ID: 929898037

View in Genome Browser
Species Human (GRCh38)
Location 2:45978443-45978465
Sequence TAGGTGAAGGCCAACATTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 76}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929898037_929898041 4 Left 929898037 2:45978443-45978465 CCTCTAATGTTGGCCTTCACCTA 0: 1
1: 0
2: 0
3: 5
4: 76
Right 929898041 2:45978470-45978492 ACCTCTTGAACCTCTAGTTCGGG 0: 1
1: 0
2: 0
3: 3
4: 100
929898037_929898045 15 Left 929898037 2:45978443-45978465 CCTCTAATGTTGGCCTTCACCTA 0: 1
1: 0
2: 0
3: 5
4: 76
Right 929898045 2:45978481-45978503 CTCTAGTTCGGGGCACAGACTGG 0: 1
1: 0
2: 0
3: 7
4: 77
929898037_929898040 3 Left 929898037 2:45978443-45978465 CCTCTAATGTTGGCCTTCACCTA 0: 1
1: 0
2: 0
3: 5
4: 76
Right 929898040 2:45978469-45978491 AACCTCTTGAACCTCTAGTTCGG 0: 1
1: 0
2: 2
3: 6
4: 70
929898037_929898046 29 Left 929898037 2:45978443-45978465 CCTCTAATGTTGGCCTTCACCTA 0: 1
1: 0
2: 0
3: 5
4: 76
Right 929898046 2:45978495-45978517 ACAGACTGGCTTAGAACCATTGG 0: 1
1: 0
2: 3
3: 8
4: 141
929898037_929898043 5 Left 929898037 2:45978443-45978465 CCTCTAATGTTGGCCTTCACCTA 0: 1
1: 0
2: 0
3: 5
4: 76
Right 929898043 2:45978471-45978493 CCTCTTGAACCTCTAGTTCGGGG 0: 1
1: 0
2: 0
3: 5
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929898037 Original CRISPR TAGGTGAAGGCCAACATTAG AGG (reversed) Intronic
902127601 1:14229641-14229663 TAGGTGAAGGACACCCTTAGAGG - Intergenic
918929239 1:190832851-190832873 TAGGTTAAGTCAAACATTAGTGG - Intergenic
921125156 1:212171106-212171128 CAAGTGAAGCCCATCATTAGAGG - Intergenic
921259412 1:213372314-213372336 GATCTGAAGGCAAACATTAGGGG - Intergenic
921728907 1:218554839-218554861 TAGGGGAAAGATAACATTAGGGG - Intergenic
921869788 1:220127447-220127469 TAGGAGAAGGCACATATTAGAGG + Intronic
1064064150 10:12166367-12166389 TAGGGGAAGGCTACCATTACAGG + Exonic
1065109526 10:22426091-22426113 GAGGTGAAAGAAAACATTAGTGG + Intronic
1080798639 11:35589162-35589184 TTGGTGAAGGCCAACAGAACAGG - Intergenic
1085935575 11:81137795-81137817 TAGGGGAGGGATAACATTAGGGG - Intergenic
1089927112 11:122270132-122270154 GAGGTGAAGGCAAATATCAGTGG + Intergenic
1107720863 13:43246684-43246706 TAGGGGAAGGCCAAGGTCAGAGG + Intronic
1108706837 13:52996625-52996647 AAGGAGAAGGCTAGCATTAGTGG + Intergenic
1109462553 13:62680569-62680591 TAGGACAAGGCCAAGATCAGTGG + Intergenic
1112107165 13:96253296-96253318 TAGGTGAGGTGCAACATAAGTGG + Intronic
1114207037 14:20581699-20581721 TAGCTGAAAGAAAACATTAGAGG - Intergenic
1114658800 14:24331941-24331963 TGGGTGAAGGCCAGCCTCAGAGG + Intronic
1116227778 14:42173770-42173792 TAGGTGATGGCCAATATTTGAGG + Intergenic
1120553559 14:85902051-85902073 TAGGGGAGGGACAGCATTAGGGG - Intergenic
1121477479 14:94224070-94224092 TAGATGAAGGGCAAGATAAGGGG + Intronic
1126379352 15:48029971-48029993 TGGTTGGAGGCCAACATTTGAGG - Intergenic
1128973833 15:72133362-72133384 GAGGTGCAGGCAAATATTAGAGG - Intronic
1130099422 15:80881134-80881156 TAAGTGAAGGCAAACCTTACCGG - Exonic
1131073457 15:89480165-89480187 TGGGTGAAGGCCACCATGATGGG - Intronic
1132301120 15:100776260-100776282 GAGGTGAAGACAAACAGTAGTGG + Intergenic
1134037055 16:11039176-11039198 TAGGAGAATGCCACCATTTGGGG + Intronic
1138586493 16:57973669-57973691 GAGGTGAAAGCCAAGAGTAGTGG + Intergenic
1151591728 17:75048733-75048755 GAGCTCAAGGCCAACATCAGTGG - Intronic
1152879550 17:82807324-82807346 CAGGGGAAGGCCAACATCAAGGG - Intronic
1155175256 18:23296106-23296128 TAGGGGAGGGATAACATTAGGGG + Exonic
1156226208 18:35111765-35111787 TAGGGAAAGACCAACATTTGTGG - Intronic
