ID: 929898394

View in Genome Browser
Species Human (GRCh38)
Location 2:45981123-45981145
Sequence GAAAATGCAACAATGAAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 590
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 557}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929898392_929898394 4 Left 929898392 2:45981096-45981118 CCTAGTTTGGTAGAGGTAAGGAA 0: 1
1: 0
2: 3
3: 11
4: 154
Right 929898394 2:45981123-45981145 GAAAATGCAACAATGAAGCTAGG 0: 1
1: 0
2: 1
3: 31
4: 557

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929898394 Original CRISPR GAAAATGCAACAATGAAGCT AGG Intronic
900251582 1:1673208-1673230 GAAAACACAAAAATGAGGCTGGG + Intronic
900261943 1:1735744-1735766 GAAAACACAAAAATGAGGCTGGG + Intronic
901185512 1:7370261-7370283 AAACATGGAACAATGCAGCTTGG + Intronic
901252006 1:7785959-7785981 CAAAATGCAGTAATGAGGCTGGG + Intronic
902311006 1:15581712-15581734 AAAAATGCAACAAATTAGCTGGG + Intronic
902747892 1:18485243-18485265 GACAAGGCAACAACTAAGCTAGG + Exonic
902945940 1:19838614-19838636 GAAATTGCAATAATGTGGCTAGG - Intergenic
903076411 1:20770608-20770630 GAAACAGCAAAAATGAGGCTAGG - Intronic
903203332 1:21761592-21761614 TAAAATATAAAAATGAAGCTGGG + Intronic
903533320 1:24048938-24048960 AAAAATACAAAAATTAAGCTGGG + Intergenic
904215636 1:28916474-28916496 AAAAATGCAAAAAAGTAGCTGGG + Intronic
905248954 1:36635880-36635902 GAAAAGGGCACAGTGAAGCTGGG + Intergenic
905897993 1:41561273-41561295 GAAGATGTAAGAATGAGGCTTGG - Intronic
906166171 1:43688045-43688067 GAAAATGTAAAAACAAAGCTGGG + Intronic
906310062 1:44747468-44747490 GAAAATGTAACAATCCAGGTAGG + Exonic
907017639 1:51032792-51032814 GAAAAAAGAACAATGAAGCTGGG - Intergenic
907587453 1:55633929-55633951 TAAAATGCAAGAATGGGGCTGGG + Intergenic
907939498 1:59073865-59073887 AAGAAGGCAACAATGAGGCTGGG + Intergenic
909143474 1:71896910-71896932 ATAAATGAAAAAATGAAGCTTGG + Intronic
909905618 1:81190972-81190994 CAAAGTGCAACAAAGAGGCTGGG - Intergenic
909969661 1:81966460-81966482 GAAAATGCAACCATTAAACTGGG + Exonic
910781056 1:90933692-90933714 GAAAATTCTAAAATGAAGGTGGG - Intronic
910944506 1:92575490-92575512 CAAAATGTAACCATGAACCTTGG - Intronic
911232213 1:95373375-95373397 GAAATTACAAAAATGAAGGTGGG + Intergenic
912054820 1:105581607-105581629 GAAAATACAAAAACGTAGCTGGG - Intergenic
912692117 1:111812330-111812352 GGAAATGCAAAAATGATGGTGGG + Intronic
912902446 1:113667038-113667060 AAAAATGGAACAATAAAGCCTGG - Intronic
913177962 1:116292271-116292293 GAAAATGGAAGAAGGATGCTTGG - Intergenic
914415270 1:147474580-147474602 GTAAATACAACAATAAAGCCTGG + Intergenic
914891357 1:151626539-151626561 GAAAATGCAAAAAATTAGCTGGG + Intronic
914894541 1:151657324-151657346 AAAAATACAAAAATGAAGCTGGG - Intronic
914977835 1:152381778-152381800 GTAAATGGAACAGTAAAGCTTGG + Intergenic
916152045 1:161803545-161803567 GAAGATGAAACAATGTTGCTGGG + Intronic
916498205 1:165364449-165364471 GAAAAGGCATCAAAGAGGCTTGG + Intergenic
916520672 1:165561014-165561036 GAAAAGGAAACAATGGAGATAGG + Intronic
916542964 1:165774724-165774746 TAAAATTCAACCATGAGGCTGGG - Intronic
916570878 1:166026473-166026495 GAAAATGAGACAAAGATGCTTGG - Intergenic
916792038 1:168133754-168133776 AAAAATACATAAATGAAGCTGGG - Intronic
917994969 1:180427536-180427558 GCAATTGCAACAATGAAAATGGG - Intronic
918476740 1:184933365-184933387 GAAAATGTAGCAATTAAGATAGG - Intronic
918498113 1:185162084-185162106 GGAAAGGCAACACTGAAGCATGG + Intronic
918677661 1:187307635-187307657 GAAAATGCAATAATGACTTTAGG + Intergenic
919092430 1:192991629-192991651 AAAAATACAAAAATGTAGCTGGG + Intergenic
920192893 1:204205770-204205792 AAAAATACAGCAATGAAGCCAGG + Intronic
920341455 1:205277662-205277684 AAAAATACAAAAATGAGGCTGGG - Intergenic
921154539 1:212428882-212428904 GAAAATGCTACAATCCAGCCAGG + Intergenic
921251586 1:213303325-213303347 GAAAATCCTACGATGAATCTTGG - Intergenic
921408311 1:214806536-214806558 GGAAATGGAACAACAAAGCTTGG + Intergenic
921451231 1:215308226-215308248 GGAAATGCAAGAATAAAGCTAGG + Intergenic
922032597 1:221816659-221816681 AATAAAGCAACAATGAAGTTTGG - Intergenic
922502557 1:226108144-226108166 GAAAATGAAAATAAGAAGCTAGG - Intergenic
922940419 1:229459803-229459825 GAAAATGCTGCAATGAACATGGG + Intronic
923496912 1:234533684-234533706 TAAAATGCAACAAAAGAGCTTGG - Intergenic
923623929 1:235598884-235598906 AAAAATACAAAAATTAAGCTAGG - Intronic
923756292 1:236794165-236794187 GAGAATGCAACAAAGAAGGGAGG - Intergenic
924118296 1:240769769-240769791 GATTCTCCAACAATGAAGCTCGG + Intergenic
924222483 1:241892636-241892658 AAAAATACAAAAATGAAGCTGGG - Intronic
924781210 1:247149395-247149417 GAAAATGCTGCAATAAACCTGGG - Intronic
1063152532 10:3350197-3350219 GAAATTGCAACTGTGAAGCAAGG + Intergenic
1063333171 10:5182747-5182769 GAAAATACAAAAAATAAGCTGGG + Intergenic
1063686133 10:8238664-8238686 GAAAATGCTACAACAGAGCTGGG + Intergenic
1064190410 10:13200983-13201005 GAAAATCCAAAAATTTAGCTGGG + Intronic
1064339043 10:14470270-14470292 GACCATGCAACAATGTACCTCGG + Intergenic
1064762878 10:18639331-18639353 AAAAATACAAAAATGAAGCCAGG + Intronic
1064911166 10:20403398-20403420 GAAAAAGCAATAATTAAGCATGG - Intergenic
1065932603 10:30492883-30492905 GAAAATACAAAAAATAAGCTGGG + Intergenic
