ID: 929910514

View in Genome Browser
Species Human (GRCh38)
Location 2:46085605-46085627
Sequence GAGGAAGACCTGAGTCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2911
Summary {0: 1, 1: 1, 2: 8, 3: 223, 4: 2678}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929910514_929910517 -5 Left 929910514 2:46085605-46085627 CCTCCCTGACTCAGGTCTTCCTC 0: 1
1: 1
2: 8
3: 223
4: 2678
Right 929910517 2:46085623-46085645 TCCTCTACCTGCCTCTTATAAGG 0: 1
1: 0
2: 12
3: 93
4: 445
929910514_929910521 27 Left 929910514 2:46085605-46085627 CCTCCCTGACTCAGGTCTTCCTC 0: 1
1: 1
2: 8
3: 223
4: 2678
Right 929910521 2:46085655-46085677 ATTGTATTTAAGACCCACGCTGG 0: 1
1: 0
2: 4
3: 11
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929910514 Original CRISPR GAGGAAGACCTGAGTCAGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr