ID: 929898534

View in Genome Browser
Species Human (GRCh38)
Location 2:45982283-45982305
Sequence CACAGGCATCACATTAAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 115}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929898534 Original CRISPR CACAGGCATCACATTAAAGG TGG (reversed) Intronic
903410996 1:23142655-23142677 CACAGGCATCCAATAAATGGTGG + Intronic
906180601 1:43815154-43815176 CACAGGCAGCTCATTATAGAAGG + Intronic
908324706 1:63012447-63012469 CACAGGGATCACATTTACGAAGG - Intergenic
910171684 1:84384824-84384846 CACAGGCATCTTATTGAAGAAGG + Intronic
910264044 1:85320023-85320045 CACAGGCAATACAGGAAAGGTGG + Exonic
910583828 1:88857216-88857238 CACAGGCATCAGCTGAAAAGAGG - Exonic
911974193 1:104471057-104471079 CAGAGGCAGCATAGTAAAGGTGG - Intergenic
913262597 1:117013293-117013315 CACAGGGATCACATTTTATGTGG - Intronic
914938337 1:152000346-152000368 CACAGGCCTTACATTATAGTGGG + Intergenic
915119743 1:153621999-153622021 CACAGGCATCGCATGAAGTGTGG + Intronic
918100788 1:181372023-181372045 CAAAGGCATCACATTACCTGAGG - Intergenic
921211743 1:212906650-212906672 CAAAGGCCTCTAATTAAAGGAGG + Intergenic
924315788 1:242795103-242795125 AACAGGCATCTCATCAAAGGAGG - Intergenic
1063507885 10:6618173-6618195 CACATGTGTCACATTAAAGAAGG + Intergenic
1069825564 10:71253239-71253261 CACAGCCCTGCCATTAAAGGGGG + Intronic
1074272399 10:111967620-111967642 AAATGGCATCACATTATAGGTGG - Intergenic
1078464264 11:11538818-11538840 CACAGCCATGAAGTTAAAGGAGG - Intronic
1078512004 11:11991632-11991654 CACAGGCATCACATTGTGAGAGG - Intronic
1080174657 11:29347825-29347847 CACAGGCACCACACCAAAAGAGG - Intergenic
1083249152 11:61454146-61454168 GACAAGCATCAGGTTAAAGGTGG + Intronic
1084755323 11:71234815-71234837 CACAGGCACCCCATGAACGGAGG + Intronic
1087408596 11:97762041-97762063 GACAGAGATGACATTAAAGGTGG + Intergenic
1096123188 12:49101975-49101997 CACAGGCAGGACATAAAAGTAGG + Intronic
1099267765 12:80469048-80469070 CACATGCATCACATGAAATGTGG - Intronic
1099789890 12:87320065-87320087 CACTGGAATCACATGAAATGGGG + Intergenic
1100288656 12:93192314-93192336 CACGGGCATCACATGGGAGGAGG + Intergenic
1101708127 12:107239983-107240005 GACAGTCATCAGAGTAAAGGAGG + Intergenic
1105412733 13:20184866-20184888 ATCAGGCTTCACATTGAAGGAGG - Intergenic
1109406613 13:61908648-61908670 CACGGGCATCAAATAAAAAGTGG + Intergenic
1112298939 13:98213091-98213113 CACAGGAATCACATATAGGGAGG - Intronic
1115043957 14:28966818-28966840 CACAGGTATCACATTAGATGTGG + Intergenic
1115189137 14:30728184-30728206 AAAAGGCATGAAATTAAAGGGGG - Intronic
1119157094 14:72421462-72421484 CAAAGGCATCACGTTAGAGCTGG - Intronic
1121922706 14:97897823-97897845 CACAGGAACCACATCGAAGGTGG - Intergenic
1121998517 14:98626376-98626398 CACAGGCATCCCCTAAAAGCTGG + Intergenic
1124580237 15:30946852-30946874 CAAAAGCATGACATTTAAGGTGG + Intronic
1126195162 15:45923142-45923164 AACAGGTATCACAGTAATGGTGG - Intergenic
1127974673 15:63988285-63988307 CCCAGGACTCACATTAAAAGGGG + Intronic
1130067915 15:80620382-80620404 CACAAGCATCACTTTCAAGGTGG - Intergenic
1138839659 16:60484487-60484509 AACAGGCATCACACAAAAGGAGG - Intergenic