1066027079 10:31369642-31369664 AATAATGCAACAATGAACATAGG + Intronic
1066324564 10:34344575-34344597 AAAACAGCAACAATGCAGCTGGG - Intronic
1067104454 10:43356844-43356866 AAAAATGCAAAAATTAGGCTGGG + Intergenic
1067360504 10:45574017-45574039 GAAAAGGCAACAATGAGGTGTGG - Intronic
1068089315 10:52413130-52413152 GATTCTCCAACAATGAAGCTCGG - Intergenic
1068104502 10:52596975-52596997 GAAAATGCAAAAAATTAGCTGGG + Intergenic
1068218754 10:54016294-54016316 GAAAATGGAACAAAGCAGTTTGG + Intronic
1068765440 10:60758173-60758195 GAAAATACAAAGATAAAGCTAGG + Intergenic
1069351788 10:67535172-67535194 GAAAATGAAATAAAGAAGCATGG + Intronic
1069526118 10:69173702-69173724 GAAAACGCACCAATCAGGCTGGG + Intergenic
1072538682 10:96382188-96382210 AAAAATGCAAAAAATAAGCTGGG - Intronic
1073198797 10:101717818-101717840 AAAAATTAAACAATGAGGCTGGG + Intergenic
1073257777 10:102165230-102165252 GAAAATGGAAGCATGAAGGTGGG - Intergenic
1074666991 10:115738531-115738553 GAAAATTCCAAAATGCAGCTGGG - Intronic
1075385886 10:122055057-122055079 TAAAATGCAAAAATTTAGCTGGG + Intronic
1075387458 10:122066560-122066582 GAAAATACAAAAATTAAGCTGGG - Intronic
1075472279 10:122700272-122700294 GAGGAAGCAACAATTAAGCTGGG - Intergenic
1075541456 10:123317685-123317707 GAAACTGGAGCAATGAAACTGGG + Intergenic
1075891099 10:125951728-125951750 GAAATTGAAAGAATGAAGATTGG - Intronic
1076487921 10:130836128-130836150 GAAACAGCAACAAAGAGGCTGGG - Intergenic
1079695723 11:23480085-23480107 GATTCTCCAACAATGAAGCTCGG - Intergenic
1079742132 11:24076076-24076098 GAAAATGCAAAAACAAAGCAAGG + Intergenic
1080134730 11:28841442-28841464 GAAAATGCTAGGATGAAGTTTGG - Intergenic
1080604634 11:33854934-33854956 GAAAATATAACAATCAGGCTGGG + Intergenic
1082882888 11:58055637-58055659 GAAAATACAAAAATGTAGCCAGG + Intronic
1083040052 11:59677041-59677063 GTAAATGAAACAATAAAGCCTGG - Intergenic
1084852208 11:71950927-71950949 AAGAATGCAATAATGAGGCTGGG + Intronic
1085790034 11:79489174-79489196 GATGATGCAACAGTTAAGCTTGG - Intergenic
1085970592 11:81585689-81585711 AACAATGCAACAATGAATTTAGG - Intergenic
1086451146 11:86918216-86918238 GTAAATGCAGAGATGAAGCTTGG + Intronic
1087229465 11:95643966-95643988 CAAAATTCAACTATGAAACTTGG - Intergenic
1088681237 11:112243668-112243690 AAAAATGCAAAAATTTAGCTAGG - Intronic
1089935219 11:122357627-122357649 AAAAATTCAAAAATGTAGCTGGG + Intergenic
1090024009 11:123152360-123152382 AAAAATACAAAAATGTAGCTGGG + Intronic
1090311569 11:125745995-125746017 GAGAATGCAAGGATAAAGCTGGG - Intergenic
1090349279 11:126097199-126097221 GAAAATACAAAAATTAGGCTGGG - Intergenic
1090912605 11:131134612-131134634 GAAAAATCAGCAAGGAAGCTAGG - Intergenic
1090947373 11:131443262-131443284 CAAAATTCAACAATGAAGACTGG + Intronic
1091478209 12:798485-798507 GAAAATGCAATAGTAAGGCTGGG - Intronic
1092105684 12:5920337-5920359 CAAAATTCAACAAGGAAACTAGG + Intronic
1092213699 12:6665585-6665607 GAAAATACAAAAAATAAGCTAGG - Intergenic
1092266357 12:6983845-6983867 AAAAATGATACAAGGAAGCTAGG + Intronic
1092768187 12:11871853-11871875 GAAAATGAAAAAATAAAACTGGG + Intronic
1093246464 12:16743880-16743902 GAAAATACAAAAAATAAGCTGGG + Intergenic
1093299462 12:17436796-17436818 GCAAATGCTACAATGAATGTGGG - Intergenic
1093382518 12:18510264-18510286 GAAAATTAAAAAATGAAGATAGG - Intronic
1093569769 12:20653639-20653661 GAAAATGCAATGGTGAGGCTGGG - Intronic
1095050464 12:37549652-37549674 TAAAAAGCTACATTGAAGCTGGG + Intergenic
1095260861 12:40097922-40097944 GATAATGCTGCAATGAAGATGGG - Intronic
1095357317 12:41291036-41291058 AAAAATGCTACAATTAATCTTGG + Intronic
1095561382 12:43570097-43570119 GATTCTCCAACAATGAAGCTCGG + Intergenic
1097669134 12:62515186-62515208 AAAAATGCGACAATGAACATGGG - Intronic
1098082617 12:66805135-66805157 AAAAATGTAACAATTGAGCTAGG - Intergenic
1098139459 12:67437006-67437028 GATAATGCCACAATGAACATGGG + Intergenic
1098652179 12:72986314-72986336 GAAATTGAAACCATGAGGCTGGG - Intergenic
1099340620 12:81428420-81428442 TAAAATCCAACAAAGAAGATAGG - Intronic
1099708819 12:86193412-86193434 GACAATATAACACTGAAGCTAGG - Intronic
1100927189 12:99562215-99562237 AAAAATGGAACAATCAAGCCTGG - Intronic
1101269702 12:103130641-103130663 GCAAAAGCAAGAGTGAAGCTTGG + Intergenic
1102114468 12:110391929-110391951 TAAAATGCAAAAAAGTAGCTGGG + Intronic
1102161693 12:110774330-110774352 AAAAATACAAAAATTAAGCTGGG + Intergenic
1102193907 12:111010546-111010568 GAAAATACAAAAATTTAGCTGGG + Intergenic
1102240391 12:111321171-111321193 AAAAATACAAAAATTAAGCTGGG + Intronic
1102318797 12:111912898-111912920 CAAAATTCAAGAATGAAGTTTGG - Intergenic
1103770544 12:123319566-123319588 GAAAATACAAAAATTTAGCTGGG - Intronic
1104169889 12:126269907-126269929 GAAAAGGCAAAAATGAAGAAAGG - Intergenic
1104487565 12:129164485-129164507 GAAAATGGACCAATACAGCTGGG - Intronic
1105211064 13:18257351-18257373 GAAAAGGGAACATTGATGCTTGG + Intergenic
1107246307 13:38300485-38300507 GCAAATGAAACCATGAAGTTCGG - Intergenic
1108561463 13:51648288-51648310 AAAAAGGCAGCAAGGAAGCTAGG - Intronic
1108589707 13:51902238-51902260 GAAAATGTAACAAGGCAACTGGG - Intergenic
1108953789 13:56124574-56124596 AAAAATGCTGCAATGAAGATAGG + Intergenic
1109547941 13:63852497-63852519 GAAACTGAGACAATGAAGTTAGG + Intergenic
1111292714 13:86188511-86188533 GAAAATGCAACATTTGGGCTCGG - Intergenic
