ID: 929910953

View in Genome Browser
Species Human (GRCh38)
Location 2:46089182-46089204
Sequence TAGAATAAGAATGAGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 780
Summary {0: 1, 1: 0, 2: 5, 3: 52, 4: 722}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929910953_929910959 6 Left 929910953 2:46089182-46089204 CCTCCCTCCTCATTCTTATTCTA 0: 1
1: 0
2: 5
3: 52
4: 722
Right 929910959 2:46089211-46089233 GGGCAATTTCAACCTTCGCATGG 0: 1
1: 0
2: 0
3: 2
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929910953 Original CRISPR TAGAATAAGAATGAGGAGGG AGG (reversed) Intronic
900334797 1:2157157-2157179 GAGAACAAGAAGGAGGAGGAAGG - Intronic
901145828 1:7064110-7064132 GAGAAGAAGAAGGAGGAGGAGGG - Intronic
903388609 1:22946775-22946797 TTGAATAAGAATGGTGAGAGTGG - Intergenic
903557524 1:24204409-24204431 CAGACTCAGAATGAGGAGGAAGG - Intergenic
903864758 1:26389912-26389934 TAGGAGCAGAATGAGGAGGAAGG + Intergenic
904118094 1:28176942-28176964 GAGAGTGAGAAAGAGGAGGGAGG + Exonic
904295761 1:29518856-29518878 GAGAAGGAGAATGAGGAAGGAGG - Intergenic
905829167 1:41050477-41050499 TAGAATTAGAATTATGAAGGTGG - Intronic
906273924 1:44501940-44501962 GAGAAAAAGAAGGAGGAGGAAGG + Intronic
906581836 1:46941347-46941369 CAGAAGCAGAATGAGCAGGGAGG + Exonic
906601881 1:47137550-47137572 CAGAAGCAGAATGAGCAGGGAGG - Exonic
906758459 1:48346428-48346450 TTGAATAAGAGTGATGAGAGAGG - Intronic
906809296 1:48809878-48809900 CAGAATAAAACTGAGGAAGGAGG - Intronic
907342069 1:53742296-53742318 TAGGAGAAGGATGAGGATGGAGG - Intergenic
907696234 1:56731938-56731960 TTGAATAAGAATGGAGAGAGTGG - Intronic
907770604 1:57459787-57459809 AAGAATGAGAAAGAGGAGAGAGG - Intronic
908698155 1:66868509-66868531 TAGAATTAGAAGGTGGAGGAAGG + Intronic
908743578 1:67354113-67354135 TAGAATAAGCATGAGGTAAGAGG + Intronic
908752672 1:67439597-67439619 TAGGAAGAGAATGAGGAGGCTGG - Intergenic
909253658 1:73390568-73390590 TAGAAGAAGAAGGAGGAAGGAGG - Intergenic
909492818 1:76244485-76244507 TTGAATAGGAATGATGAGAGAGG + Intronic
910308076 1:85789588-85789610 TTGAATAGGAGTGAGGAGAGGGG + Intronic
910490418 1:87763469-87763491 GAGAAAAAGAAGGAGAAGGGGGG + Intergenic
910620385 1:89247252-89247274 TTGAATAAGAGTGATGAGCGTGG - Intergenic
911078655 1:93906746-93906768 TATTATAAGAATGAAGAGAGCGG - Intronic
911358200 1:96846644-96846666 TGGAATAGGGATGGGGAGGGAGG + Intergenic
911389757 1:97226341-97226363 TGGAGTAAAAATGAGGAGAGTGG - Intronic
912547904 1:110464617-110464639 TAGAAAAAGCATAAGGAGAGTGG + Intergenic
912558720 1:110535023-110535045 AAGAATAATAATGATGATGGTGG - Intergenic
913079915 1:115374063-115374085 AAGAATTAGAATGAGGAGGTGGG - Intergenic
913182407 1:116334876-116334898 CAGCATAAGAATGAAGAGGAGGG + Intergenic
913963694 1:143357590-143357612 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
914261838 1:146005457-146005479 TAGAATAAGAAACAGGAGACAGG - Intergenic
914344631 1:146788050-146788072 TAGAGTCAGAATGAGGTAGGAGG - Intergenic
915271324 1:154755817-154755839 AAGAAGAAGAAGGAGGAGGAGGG + Intronic
915710043 1:157887522-157887544 TTGAATAAGAATGATTAGGGTGG - Intronic
915749100 1:158187856-158187878 GAGCACAAGAATGGGGAGGGAGG - Intergenic
915816080 1:158966815-158966837 TTGAATAGGAATGGTGAGGGAGG - Intronic
915832177 1:159141448-159141470 TACAGAAAGAATGAAGAGGGAGG + Intronic
916169321 1:161988724-161988746 TGCAGGAAGAATGAGGAGGGAGG - Intronic
916616378 1:166445534-166445556 TAGAAGAAGAAGAAGGAAGGAGG + Intergenic