1157343983 18:46806774-46806796 TTGATGAAGGCCAAAATAAGAGG + Intergenic
1160367012 18:78335316-78335338 TAGGTGAAGGCACAGATGAGAGG + Intergenic
1165527341 19:36367390-36367412 TAGGAGATGCTCAACATTAGTGG + Intronic
926457689 2:13088300-13088322 TAGGGGAAGACAAACATAAGGGG - Intergenic
929898037 2:45978443-45978465 TAGGTGAAGGCCAACATTAGAGG - Intronic
932656464 2:73614948-73614970 TAGGTGAAGCTTAACATCAGTGG + Intergenic
932817196 2:74871424-74871446 TAGGTGAAGGCTGAGACTAGAGG - Intronic
939062443 2:137438987-137439009 AAGATGAAGGCAAAAATTAGAGG + Intronic
940857769 2:158742921-158742943 AAGGTCAAGGGCACCATTAGGGG + Intergenic
945060485 2:205904518-205904540 AAAGTGAAGGGCCACATTAGGGG + Intergenic
945371692 2:209026150-209026172 TAGGGGAGGGATAACATTAGGGG + Intergenic
946495262 2:220190174-220190196 TAGGGGAGGGACAGCATTAGGGG + Intergenic
1180536460 22:16396830-16396852 TGGGTGAGGGCCAGCATCAGAGG + Intergenic
1182459292 22:30472581-30472603 GAGGGGAAGGCAAACATTAACGG - Intergenic
951785148 3:26410346-26410368 CAGGTTAAGTCCAACATCAGTGG + Intergenic
960875283 3:122289573-122289595 TAGGTGAAGGCCAACAGGGCAGG + Intergenic
961967043 3:130915967-130915989 TATGTGAAGGGCAGCATTACTGG + Intronic
962328774 3:134459031-134459053 TGGGTGAAGGATAACATTAGGGG - Intergenic
965332098 3:167388325-167388347 GAGATGAAGGCCAAAATAAGGGG + Intergenic
966124208 3:176556618-176556640 TAGATGAATGCAATCATTAGAGG + Intergenic
973556276 4:52086387-52086409 TAGGAGAGGGATAACATTAGGGG - Intronic
978659441 4:111106789-111106811 TATGTGAAGGATATCATTAGAGG + Intergenic
979582424 4:122376552-122376574 AAGGTGAATGCTAAAATTAGTGG + Intergenic
980643484 4:135611155-135611177 TTGGTGAAGGACAATATGAGGGG + Intergenic
989019416 5:36984779-36984801 TGGGTCAAGGCCAGCATTAATGG + Exonic
989562816 5:42871002-42871024 TAGGGGAAGGCCAGCATCACAGG + Intronic
989635279 5:43525053-43525075 TAGGTTAAGACCAATATTTGTGG + Intergenic
995648535 5:114341450-114341472 TAGGAGAAGGGGAAAATTAGGGG + Intergenic
998848869 5:146336100-146336122 AAGGTGAAGGTCAACATTGGAGG + Intronic
999527698 5:152425598-152425620 TAAGTCAAGGCTAACATTTGAGG - Intronic
1002421047 5:179149195-179149217 TAGGTGATGGCCCTCATGAGTGG + Intronic
1007732457 6:43955402-43955424 TATGTTAAGGCCAACATTGCAGG + Intergenic
1009655385 6:66538489-66538511 TAGTCAAAGGCCAACATGAGAGG - Intergenic
1011881024 6:92027046-92027068 TTGGTGAAGGTCAAGATGAGTGG - Intergenic
1018139787 6:160819609-160819631 TAGGTAAAGGCCAAAATAATCGG - Intergenic
1020713462 7:11638030-11638052 AAGGTGAGGGCCAACATGTGGGG + Intronic
1032958799 7:137005585-137005607 TAGGTCAAGGACAACTTTAAAGG - Intronic
1043060345 8:75492531-75492553 GTGGTGAAGGCCATCATTATTGG - Intronic
1043883607 8:85573261-85573283 AAGGTGAAGGAAAACTTTAGGGG - Intergenic
1048729922 8:137427101-137427123 TAGGGGAAGGATAGCATTAGGGG - Intergenic
1057872874 9:98731519-98731541 TAGGGGAAGGCCAAACCTAGAGG + Intronic
1058062229 9:100510029-100510051 AAGGTGAAGGCCATTCTTAGGGG + Intronic
1058303580 9:103407899-103407921 CAGGTGAATGCAAACATAAGAGG - Intergenic
1058912996 9:109538136-109538158 GAAGTGAAAGCCAACATTAAGGG - Intergenic
1059653251 9:116334622-116334644 TAGGTGAAGGGGAAGCTTAGGGG + Intronic
1187658541 X:21510634-21510656 TTTGTGAAGGACAACATAAGTGG - Intronic
1190182747 X:48207194-48207216 TAGGTGAAGGAAAAGATTTGGGG + Intronic
1190185710 X:48232135-48232157 TAGGTGAAGGAAAGCATTTGGGG - Intronic
1192957553 X:76089377-76089399 AAGGGGAAGGATAACATTAGGGG - Intergenic
1196237200 X:113296364-113296386 TAGGCGAAGCCCAACATCAATGG - Intergenic
1200293690 X:154895734-154895756 TAGGTGAAAGACAAGTTTAGGGG - Intronic