1111731068 13:92077503-92077525 GAAAATGCTACCATGAAACGGGG - Intronic
1113499395 13:110761249-110761271 GAAAATTCAACAAGAAATCTGGG - Intergenic
1114161177 14:20169453-20169475 AAAAATACAAAAATGTAGCTGGG + Intergenic
1114291667 14:21293581-21293603 AAAAATACAAAAATTAAGCTGGG + Intronic
1114348336 14:21821442-21821464 GAAAATTCAACAATTCATCTTGG - Intergenic
1114919882 14:27312858-27312880 CAAAATGCACAAATGAAGCAAGG - Intergenic
1115196078 14:30800906-30800928 AATAATGCTACAATGAACCTTGG + Intergenic
1115762106 14:36584879-36584901 GTAAATGCTACAATGAAGATAGG - Intergenic
1115773109 14:36687110-36687132 GAAAATACAAAAATTTAGCTGGG - Intronic
1116607116 14:47014229-47014251 ATAAATGCAACAACAAAGCTTGG - Intronic
1116976290 14:51119869-51119891 GAAAGGGAAACAATCAAGCTTGG - Intergenic
1117263361 14:54059937-54059959 ATAAATGAAACAATGAACCTTGG - Intergenic
1117292896 14:54350886-54350908 GAAAATACAAAAATTTAGCTGGG - Intergenic
1117381693 14:55170597-55170619 GATAATGAAACAATAAAGTTAGG + Intronic
1117406287 14:55407422-55407444 AAAAATGCAAAAATGAGGCCGGG - Intronic
1117465047 14:55984748-55984770 GAAGATGCAACCTTGAAGCTGGG - Intergenic
1117999437 14:61509582-61509604 GAAAAGGCAACTATGAATGTTGG + Intronic
1118392281 14:65305333-65305355 GGAAATTCAACAATAAACCTAGG + Intergenic
1119067567 14:71545153-71545175 TAAAAGGCAAGAATGAGGCTGGG - Intronic
1119347869 14:73941279-73941301 AAAACTGCAAAAATGTAGCTGGG - Intronic
1119549210 14:75496216-75496238 GAAAATGCAACACGGCAGATTGG - Intergenic
1119679420 14:76580842-76580864 GAAACTGCAAGAAAGAAGCTTGG + Intergenic
1120040673 14:79749421-79749443 AAAAAAACAACACTGAAGCTTGG - Intronic
1120606215 14:86582077-86582099 GGAAATGCAAGTATGGAGCTTGG + Intergenic
1120995181 14:90412061-90412083 GAAAAAGTAAAAAAGAAGCTGGG - Intergenic
1121036497 14:90708495-90708517 GTAAATGGAACAATAAAGCCTGG + Intronic
1122530639 14:102423841-102423863 GAAAAGGCAACAATATAGATGGG + Intronic
1122837947 14:104440002-104440024 GAAAATGGAACAACAAAGCCTGG - Intergenic
1123013724 14:105363094-105363116 GAAAATGGAACAACAAAGCCTGG - Intronic
1202927794 14_KI270725v1_random:7645-7667 AAAAAATCAACAATGAGGCTGGG + Intergenic
1123487001 15:20749659-20749681 GAAAATGCAAAAAATTAGCTGGG + Intergenic
1123543488 15:21318717-21318739 GAAAATGCAAAAAATTAGCTGGG + Intergenic
1124009024 15:25820700-25820722 GAAAATTCAAAAATGCTGCTTGG + Intronic
1124052742 15:26213689-26213711 GAAAATGAAAAAATGTAGTTGGG + Intergenic
1125313707 15:38408343-38408365 GAAAATGGAAAACTGAAGGTTGG + Intergenic
1125688884 15:41580590-41580612 GAAAATGCAAATATTCAGCTGGG + Exonic
1126237731 15:46405729-46405751 AAAAATGCAACAAATTAGCTTGG - Intergenic
1126477788 15:49084331-49084353 GCAAACGGAACAATTAAGCTGGG - Intergenic
1126603022 15:50447896-50447918 AAAAATGCAAAAATTAGGCTGGG - Intronic
1127206030 15:56720040-56720062 TAAAATAAGACAATGAAGCTTGG + Intronic
1129590699 15:76912360-76912382 AAAAATGCAACAAATTAGCTGGG - Intergenic
1131545159 15:93309718-93309740 AAAAATACAAAAATTAAGCTTGG + Intergenic
1131719080 15:95147702-95147724 GAAAATCCAAAATTCAAGCTGGG + Intergenic
1202951808 15_KI270727v1_random:45841-45863 GAAAATGCAAAAAATTAGCTGGG + Intergenic
1132610661 16:814344-814366 TAAAATGCAAAAATGTAGCCAGG + Intergenic
1132752105 16:1462858-1462880 CCACATGCAAAAATGAAGCTGGG + Intronic
1133122599 16:3619520-3619542 AAAAATACAAAAATGGAGCTAGG - Intronic
1134582693 16:15384497-15384519 AAAAATGCAAAAATTAAGCTGGG - Intergenic
1135314013 16:21428555-21428577 AAAAATGCAAAAATTAGGCTGGG - Intronic
1135366937 16:21860835-21860857 AAAAATGCAAAAATTAGGCTGGG - Intronic
1135444878 16:22510327-22510349 AAAAATGCAAAAATTAGGCTGGG + Intronic
1135494247 16:22937712-22937734 GAAAATGGAAGAATGACTCTAGG + Intergenic
1135713295 16:24736986-24737008 GAAAATGAAACATTGGGGCTGGG + Intronic
1135742461 16:24987789-24987811 TAAAATGAAAAAATGAAGCATGG + Intronic
1135754773 16:25087824-25087846 TAAAATGAAAAAATGAAGCATGG + Intergenic
1136130260 16:28215892-28215914 AAAAATACAAAAATGAGGCTGGG + Intergenic
1136193599 16:28634870-28634892 AAAAATGCAAAAATTAGGCTGGG + Intergenic
1136310683 16:29407262-29407284 AAAAATGCAAAAATTAGGCTGGG - Intergenic
1136324124 16:29509044-29509066 AAAAATGCAAAAATTAGGCTGGG - Intergenic
1136438809 16:30249027-30249049 AAAAATGCAAAAATTAGGCTGGG - Intronic
1137649909 16:50110864-50110886 GAAAATGCTAAGATGACGCTTGG + Intergenic
1139858365 16:69999646-69999668 GAAAATGCAAAAATTAAGCCGGG - Intergenic
1140330926 16:74056059-74056081 AAAAAGGCAAATATGAAGCTGGG + Intergenic
1140841175 16:78840687-78840709 GAAAAGGAAACAAAGAAGCTCGG - Intronic
1142724324 17:1801038-1801060 GAAAATCCCACAATGACCCTTGG + Intronic
1143561860 17:7701262-7701284 AAAAATACAAAAATGAGGCTGGG - Intronic
1143946015 17:10592760-10592782 GAAAATTTAACTATGAATCTTGG - Intergenic
1144386471 17:14753006-14753028 AAAAATACAACAATTAGGCTGGG + Intergenic
1144762192 17:17713478-17713500 GAAAATACAAAAATTTAGCTGGG + Intronic
1145715853 17:27020346-27020368 AAAAATACAAAAATGTAGCTGGG + Intergenic
1145951579 17:28822462-28822484 AAAAATACAAAAATTAAGCTGGG + Intronic
1146175025 17:30660482-30660504 GAAATAGCAACAGGGAAGCTGGG - Intergenic
1146348479 17:32076506-32076528 GAAATAGCAACAGGGAAGCTGGG - Intergenic
1146610921 17:34304348-34304370 GAAGCTGGAAGAATGAAGCTGGG + Intergenic
1147275756 17:39315090-39315112 GCAAATACAAAAATTAAGCTGGG - Intronic
1147524593 17:41209661-41209683 AAAAATACATCAATGAAGCCAGG - Intronic
1148468371 17:47878263-47878285 GAAAATGGAGCAATTAAGATGGG - Intergenic
1149051860 17:52314425-52314447 GAATATGCAGCAATGAACATGGG - Intergenic
1149155763 17:53628687-53628709 GAAAATGCTACAATGAACATGGG + Intergenic
1149901269 17:60481657-60481679 GAAAATACTACAATAGAGCTGGG + Intronic
1150066644 17:62115664-62115686 TAAAATGCAAGAGTGAGGCTGGG + Intergenic
1150727601 17:67664122-67664144 AAAAATGCAAAAATTTAGCTGGG - Intronic
1151472960 17:74329285-74329307 GAAAATACAAAAATTTAGCTGGG + Intronic
1151797428 17:76355642-76355664 AAAAATGCAAAAATTAGGCTGGG + Intronic
1152105664 17:78327281-78327303 AAAAATACAAAAATTAAGCTGGG + Intergenic
1152343809 17:79739542-79739564 GAAAATGCAAAAATGAAAGATGG + Intronic
1153001883 18:463265-463287 GAAAATGAAACAATAAACCAAGG - Intronic
1153021868 18:636784-636806 AAAAATACAACAAAGTAGCTGGG - Intronic
1153848737 18:9072991-9073013 GAAAATACAAAAATTAGGCTGGG + Intergenic
1154119809 18:11642917-11642939 AAAAATGCAAAAATTAGGCTGGG - Intergenic
1154938539 18:21087437-21087459 TAAAATGCAACAATACAGGTAGG + Intronic
1155951240 18:31915599-31915621 AAAAATACAAAAATGAAGCCGGG + Intronic
1156165681 18:34417955-34417977 GAAATTGCAACAATGATTATAGG + Intergenic
1156649359 18:39206132-39206154 GAAAATGTGACAATATAGCTGGG + Intergenic
1156917266 18:42476462-42476484 GAAAATGTAAGGATGAAGATGGG + Intergenic
1157853424 18:51080834-51080856 GAAAAGGGAACAATGAGGCCAGG - Exonic
1158199339 18:54922690-54922712 AAAAATGCAAAAATTATGCTGGG + Intronic
1158617311 18:59000211-59000233 AAAAATGCCATCATGAAGCTGGG - Intergenic
1158635849 18:59156819-59156841 GAAAATGCAACAAAGAAAAATGG - Intronic
1158694015 18:59687104-59687126 GAAAATTCCAAAATGAAGCAAGG + Intronic
1159010428 18:63054130-63054152 GAAAATCCAAGAATGTAGCTTGG + Intergenic
1159191726 18:65054168-65054190 ATAAATGCAAGAAGGAAGCTGGG - Intergenic
1159221588 18:65471775-65471797 GAAAATAAAACAATGAATCTCGG + Intergenic
1159749294 18:72280505-72280527 GAAAATGAAAAAAAGAAACTGGG + Intergenic
1160318798 18:77871217-77871239 GAAAATGGAAAAAAGAAGCCAGG - Intergenic
1160691595 19:462827-462849 GAAGAGGCAATATTGAAGCTGGG - Intergenic
1161842284 19:6689684-6689706 AAAAATACAACAATTAGGCTGGG + Intronic
1162144709 19:8606560-8606582 AAAAATACAAAAATGTAGCTGGG - Intronic
1162264538 19:9560276-9560298 AAAAATTCAACAATGAAGAGGGG + Intergenic
1162302685 19:9852981-9853003 GAAAATGGAAAAATTCAGCTGGG + Intergenic
1163433094 19:17279973-17279995 GGAAATGCAAAAATTAAGCCAGG + Intronic
1163944813 19:20525473-20525495 AAAAATGCAACACTGGACCTGGG - Intergenic
1164879982 19:31724755-31724777 GAAATTGCAACATAGAACCTAGG - Intergenic
1165159462 19:33807426-33807448 GAAAATGCAAAAATTAGGCCTGG + Intronic
1165272134 19:34719132-34719154 AATAATGCCACAATGAACCTTGG - Intergenic
1166044351 19:40221135-40221157 AAAAATGCAACAAATTAGCTGGG - Intergenic
1166249916 19:41563021-41563043 GAAAATGAAATACTGAGGCTGGG - Intronic
1167289473 19:48616401-48616423 GAAACTACAGCAAGGAAGCTGGG + Intronic
1167302225 19:48684775-48684797 AAAAATGAAACAAGGAAACTTGG - Intergenic
1167813359 19:51854885-51854907 GAATAAGCAAATATGAAGCTAGG - Intergenic
1168090319 19:54078660-54078682 AAAAATACAAAAATGAGGCTGGG - Intronic
1168180482 19:54659413-54659435 GAAAACGAAACAATGAAACATGG + Intronic
1168447232 19:56430496-56430518 GAAAATGAAAGATTGAAGCAAGG + Intronic
925359996 2:3271671-3271693 GTAAATGGAACAATAAAGCCTGG - Intronic
926038647 2:9655162-9655184 GAAAATACAACAAATCAGCTGGG + Intergenic
926167439 2:10530358-10530380 TAAAATGCAAAAAAAAAGCTGGG - Intergenic
926385611 2:12332993-12333015 GAAAATGCAAAAAGTTAGCTGGG + Intergenic
927546001 2:23953963-23953985 GCTAATGCAATAATGAATCTAGG - Intronic
928151059 2:28829646-28829668 GAAAATACAAAAATTAGGCTGGG + Intronic
928322118 2:30292190-30292212 AAAAATGCAACAAACTAGCTGGG + Intronic
929190770 2:39137518-39137540 AAAAATACAACAAATAAGCTGGG - Intergenic
929898394 2:45981123-45981145 GAAAATGCAACAATGAAGCTAGG + Intronic
929979419 2:46664734-46664756 GAAAATACAACAGAGAATCTTGG + Intergenic
930451977 2:51552905-51552927 GAAACTGCCAAAAGGAAGCTAGG - Intergenic
930491958 2:52085345-52085367 ATAAATGCAACAATGAAGTGTGG - Intergenic
931356732 2:61543654-61543676 GAAAATAAAACAAAGTAGCTGGG - Intergenic
931727201 2:65122808-65122830 AAAAATGCAAAAATTTAGCTGGG + Intronic
932464750 2:71911284-71911306 AAAAATGAAACAAAGAAGCATGG + Intergenic
932518264 2:72377403-72377425 GATAATGCTACAATGAACATAGG - Intronic
933079804 2:77971902-77971924 AAAAATACAAAAATGTAGCTGGG + Intergenic
933511579 2:83246783-83246805 AAAAATACAAAAATTAAGCTGGG + Intergenic
933993925 2:87654075-87654097 GACAAAGCCACCATGAAGCTAGG + Intergenic
934473046 2:94573232-94573254 AAAAATACAAAAATTAAGCTGGG - Intergenic
934966349 2:98727240-98727262 GAAAATGCAGCAATCCAGCCAGG + Intronic
935333408 2:101994126-101994148 TAAAAGGCAAGAAGGAAGCTCGG + Intronic
935544669 2:104388055-104388077 GAAAATGCAAGAAACAAGCACGG + Intergenic
935840199 2:107100910-107100932 TTCAAGGCAACAATGAAGCTGGG - Intergenic
936299940 2:111296839-111296861 GACAAAGCCACCATGAAGCTAGG - Intergenic