1139835629 16:69836423-69836445 CACATGCTTCACATGAAAGAGGG - Intronic
1140528023 16:75640187-75640209 GACTGACATCACCTTAAAGGTGG - Exonic
1141238325 16:82241560-82241582 CACAGACATCACATGAAAGCAGG - Intergenic
1141827909 16:86493900-86493922 TACAGGCTTCACATTAACGTCGG + Intergenic
1147999879 17:44381420-44381442 CACAAGAATCACTTTAACGGGGG - Intronic
1154149830 18:11897768-11897790 CAAAAGCAACACATTACAGGCGG - Intronic
1158026845 18:52908808-52908830 TAAAGGCATCACATCAAATGAGG + Intronic
1162606205 19:11710021-11710043 CTCAGACATCACGTTAAAGAAGG + Intergenic
1162827482 19:13262632-13262654 CAAGGACAACACATTAAAGGAGG - Intronic
929132856 2:38595532-38595554 CACAGTCATCACTTAAAAGCTGG + Intronic
929898534 2:45982283-45982305 CACAGGCATCACATTAAAGGTGG - Intronic
931989794 2:67778816-67778838 AAAAGGCAGCAAATTAAAGGGGG + Intergenic
932000501 2:67880278-67880300 TACTGGCAGCACATTAAATGAGG - Intergenic
932972812 2:76566672-76566694 CAGAGCCATCACAATAAAGATGG - Intergenic
938562114 2:132482354-132482376 AAAAGGCATCTCACTAAAGGAGG - Intronic
940739022 2:157485775-157485797 CCAAGGCATCACAATAGAGGAGG - Intronic
941446593 2:165608693-165608715 CAAAGGGATCACATTAATGGTGG - Intronic
941617734 2:167740399-167740421 CAAAGACATCTCATTAAAGGTGG - Intergenic
942909893 2:181230595-181230617 AACAGGCATGATGTTAAAGGAGG + Intergenic
943260046 2:185647981-185648003 CACAGGCATCACAATGCAAGGGG + Intergenic
943927933 2:193811949-193811971 TACAGGGATCACATTGATGGCGG + Intergenic
946391811 2:219420702-219420724 CACAGGCAGCACATCCAAGCTGG - Intronic
1168898746 20:1342071-1342093 CTCAGCCATCAGATTAAAAGTGG - Intronic
1169084708 20:2819502-2819524 CACAGGCATCACCTGGAAGCTGG + Intronic
1172491334 20:35340898-35340920 CAAAGGCATTACATTTTAGGAGG - Intronic
1174929744 20:54800004-54800026 CACAGACATCACATTACTGCTGG - Intergenic
1175582707 20:60112851-60112873 CACTGGCATTACATTCAAGGAGG - Intergenic
1180121312 21:45750322-45750344 TACAGCCATCACAGTAAAGACGG - Intronic
1182025077 22:27111463-27111485 CACAGGCAGCACTGTAATGGAGG + Intergenic
949887410 3:8707246-8707268 CAAAGTCATCACATAAAATGTGG + Intronic
952338355 3:32424353-32424375 CACTTCCATCACATTACAGGCGG + Intronic
954201684 3:49026990-49027012 TGCAGGCATCACACTGAAGGAGG - Exonic
954340247 3:49947766-49947788 CACATGCATAACAATAAAGTGGG - Intronic
954835132 3:53459959-53459981 CACAGTCATCAAATTAAAATAGG + Intergenic
955042795 3:55333331-55333353 CACAGGCTGCAGATTAAGGGCGG + Intergenic
960464960 3:117986314-117986336 CAGAGGCAGCACAGTAAAGAAGG + Intergenic
962041855 3:131715783-131715805 TAAATGCATCACATTAAAGAAGG + Intronic
968709790 4:2105404-2105426 AACAGGCATCCAGTTAAAGGTGG + Intronic
972262757 4:37427106-37427128 GACAGGCAGCACATTAAATATGG - Intronic
978887818 4:113786042-113786064 CAGAAGCATCACATTAAACCTGG + Intergenic
982795577 4:159639900-159639922 ATCAGGCATCACATTGATGGTGG - Intergenic
985860818 5:2469228-2469250 CACAGGCACCAAATTAAAATCGG + Intergenic
986438363 5:7757550-7757572 CACAGCCATCATATTAATGATGG + Exonic
990115382 5:52383492-52383514 CACAAACATCACATTTAAGGGGG - Intergenic
991068077 5:62445362-62445384 AACATGCATAAAATTAAAGGTGG + Intronic
