ID: 929904230

View in Genome Browser
Species Human (GRCh38)
Location 2:46032257-46032279
Sequence ATAGGCACAAACGATGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 85}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929904226_929904230 8 Left 929904226 2:46032226-46032248 CCTGGGATATCTTTCTTTGACAG 0: 1
1: 0
2: 1
3: 20
4: 202
Right 929904230 2:46032257-46032279 ATAGGCACAAACGATGAGCTGGG 0: 1
1: 0
2: 0
3: 4
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929904230 Original CRISPR ATAGGCACAAACGATGAGCT GGG Intronic
903563224 1:24244912-24244934 ACAGGCACAATGGAGGAGCTGGG + Intergenic
913088072 1:115457443-115457465 ATAGGCTCAAGAGAGGAGCTGGG + Intergenic
920963555 1:210684197-210684219 ATAGGCAGAAGGGCTGAGCTGGG - Intronic
923108323 1:230870903-230870925 AAAGGCACAACCTATGAGCCAGG + Intergenic
924021855 1:239791741-239791763 ATAGGCACAGACACTGAGATGGG + Intronic
1069257670 10:66354121-66354143 AAAGACACAAACAATTAGCTGGG + Intronic
1074811821 10:117112343-117112365 AGATGCATAAATGATGAGCTAGG - Intronic
1075489395 10:122853566-122853588 ATAGGCACAAACAAAGGGCATGG - Intronic
1077992535 11:7424785-7424807 GTATGCACAAAGGTTGAGCTTGG - Intronic
1087144302 11:94797077-94797099 ATAGGAAGAAAAGATGAACTTGG + Intronic
1094731310 12:33179501-33179523 ATAGACAGAAAGGATGAGGTTGG + Intergenic
1095358096 12:41301193-41301215 AGAGGCAGAAACGATGAGAAAGG + Intronic
1095998458 12:48109467-48109489 ATAGGAAAAAACCATCAGCTGGG - Intronic
1099038248 12:77617039-77617061 AAAGTCACAAAAGATGTGCTCGG - Intergenic
1101857168 12:108453271-108453293 AGAGGCACAAACAATGAGTGAGG - Intergenic
1111495356 13:89041870-89041892 ATAGGGACAAACAATCATCTTGG - Intergenic
1121857841 14:97286601-97286623 ATAGGCACCAATGATGTGCCAGG - Intergenic
1124427711 15:29576384-29576406 ATAGGCATAAACCGTGACCTTGG + Intergenic
1125275316 15:37983212-37983234 ATGGGCACTTACGATGTGCTAGG + Intergenic
1127702032 15:61510656-61510678 ATACTCCCAAAGGATGAGCTTGG - Intergenic
1129919121 15:79304204-79304226 ATATGCAAAAAAGATGAACTTGG - Intergenic
1137364644 16:47850002-47850024 ATAGGAACCACAGATGAGCTGGG - Intergenic
1138410394 16:56834924-56834946 ATGGGCCCAAATGATGACCTTGG + Intronic
1139121363 16:64022602-64022624 ATACGCACAAAAAATTAGCTGGG - Intergenic
1143728786 17:8868013-8868035 AGAGGGAGAAATGATGAGCTCGG - Intergenic
1144334387 17:14255917-14255939 ATAGGCCCAAACCTTGATCTTGG - Intergenic
1146593917 17:34153499-34153521 AGAGGGACAAAGGATGAGTTGGG + Intronic
1148141164 17:45329887-45329909 AAAGACACAAACAATTAGCTTGG + Intergenic
1150474208 17:65462066-65462088 ATGGGCACAAAGGATCAGTTTGG - Intergenic
1156400194 18:36732778-36732800 AGAGGAACAAAGGATGAGCAGGG + Intronic
1157321249 18:46636337-46636359 GTAGGCACAGAAGGTGAGCTGGG - Intronic
1160097865 18:75891619-75891641 CTAGGCACAGAAGATGAGCTAGG + Intergenic
1161814367 19:6490601-6490623 AAAGGCACAAAAAATTAGCTGGG - Intergenic
1164089821 19:21939668-21939690 ATAGGCACAGAATAAGAGCTTGG + Intronic
1164194139 19:22939578-22939600 ATAGGCACACAATAAGAGCTTGG + Intergenic
1168716677 19:58532705-58532727 AAAAACACAAACAATGAGCTGGG - Intronic
929904230 2:46032257-46032279 ATAGGCACAAACGATGAGCTGGG + Intronic
934767987 2:96891244-96891266 ATAATTACAAACGATGTGCTGGG + Intronic
942574703 2:177351091-177351113 AGAGACACACAAGATGAGCTAGG + Intronic
942574747 2:177351642-177351664 AGAGACACACAAGATGAGCTAGG + Intronic
942975951 2:182017440-182017462 ATAAGCAAAAACAATGAGCAAGG - Intronic