936343227 2:111655971-111655993 GAAAATCCAAGAATGCAACTGGG + Intergenic
937947119 2:127350311-127350333 AAAAATGAAACAATGAAGTTAGG + Intronic
938007662 2:127801364-127801386 TAAAATGGTACAATGAGGCTGGG + Intronic
938038694 2:128057664-128057686 GAAAATATTACAATGAAGATAGG + Intergenic
938470210 2:131553136-131553158 AAAAATGCACCAAAGAAGCTGGG - Intergenic
938809325 2:134837786-134837808 TTAAATGCATGAATGAAGCTGGG + Intergenic
939003708 2:136763658-136763680 GAAAATGCAGCATTGATTCTGGG + Intergenic
940220956 2:151350834-151350856 GAAAATACAAAAATGAACCTGGG + Intergenic
941098454 2:161269269-161269291 AAACATGCAACAGTGAGGCTAGG + Intergenic
941292056 2:163688872-163688894 TAATATACAACAATGAGGCTGGG + Intronic
941392888 2:164936648-164936670 GAAAATGCTAGAATGAAACCAGG - Intronic
941465594 2:165822360-165822382 GAAAATGAAACCATGAAGAAAGG - Intergenic
941698300 2:168576865-168576887 GAGAATTCAAGAATGACGCTTGG + Intronic
942059906 2:172219008-172219030 GAAAATACGAAAATTAAGCTGGG - Intergenic
942256498 2:174105912-174105934 TAAACGGCAACAATTAAGCTAGG + Intronic
942354546 2:175095256-175095278 AAAAATACAAAAATTAAGCTGGG - Intronic
942534270 2:176946816-176946838 AAAAATGCAACAACAAAGCTCGG + Intergenic
942822314 2:180129025-180129047 GCAAATGGAACAATAAAGCCTGG - Intergenic
942903150 2:181146738-181146760 AAAAATGAAAGAAAGAAGCTTGG - Intergenic
942928950 2:181466216-181466238 AAAATTGCAACCATAAAGCTTGG + Intronic
943494335 2:188601331-188601353 TAAAATGAAACAATGTAACTAGG + Intergenic
943899787 2:193418888-193418910 AAAAATACAAAAATGTAGCTAGG - Intergenic
945334589 2:208577622-208577644 TTAAATGCAACACTGAAGCCAGG - Intronic
945565275 2:211390329-211390351 GAAAAGGCAAGAATGAAACAAGG + Intronic
945928490 2:215830430-215830452 TAAAATGCAACAGTCCAGCTGGG - Intergenic
946522520 2:220482107-220482129 AAAAATGCAACAGTGAGGCAAGG - Intergenic
946796366 2:223358517-223358539 TAAAATTCAAAACTGAAGCTTGG - Intergenic
947328849 2:229007002-229007024 GAAAATTCACAAATGAAGCTTGG + Intronic
948172436 2:235915517-235915539 AAAAATGCAAAAATTTAGCTGGG + Intronic
1169123820 20:3112976-3112998 GAAAAAGACACAGTGAAGCTGGG + Intronic
1169237344 20:3941777-3941799 GAAAATAAAAAGATGAAGCTGGG + Intronic
1169518171 20:6340941-6340963 GATAATGCCAAACTGAAGCTTGG - Intergenic
1170168715 20:13387352-13387374 AAAAATACAAAAATTAAGCTGGG - Intergenic
1170252330 20:14298012-14298034 GTAAATGGAAGAATGAAGCCTGG + Intronic
1170626326 20:18032983-18033005 AAAAATAAAACAATGAAGCGAGG + Intronic
1171251047 20:23647853-23647875 GATAAGACAACAATGAAGTTTGG + Intergenic
1171321689 20:24249962-24249984 GAAAATGACACAATGAAAGTAGG + Intergenic
1172238268 20:33393334-33393356 AAAAATCAAACAATGAGGCTGGG - Intronic
1172582202 20:36057287-36057309 AAAAATACAAAAATGAAGCTGGG + Intergenic
1173551469 20:43935764-43935786 GAAAATACAAAAATTTAGCTGGG + Intronic
1174361685 20:50032804-50032826 AAAAATACAAAAATTAAGCTAGG + Intergenic
1175317739 20:58062316-58062338 GAAAAGGAAATAATAAAGCTAGG + Intergenic
1175351369 20:58322091-58322113 GAAAATCTAACAATGACGCCCGG - Intronic
1175672133 20:60912647-60912669 GAAAATACAAAAATTTAGCTAGG + Intergenic
1176008306 20:62878582-62878604 TAAAATGCAACAATTATACTAGG + Exonic
1176589816 21:8636308-8636330 AAAAAATCAACAATGAGGCTGGG + Intergenic
1176972709 21:15285418-15285440 GTAAATCCAGAAATGAAGCTGGG - Intergenic
1177879329 21:26673456-26673478 GAAAATTTAAAAATGTAGCTGGG - Intergenic
1178148417 21:29766292-29766314 GATAATGCCAAAATGTAGCTAGG - Intronic
1178477561 21:32950653-32950675 GAAAATGCACAAATGAAGAAGGG - Intergenic
1179447710 21:41444811-41444833 GAGAAGGCAGCAATGAAGCCCGG - Intronic
1180272649 22:10613323-10613345 AAAAAATCAACAATGAAGCTGGG + Intergenic
1180644340 22:17326171-17326193 CAAAATACAAAAATGTAGCTGGG + Intergenic
1180765183 22:18342085-18342107 GAAAAGGGAACATTGATGCTTGG - Intergenic
1180813847 22:18777599-18777621 GAAAAGGGAACATTGATGCTTGG + Intergenic
1181200032 22:21211934-21211956 GAAAAGGGAACATTGATGCTTGG + Intronic
1181625969 22:24122410-24122432 CAAAATGCTCCAATGAGGCTGGG + Intronic
1182315924 22:29447191-29447213 AAAAATGCAAAAATTAGGCTGGG - Intergenic
1182724177 22:32429365-32429387 GAAAATGCAAAAAATTAGCTGGG - Intronic
1182838993 22:33369432-33369454 GAAAATAGAAAAAAGAAGCTTGG - Intronic
1183785241 22:40025449-40025471 TAAAATGCAACAAATACGCTTGG + Intronic
1183851885 22:40596504-40596526 AAAAATGCAAAAATTAGGCTGGG + Intronic
1183903669 22:41023911-41023933 AAAAATACAAAAATTAAGCTGGG - Intergenic
1183982920 22:41552969-41552991 AAAAATACAAAAATGAGGCTGGG - Intergenic
1184349165 22:43932300-43932322 TTAAATGAAACAATGAACCTGGG - Intronic
1184808415 22:46811781-46811803 GAAAAGCCAAAAATGCAGCTGGG + Intronic
1185407984 22:50666549-50666571 GAAAATACAAAAACGTAGCTGGG - Intergenic
1203226804 22_KI270731v1_random:82990-83012 GAAAAGGGAACATTGATGCTTGG - Intergenic
949137473 3:585398-585420 AAAAAATCAACAATGAGGCTGGG - Intergenic
949630027 3:5914861-5914883 GAAAGTACAACAAAAAAGCTTGG - Intergenic
949784355 3:7724207-7724229 GAGAAAGCAACAATGAAGCAAGG + Intronic
950700263 3:14739446-14739468 ATAAATGGAACAATGAAGCTTGG - Intronic
950970879 3:17186547-17186569 AAAAATGCAACAAATTAGCTGGG + Intronic
951538799 3:23763370-23763392 GAAAATGAAACACAGAAGCTGGG - Intergenic
951759772 3:26133606-26133628 GAAAATTCAACAGTGAAAGTTGG - Intergenic
952270249 3:31824010-31824032 AAAAATGCAAAAAAGTAGCTGGG - Intronic
954739889 3:52740636-52740658 AAAAATACAAAAATGTAGCTGGG + Intronic
955307741 3:57851026-57851048 TAAAGTGCTAGAATGAAGCTTGG - Intronic
955360682 3:58271923-58271945 GAAAATGCAAAAAATTAGCTGGG - Intronic
955728071 3:61953663-61953685 GAAAATGCAGCAGTGAGCCTTGG - Intronic
955931537 3:64062366-64062388 GATAATACAGAAATGAAGCTGGG + Intergenic
956470618 3:69563385-69563407 GAAAAAGAAACAAAGAAGCATGG - Intergenic
956670120 3:71681186-71681208 GAAAATGTAAAAATGATACTTGG - Exonic
956703468 3:71979500-71979522 GAAAATGCAACAAGGAAGGGTGG + Intergenic
957278711 3:78122581-78122603 GAAAGTGCAGGAATGCAGCTGGG - Intergenic
957771988 3:84706511-84706533 AAAAAAGCAACACTGAAGTTAGG - Intergenic
958760795 3:98305641-98305663 AAAAATGCAAAAAAGTAGCTGGG - Intergenic
959315531 3:104801451-104801473 AAAAATGCAACAATTATGGTGGG + Intergenic
962490824 3:135892646-135892668 GAAAATACAAAAAAAAAGCTGGG + Intergenic
963705651 3:148684784-148684806 GAAGAGGCATCAATGGAGCTTGG - Intergenic
964274443 3:154994472-154994494 GTAAATGCAGCTATGAGGCTTGG + Intergenic
964322554 3:155513421-155513443 GGAAATGCAACCATAAGGCTTGG - Intronic
964346258 3:155757450-155757472 AAAAATACAAAAATGTAGCTGGG + Intergenic
966072596 3:175896686-175896708 GATAATGCAATAATGATGCAGGG - Intergenic
966367540 3:179206216-179206238 GAAAATACAAAAAATAAGCTGGG - Intronic
966571539 3:181449502-181449524 GAAAATACAAAAAATAAGCTGGG + Intergenic
966719778 3:183050541-183050563 AAAAATGCAAAAAAGTAGCTGGG + Intronic
967666263 3:192175838-192175860 GAGTATGAAACTATGAAGCTGGG - Intronic
967707563 3:192669424-192669446 GAAAATACAAAAATTTAGCTGGG + Intronic
967812159 3:193769506-193769528 GAAAATCACACAATGAAGTTAGG - Intergenic
968321321 3:197771479-197771501 GAAAATGCAAAAATTAGGCCGGG + Intronic
968680418 4:1915077-1915099 AAAAATTCAACAAGAAAGCTTGG - Intronic
969708028 4:8823290-8823312 AAAAATACAAAAATTAAGCTGGG + Intergenic
970518061 4:16853676-16853698 GAAAATGCTGCAATGAACATGGG - Intronic
970588309 4:17535540-17535562 GAAAATGAAACAATGCATGTGGG - Intergenic
971046716 4:22813298-22813320 AAAAATGCAACATTGATCCTTGG + Intergenic
971208914 4:24597380-24597402 GAAAAAGAAAAAATGAAGCAGGG - Intergenic
971248711 4:24953375-24953397 GAAAAGACAAAAATGAAGCAGGG - Intronic
971905322 4:32717153-32717175 AAAAATGCAAAAAAGTAGCTGGG - Intergenic
972167959 4:36310648-36310670 AAAAAAGAACCAATGAAGCTTGG - Intronic
974664390 4:64938838-64938860 AAAAATGCTACAATGAATATGGG - Intergenic
975162546 4:71140258-71140280 GAAAATACAACAAATTAGCTGGG + Intergenic
975694139 4:76994932-76994954 TAAAATGGAACATTGAAGCTGGG + Intronic
975798168 4:78031473-78031495 GAATATGAAACTATGAAGATGGG + Intergenic
976437252 4:85032441-85032463 CAAAATGCACAAATGAAGCAAGG + Intergenic
976822407 4:89221259-89221281 GAAAAAGCAACAGTGCAGCAAGG - Intergenic
977096172 4:92747899-92747921 GAAATTGCATCAGTGAAGTTTGG - Intronic
977830112 4:101580214-101580236 AACAATGCAACAATGCAGCAAGG - Intronic
978160985 4:105547801-105547823 GAAAATGCATCAAAGAAAGTAGG - Intergenic
978287096 4:107092291-107092313 GTAAATGAAACAACAAAGCTTGG + Intronic
979072776 4:116231396-116231418 GGAAATGCAAGAAAGAAGCAAGG + Intergenic
979303855 4:119119766-119119788 GACAATTCAATAATTAAGCTAGG + Intergenic
980275161 4:130641563-130641585 CAAATTACAACAAAGAAGCTGGG + Intergenic
980340773 4:131543054-131543076 GAAAATGCATAAATCAATCTAGG - Intergenic
980919704 4:139070914-139070936 TAAAATGCAAAAATAAAGGTGGG - Intronic
982008271 4:151083420-151083442 AAAAATACAAAAATGTAGCTGGG + Intergenic
982201647 4:152967264-152967286 AAAAATACAAAAATTAAGCTGGG + Intronic
982602959 4:157474898-157474920 CAAAATGCAACAAGGCAGCAAGG - Intergenic
984416734 4:179470199-179470221 AAAAATGCAAAAATTTAGCTGGG - Intergenic
984739270 4:183143645-183143667 AAAAATGCAAAAATTTAGCTGGG + Intronic
984890505 4:184488345-184488367 GATAATTAAACTATGAAGCTGGG - Intergenic
985320329 4:188703439-188703461 GAAAATGCAACAATGCATGCTGG - Intergenic
988069149 5:26265118-26265140 AAAAATGCAAAAAATAAGCTGGG - Intergenic
988792485 5:34621351-34621373 GAAAATACAGAAATGAGGCTGGG - Intergenic
989350669 5:40482547-40482569 GAAAATGGACCTATGAAGTTGGG + Intergenic
989451307 5:41589263-41589285 GAAAAGGCAAAAAAGAAGCATGG - Intergenic
989802191 5:45556570-45556592 GAAAATGGAAGAAGGAATCTAGG - Intronic
990722963 5:58718772-58718794 GAATATGCATAAATGAAGCCAGG + Intronic
991284648 5:64958792-64958814 TAACATGAAGCAATGAAGCTAGG + Intronic
991622921 5:68565135-68565157 AAAAATGAAACAATGAAGCTAGG + Intergenic
994735100 5:103543945-103543967 GAAAATGCAACTGACAAGCTAGG - Intergenic
994754503 5:103778181-103778203 GAAAATGCAAAAAATTAGCTGGG + Intergenic
994777048 5:104048518-104048540 CAAAATACAACAATGAAACAGGG + Intergenic
995678433 5:114689918-114689940 ATAAATGGAACAATGAAGCCTGG - Intergenic
996502226 5:124230048-124230070 GAAAAGGCAACATTGGAGCAGGG - Intergenic
996517628 5:124390402-124390424 GTAAATGGAACAACAAAGCTTGG - Intergenic
997494504 5:134310644-134310666 GAAAATGCAAAAACTTAGCTGGG - Intronic
998541300 5:142984040-142984062 TAAAAAGACACAATGAAGCTGGG - Intronic
998547783 5:143045836-143045858 GAAAATACAAAAATTAGGCTGGG + Intronic
998767613 5:145505699-145505721 AATAATGCAACAATGAACATGGG - Intronic
