + Intergenic
1050189397 9:3009255-3009277 TCCTAGCAGATCCTCTTCACTGG + Intergenic
1057305128 9:93907831-93907853 TCCTAAAAGGTCCCCAACAGAGG + Intergenic
1057576060 9:96243855-96243877 TCACAGAAGGTCCCCTCCCCTGG + Intronic
1060528641 9:124334664-124334686 TCCTTTAAGGTCCCCTCCCCTGG - Intronic
1061132107 9:128714037-128714059 TCGCAGAAGGTCACCTGCAGGGG - Exonic
1185761119 X:2690777-2690799 TCCCAGCAGCTCCCCTGCTCGGG - Intergenic
1186134111 X:6500998-6501020 TCCTAGGAGACACCCTGCACTGG + Intergenic