947010537 2:225561406-225561428 AAAGGCACAAAAGATGAAGTTGG + Intronic
947158493 2:227187734-227187756 GTAGGCAGAAACCATGAGCTAGG - Intronic
948155948 2:235781539-235781561 AAAGGCACAAATGAAGAGTTGGG + Intronic
1173256643 20:41398464-41398486 CTAAGCACAAATGATGAGCAAGG - Intergenic
1173901253 20:46591007-46591029 AAAGGCACAAAAAATTAGCTGGG + Intronic
1178384375 21:32137550-32137572 CTAGGCACTAACAGTGAGCTAGG + Intergenic
1178740609 21:35196842-35196864 ATAGGGAAAGATGATGAGCTTGG + Intronic
1180027130 21:45172503-45172525 TTACGCACAACCGATGATCTGGG + Intronic
1180979089 22:19870316-19870338 ATAGGCACACAGGATTGGCTGGG + Intergenic
949375700 3:3387641-3387663 ATAGGCACAAATGAAGAGAGGGG + Intergenic
955791542 3:62593322-62593344 ATATCCACAAACTATGAGCAGGG - Intronic
958089610 3:88859311-88859333 TTAGGCAAAACTGATGAGCTTGG - Intergenic
959932423 3:111999017-111999039 AAAGGCAGAAACGATGAGATCGG - Exonic
960142417 3:114163854-114163876 ATAGGCACCAAAGGTGAGATAGG + Intronic
962926723 3:140000390-140000412 ATGGGCACAAACTATGTGCCAGG - Intronic
966323550 3:178728862-178728884 ATAAGCACAAATGATGAAATAGG - Intronic
966523961 3:180901083-180901105 ATAGGCGTAAAATATGAGCTAGG + Intronic
966978089 3:185104179-185104201 ATGGACACAAAGGATGAGGTTGG - Intronic
967546461 3:190734900-190734922 AAAGGCACAAAAGTTGAGTTAGG + Intergenic
968527365 4:1068489-1068511 ATAAGCACAAAGGAAGAGCGAGG - Intronic
971316511 4:25572404-25572426 AAATGAACAAATGATGAGCTAGG + Intergenic
971581891 4:28352106-28352128 ATGGGCACTAAGGATGAGGTTGG - Intergenic
984938464 4:184910330-184910352 ATGGTCACAAACAAAGAGCTGGG - Intergenic
985043618 4:185917385-185917407 AAAAACACAAAAGATGAGCTAGG - Intronic
988711204 5:33777161-33777183 GTAGCCACATACGATGAGTTTGG - Intronic
990049507 5:51480122-51480144 ATAGGCACTAACCAAGAGCCTGG + Intergenic
992952897 5:81878315-81878337 TTACGCAAAAACTATGAGCTAGG + Intergenic
997440244 5:133904165-133904187 AGAGGCACACACGAGGTGCTGGG - Intergenic
999787621 5:154906137-154906159 ATAGGCACAAGCCATTATCTTGG + Intronic
1000581524 5:163040270-163040292 ACAGCCACAAACTATGAGTTGGG + Intergenic
1007303427 6:40886226-40886248 ATGAGCACACAGGATGAGCTAGG + Intergenic
1011418331 6:87145966-87145988 AGAGGTAGAAATGATGAGCTTGG + Intergenic
1011765262 6:90612518-90612540 CTAGGCAGCAACAATGAGCTAGG - Intergenic
1024543705 7:50499974-50499996 ATAGGCCCAAGGGATGAGCAAGG + Intronic
1034907060 7:154958670-154958692 ATAGGCAAAAAGGATAAACTGGG + Intronic
1036682021 8:10882089-10882111 AAAGGCACAACAGATGAGATGGG - Intergenic
1036720403 8:11169247-11169269 ATGGACACAAAGGGTGAGCTTGG - Intronic
1037813305 8:22099044-22099066 AGAGGCACACACGGTGAGCAGGG + Exonic
1038357051 8:26839317-26839339 AAAGACACAAAAAATGAGCTGGG - Intronic
1039025872 8:33257256-33257278 TTAGGCATACATGATGAGCTGGG - Intergenic
1039729290 8:40256958-40256980 ATAGCCACAAAGGGTGAGGTTGG + Intergenic
1041834800 8:62199366-62199388 ATAGAGACAAAAGATGAGCTTGG - Intergenic
1043992682 8:86775422-86775444 AAAGGCACAAATGCTGAGATTGG + Intergenic
1048641509 8:136368327-136368349 AAAGGCTCAAACCATGAGTTAGG - Intergenic
1050376705 9:4981862-4981884 ACAGGCTCAAACGAAGGGCTGGG - Intergenic
1052103795 9:24485927-24485949 AGAGGCACAAATGAAGGGCTAGG - Intergenic
1189997252 X:46650828-46650850 AAAGGCAGAAAGGATGATCTTGG + Intronic
1194128355 X:90048092-90048114 ATTGGCTGAAACGATGAGATTGG - Intergenic
1201974154 Y:19830313-19830335 GTAGACACAAAGGATGAGGTTGG + Intergenic