999685778 5:154101788-154101810 GAAAATACAAAAAAAAAGCTGGG + Intronic
1000149622 5:158486746-158486768 GAGAATCCAACAATAAATCTTGG + Intergenic
1001182992 5:169538322-169538344 GAAAATGAAACTATTAAGGTGGG + Intergenic
1002552923 5:180010518-180010540 AAAAATACAAAAATGTAGCTGGG - Intronic
1003163213 6:3653742-3653764 GCAAAAGCAACAAGGAAGATAGG + Intergenic
1003309413 6:4956442-4956464 GGAAATACAACAATAAAGATAGG + Intergenic
1003985860 6:11434595-11434617 AAAAATGCAAAAATTTAGCTGGG - Intergenic
1005007525 6:21303730-21303752 AAAAATCCAAAAATGAAACTGGG + Intergenic
1005094404 6:22098108-22098130 GAAAAATGAACAATGAAACTGGG - Intergenic
1005368334 6:25102681-25102703 GAAAATGCAAAAAATTAGCTGGG + Intergenic
1005903857 6:30243339-30243361 AAAAATACAAAAATGAAGCCGGG + Intergenic
1006445856 6:34079448-34079470 CTGAATGCAACGATGAAGCTGGG - Intronic
1008916472 6:56792906-56792928 AAAAATACAAAAATGTAGCTAGG + Intronic
1010554528 6:77262738-77262760 GAAAATGCACTAGGGAAGCTGGG - Intergenic
1011377049 6:86700077-86700099 GAAGATGCGACAATTATGCTGGG - Intergenic
1012402305 6:98851866-98851888 AATAATGCAACAATGAACATGGG - Intergenic
1012455157 6:99395304-99395326 GAAAATACAAAAATTAAGCCGGG - Intergenic
1012695757 6:102381278-102381300 GAAAATCCTACAATGAAATTGGG + Intergenic
1012849890 6:104433970-104433992 GAAAATGCTAAAATGAAGAATGG + Intergenic
1012965026 6:105664703-105664725 GTAAATGGAACAACAAAGCTTGG - Intergenic
1013459290 6:110359291-110359313 GAAAATGCAAGAGTAAAGCAAGG - Intergenic
1013970410 6:116011495-116011517 GAAAATGCAGAAAGGAAACTGGG + Intronic
1014136699 6:117897717-117897739 GAAAATGCAATCAGGAACCTAGG + Intergenic
1014294067 6:119596525-119596547 GTAAATGGAACAACGAAGCCTGG - Intergenic
1014646708 6:123982854-123982876 GCAAAAGAAACAATGAAGTTGGG + Intronic
1015728169 6:136320817-136320839 GAATATACCACAATGGAGCTGGG - Intergenic
1016864513 6:148751688-148751710 GCAAATGCTACACTTAAGCTTGG + Intronic
1017495021 6:154976090-154976112 GAAAATACAAAAAATAAGCTGGG + Intronic
1017549180 6:155486641-155486663 AAAAATGAAACAATGAACATAGG + Intergenic
1017723934 6:157263839-157263861 GAAGATGCAAAATGGAAGCTTGG - Intergenic
1018023346 6:159783992-159784014 CAAAAAACAAAAATGAAGCTTGG - Exonic
1018142659 6:160855012-160855034 GAAAATACAACAATGACCCTGGG - Intergenic
1018675906 6:166222334-166222356 AAAAATACAAAAATTAAGCTGGG - Intergenic
1019647638 7:2139532-2139554 GAAAATACAACACTCATGCTGGG + Intronic
1019774354 7:2903681-2903703 GACAATGCCACAACGATGCTTGG - Intergenic
1019987432 7:4667976-4667998 TAAAAAACAAAAATGAAGCTCGG + Intergenic
1020205615 7:6113062-6113084 AAAAATACAAAAATGTAGCTGGG - Intronic
1020664877 7:11027754-11027776 GAAAATCCAACAAAAAATCTAGG - Intronic
1020847550 7:13306423-13306445 GAAAATACAAAAATATAGCTGGG + Intergenic
1022470471 7:30679018-30679040 GAGAAAGAAACAATGAGGCTGGG - Intronic
1023032080 7:36098657-36098679 CAAAATGCAAAAATGAACCCTGG + Intergenic
1023102233 7:36729770-36729792 GAAAAAGCAACAGAGCAGCTGGG - Intergenic
1023691676 7:42795628-42795650 CAAAAAACAAAAATGAAGCTTGG + Intergenic
1024323748 7:48092861-48092883 AAAAATGCAAAAAAGTAGCTGGG - Intronic
1025059954 7:55797671-55797693 AAAAATGAAAGAATGCAGCTGGG + Intronic
1025760764 7:64388947-64388969 CAAAATGTGACGATGAAGCTCGG + Intergenic
1025934643 7:66025520-66025542 GAAAATACAAAAAAAAAGCTGGG + Intergenic
1026621032 7:71950106-71950128 CAAAATGCACAAATGAAGCAAGG - Intronic
1026993824 7:74603138-74603160 GAAAATGCAAAAATGAGGCCGGG + Intergenic
1028594298 7:92530919-92530941 AAAAATACAAAAATCAAGCTGGG + Intronic
1028598391 7:92572556-92572578 GAAAATACAAAAAAGTAGCTGGG + Intronic
1029180174 7:98694907-98694929 GAAAAGGTGGCAATGAAGCTGGG + Intergenic
1029378428 7:100196630-100196652 AAAAATACAAAAAGGAAGCTGGG + Intronic
1029643440 7:101836148-101836170 CAAAATGCAACAATGCAGGGAGG - Intronic
1030379516 7:108796358-108796380 AAAAATGCAAAAAAGTAGCTGGG + Intergenic
1030521482 7:110603358-110603380 GAAAATGCAATAATAAGGCCGGG - Intergenic
1030812931 7:113997625-113997647 GATAATGCTACAATGAACATGGG - Intronic
1031658656 7:124392451-124392473 GAAAATGAGGCAATGAAGGTGGG + Intergenic
1032034765 7:128513659-128513681 AAAAATGCAAAAATTAGGCTGGG - Intergenic
1032059285 7:128710544-128710566 GAATATGACACAATAAAGCTGGG - Intronic
1032184460 7:129712272-129712294 GAAGATGCAACAGTGAAGGAAGG + Intronic
1032837800 7:135690018-135690040 AAAAATACAAAAATTAAGCTGGG + Intronic
1032902871 7:136330950-136330972 AAAAATGTAAAAATTAAGCTGGG - Intergenic
1033214780 7:139485213-139485235 AAAAAAGCAAAAATTAAGCTGGG + Intergenic
1033386451 7:140881159-140881181 GTAAATGGAACAATGAAGCCTGG - Intronic
1033388545 7:140903351-140903373 GTAAATGGAACAATGAAGCCTGG + Intronic
1033459770 7:141535502-141535524 GAAAATGGAACAGACAAGCTTGG - Intergenic
1035013667 7:155743944-155743966 CAAACTGCAAAAATGAAGGTGGG - Intronic
1035131148 7:156654798-156654820 GAAACTGGAAAAAGGAAGCTTGG - Intronic
1035433913 7:158843553-158843575 AAAAATACAAAAATGAGGCTGGG - Intergenic
1036039878 8:5064732-5064754 TAAAATACAACAATAAAGCCAGG + Intergenic
1037258500 8:16981698-16981720 GAAAAGGCAACATTCAAGTTGGG - Intergenic
1037450255 8:19009728-19009750 AAAAATACAAAAATTAAGCTGGG + Intronic
1037900035 8:22682763-22682785 GAAATTACAACAATGAACTTTGG + Intergenic