992290966 5:75279567-75279589 CACAAGCATCACAGAAAAGGAGG + Intergenic
999123656 5:149229997-149230019 CAGAGCTATCACATTTAAGGGGG - Intronic
999277523 5:150341282-150341304 CACTGGCTTCACATTAGAGCAGG + Intergenic
1000116731 5:158160765-158160787 CACAGCAACCACATTAGAGGCGG + Intergenic
1000909496 5:167005093-167005115 CACAGACATCTAATTAAATGGGG - Intergenic
1001409215 5:171498360-171498382 CTCAGCCATGAAATTAAAGGCGG + Intergenic
1003605276 6:7554138-7554160 GACAGGCATCAGATAAAAGCAGG + Intronic
1005977487 6:30811163-30811185 CACAGGAATCACTTTCATGGAGG - Intergenic
1007409254 6:41652338-41652360 CACAGGGACCACACTACAGGGGG + Intronic
1009857604 6:69284524-69284546 CAAAGGCATCACATAAAATTGGG + Intronic
1009886613 6:69631103-69631125 TAGAGGCCACACATTAAAGGTGG + Intergenic
1011492761 6:87909620-87909642 GACAGGCATCAAATGAAATGAGG - Intergenic
1012112456 6:95254237-95254259 GAGAGGCATCACATTAGCGGAGG + Intergenic
1012487253 6:99736033-99736055 CACAGGCATTTGATTAAAGATGG - Intergenic
1017501776 6:155032412-155032434 CACAAGCATCACATCAAACGGGG + Intronic
1018768094 6:166949882-166949904 CACAAGCATCTCATCAGAGGGGG + Intronic
1021159894 7:17259859-17259881 CACAGGAGGCAGATTAAAGGAGG + Intergenic
1022533920 7:31084193-31084215 CACAGGCATCAAAGTAATGAGGG - Exonic
1023410959 7:39888726-39888748 CACAGGCCTCTCATTAATGTTGG + Intergenic
1030711881 7:112759153-112759175 CTTAGGCATCAAATTCAAGGGGG + Intergenic
1041650729 8:60299663-60299685 CACAGGCATCACCTGAGAAGTGG + Intergenic
1043692928 8:83180015-83180037 GACAGGGAACACATTAAAGTTGG - Intergenic
1044270298 8:90234726-90234748 AACAGGAATGACATTAAAGAAGG + Intergenic
1047303946 8:123638165-123638187 GTCAGACATCACATTAAATGTGG - Intergenic
1048785106 8:138042142-138042164 CACAGAAATCACCTTCAAGGGGG + Intergenic
1050253913 9:3774273-3774295 CACAGGCATCACTATAAGGTAGG + Intergenic
1050322376 9:4466473-4466495 CAAAGGCATCACAAGAAAGTAGG + Intergenic
1052027522 9:23590030-23590052 CACAGGAATTACGTCAAAGGTGG + Intergenic
1052719849 9:32161168-32161190 CACAGGCAATACATTAATGAAGG + Intergenic
1055146804 9:72945478-72945500 CACATGGATGACATTAAATGGGG - Intronic
1056067870 9:82955871-82955893 CAGAGGCCTCACATTCACGGTGG + Intergenic
1057893032 9:98883744-98883766 CACAAGGATCACATTCAAAGCGG - Intergenic
1058488444 9:105467203-105467225 CACAGGCACCTCATCAAAGGTGG - Intronic
1186924119 X:14313396-14313418 CAGAAGCATCACCTTATAGGAGG - Intergenic
1189556790 X:42153391-42153413 CACAGGAAACAAAGTAAAGGAGG - Intergenic
1190107821 X:47572113-47572135 CACAGACACCACAGCAAAGGTGG + Exonic
1193044908 X:77042485-77042507 CACAGGCAGAATATTAAAGCTGG + Intergenic
1193321843 X:80131950-80131972 AACATGAATCACATTAAAGAAGG + Intergenic
1195112413 X:101660808-101660830 TACAGCCATCAAATTACAGGAGG - Intergenic
1197270099 X:124415819-124415841 CACTGGCATCACATTGATGCAGG - Intronic
1198392803 X:136193481-136193503 AACTGGGATCCCATTAAAGGGGG + Intronic
1198469874 X:136936198-136936220 CTCAGACATCAGATTAAAGAAGG + Intergenic
1199916386 X:152346053-152346075 AACAGGCATCAAAATAAAGAAGG + Intronic
1201219414 Y:11753732-11753754 AACAGGCCTCTCATCAAAGGAGG - Intergenic