1038410865 8:27358704-27358726 GAAAAGGCAAAGATGAAGCATGG - Intronic
1038676029 8:29623798-29623820 GAAAATGTAACAATAAATCCAGG + Intergenic
1038733169 8:30145695-30145717 AAAAATGCAAAAATTTAGCTGGG + Intronic
1038766935 8:30437493-30437515 AAAAATGCAAAAATTAGGCTGGG + Intronic
1040620852 8:49090943-49090965 AAAAATGCAAAAAAGTAGCTGGG + Intergenic
1040640454 8:49328437-49328459 AAAAATACAAAAATTAAGCTGGG - Intergenic
1040744339 8:50621665-50621687 GATAATGCATTAATGAGGCTTGG - Intronic
1040769676 8:50958146-50958168 AAAAATGGAACAAAGAAGATGGG - Intergenic
1040795842 8:51289363-51289385 TAAAATGCACCAATCAGGCTGGG - Intergenic
1040943637 8:52858172-52858194 AAAAATACAAAAATGTAGCTGGG - Intergenic
1041888499 8:62841753-62841775 GATAATGCTGCAATGAACCTGGG + Intronic
1042520300 8:69704439-69704461 AAAAATGGAACAATATAGCTTGG - Intronic
1043068917 8:75613208-75613230 GAAAATGCAAGTTTGGAGCTTGG + Intergenic
1043300300 8:78721555-78721577 GAATTTGCAACAGTGAGGCTGGG + Intronic
1043545586 8:81312162-81312184 CAAAGTGCAAAAATGAAGCAGGG + Intergenic
1046252402 8:111649930-111649952 GAAAACTCAACAATGGAGATTGG - Intergenic
1046316731 8:112512576-112512598 ATAAATGGAACAATTAAGCTTGG - Intronic
1046611204 8:116427631-116427653 GAAAAGGCAGCAATAAAGCAAGG + Intergenic
1047624062 8:126637471-126637493 GAAAATGCAAAAAATTAGCTGGG - Intergenic
1047950689 8:129932157-129932179 GAAAATGCAAAAAATTAGCTGGG - Intronic
1048004007 8:130403711-130403733 AAAAATGCAAAAAAGTAGCTGGG - Intronic
1048151916 8:131902884-131902906 GAAAATGCAAAAATTAGGCGGGG - Intergenic
1048557441 8:135494437-135494459 AAAAATGCAAAAAAGTAGCTGGG - Intronic
1050513428 9:6417198-6417220 GGAACTGCAACAATGATGCAAGG - Intronic
1051511236 9:17880205-17880227 GAACATGAAATAATGAATCTAGG + Intergenic
1051677191 9:19570363-19570385 GAAGAGGCAACATTCAAGCTGGG - Intronic
1051936519 9:22447956-22447978 GATAATGAAAAAATGAAGCATGG + Intronic
1052526168 9:29622215-29622237 AAAAATGCAACATTGAATCCTGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053935255 9:43143569-43143591 AAAAATACAAAAATTAAGCTGGG + Intergenic
1054298385 9:63350736-63350758 AAAAATACAAAAATTAAGCTGGG + Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058427776 9:104890418-104890440 GAAAATACAAAAAAGTAGCTGGG + Intronic
1058745008 9:107981911-107981933 GAAAATGCATGGATGAGGCTGGG - Intergenic
1059333679 9:113554464-113554486 AAAAATACAAAAATGTAGCTGGG - Intronic
1059844342 9:118256108-118256130 ATAAATGGAACAATGAAGCATGG + Intergenic
1060316578 9:122516846-122516868 GAAACAGCAATAATGAAGTTGGG - Intergenic
1060537725 9:124404550-124404572 AAAAATGCTCCAATGAGGCTGGG + Intronic
1060662472 9:125412413-125412435 GAAAATGAGAGAATGGAGCTGGG + Intergenic
1061580321 9:131531962-131531984 AAAAATGCAACAAATCAGCTGGG + Intergenic
1061857508 9:133450271-133450293 AAAAATACAACAATTAGGCTGGG + Intronic
1061976827 9:134072656-134072678 GAAAAATCAAAAATGTAGCTGGG + Intergenic
1062677375 9:137754816-137754838 CAACATTCAACAATGAAGTTGGG - Intronic
1203619833 Un_KI270749v1:114955-114977 AAAAAATCAACAATGAGGCTGGG + Intergenic
1185452857 X:292004-292026 AAAAATACAACAATTAGGCTGGG + Intronic
1185517095 X:708259-708281 GAAAATGGAGGAATGAAGGTAGG - Intergenic
1185626368 X:1485296-1485318 TAAAATTCAAAAATGTAGCTGGG - Intronic
1185663255 X:1743753-1743775 AAGAACACAACAATGAAGCTGGG - Intergenic
1185684832 X:1919648-1919670 GAAAATGCAAAAAATTAGCTGGG + Intergenic
1185686519 X:1933388-1933410 AAAAATGCAAAAAAGTAGCTGGG + Intergenic
1185781771 X:2854090-2854112 GAGAGTCCAACAGTGAAGCTTGG - Exonic
1188010406 X:25049261-25049283 GAAAATGCAAGAAGGAAAGTTGG + Intergenic
1188194570 X:27217033-27217055 GAAGATGGAAGACTGAAGCTTGG + Intergenic
1188461829 X:30436120-30436142 GAAAAGGCCACAATCCAGCTTGG - Intergenic
1189713464 X:43840285-43840307 GAAAATGCTACAGTGAGGGTGGG - Intronic
1189821794 X:44875188-44875210 TCAACTGCAACAATAAAGCTAGG - Intronic
1190124454 X:47691429-47691451 AAAAATGCTACAATGAACATGGG + Intergenic
1190154836 X:47981737-47981759 AAAAATACAAAAATGTAGCTGGG + Intronic
1190715757 X:53101836-53101858 AAAAATACAAAAATTAAGCTGGG + Intergenic
1190757511 X:53413662-53413684 GAAAAGGACAAAATGAAGCTTGG + Intronic
1191798351 X:65048355-65048377 AATAATGCTACAATGAAGATAGG + Intergenic
1192792538 X:74397214-74397236 GATTCTCCAACAATGAAGCTTGG + Intergenic
1192991002 X:76456051-76456073 TAAAATGCAAAAATGAAGTGAGG - Intergenic
1193252705 X:79310534-79310556 TAAAATAAAACAATGAAGCATGG + Intergenic
1194444959 X:93975952-93975974 AACAATGCAGCACTGAAGCTGGG - Intergenic
1194718055 X:97309420-97309442 GAGAATGCATCAATGAAAATTGG - Intronic
1196794490 X:119491214-119491236 AAAAATACAAAAATGTAGCTGGG - Intergenic
1196971550 X:121114989-121115011 GTAAATGAAACAACAAAGCTGGG - Intergenic
1197114118 X:122811878-122811900 GTAAATGGAACAACAAAGCTTGG + Intergenic
1198030580 X:132750074-132750096 GAAACTTCAAGAAGGAAGCTGGG - Intronic
1198542964 X:137660002-137660024 TAAAATGGAACAATAAAGCATGG + Intergenic
1198621290 X:138513371-138513393 GTAAGTGTAACAATGAAGCCTGG - Intergenic
1200315694 X:155131039-155131061 GAAAATTCAACAATGACTGTTGG + Intronic
1201330867 Y:12819395-12819417 AAAAATGCAAAAATTAAGCATGG + Intronic
1201355579 Y:13093918-13093940 GAAAATGCACAAATAAAGCAAGG + Intergenic