916636846 1:166680051-166680073 GAGACTGAGAAGGAGGAGGGAGG - Intergenic
917247661 1:173022229-173022251 TAGAACAAAAAGGAGGAGGAAGG - Intergenic
917801770 1:178577865-178577887 TATAATAAAAGTGAGGATGGTGG + Intergenic
918179499 1:182074127-182074149 AAGAAGAAGGAGGAGGAGGGTGG + Intergenic
918246340 1:182662939-182662961 TAGATTGAGAATGGGGAGGGGGG + Intronic
918337767 1:183537468-183537490 AATAGTAAGAATGAGGAGGAAGG - Intronic
918604048 1:186400284-186400306 AATAATAAGAATGGGGAGGCCGG - Intronic
919295571 1:195695322-195695344 TTGAATAAGAGTGATGAGAGTGG + Intergenic
919764857 1:201120438-201120460 GAGTATAAGGCTGAGGAGGGTGG - Intronic
920770323 1:208878609-208878631 TATATTGAGAATGGGGAGGGTGG - Intergenic
920884006 1:209908824-209908846 TAGATAAAGAATGAGGAGATGGG - Intergenic
921259887 1:213376904-213376926 GAGAAGAAGAATGAGGTGGAGGG + Intergenic
921390811 1:214611660-214611682 TACAATAAGAATTAGAAGGCTGG - Intronic
921504306 1:215948653-215948675 TATAATAAAAATCAAGAGGGTGG - Intronic
921511656 1:216038490-216038512 TAGAATAAGAAAGTGGAGGGGGG - Intronic
922059691 1:222076300-222076322 TAGAATAAGAATAAGATGGCTGG - Intergenic
922427277 1:225510623-225510645 AATAATAAGAATGAGGAATGGGG + Intronic
922867873 1:228875940-228875962 AATAATAAGGAGGAGGAGGGAGG - Intergenic
923006285 1:230052670-230052692 GAGAATAAGAAGGAAGAGGTCGG - Intergenic
923072356 1:230577598-230577620 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
923306111 1:232690399-232690421 TAGAAAAACAAAGAGGAGGTAGG + Intergenic
1062936556 10:1394896-1394918 AAGAAGAAGGAGGAGGAGGGAGG - Intronic
1063181165 10:3601699-3601721 CAGAAATAGAATGAGGAAGGAGG + Intergenic
1064581116 10:16794002-16794024 TAGAATAAGAAGGCAGAGGAAGG + Intronic
1064880653 10:20049313-20049335 TTGAATAAGAATGACGACAGAGG - Intronic
1065487776 10:26251192-26251214 TAGAAAAAGAAAGATGAGGCTGG - Intronic
1065966987 10:30778727-30778749 AAGAAGAAGGATAAGGAGGGGGG + Intergenic
1068499525 10:57825957-57825979 TAGGATAAGAATGGAGCGGGAGG + Intergenic
1068520589 10:58073125-58073147 AATAATAATAATTAGGAGGGAGG - Intergenic
1069138820 10:64798951-64798973 TAGAAAGAGAATAATGAGGGTGG - Intergenic
1069356606 10:67593796-67593818 TTGAATAGGAGTGATGAGGGTGG + Intronic
1070160494 10:73863905-73863927 TAGAATCAGAATGAGGATCAAGG - Intronic
1070166902 10:73905707-73905729 CAGAATAAGAAAGGAGAGGGTGG + Intergenic
1070356601 10:75646084-75646106 TAGGAAAAGAATGTGGGGGGAGG - Intronic
1070500406 10:77067237-77067259 TAGAATAAAAAGGAGGAGTAAGG + Intronic
1070572467 10:77650491-77650513 AAGAAAAAGAAAGAGAAGGGAGG + Intergenic
1070606126 10:77899626-77899648 TGGAATGAGTATGAGGAGAGGGG - Intronic
1070635684 10:78125379-78125401 TAGAAACAGAGTGAGGAAGGAGG + Intergenic
1071332770 10:84576228-84576250 GAGAAGAAAAACGAGGAGGGTGG - Intergenic
1071702962 10:87962052-87962074 TAGAATAAGAAATAGGAAGGGGG - Intronic
1072709848 10:97709043-97709065 TACAATAAAAATGATGATGGTGG - Intergenic
1072849630 10:98874648-98874670 TCGAATAGGAATGATGAGAGAGG + Intronic
1073231500 10:101974886-101974908 TTGAGTAAGAATGAGGTAGGAGG - Intronic
1073513888 10:104060363-104060385 AAGAAAGAGAAGGAGGAGGGAGG + Intronic
1073580780 10:104663817-104663839 TAAAAGAAGAAAGAGGAGTGGGG - Intronic
1073919273 10:108440563-108440585 TAGAATAAAAAGGTGGAGGAAGG - Intergenic
1074283683 10:112078097-112078119 TAAAATAAATTTGAGGAGGGAGG + Intergenic
1074460003 10:113628166-113628188 TAAAATAAAAATGAAGAGGTTGG - Intronic
1074933542 10:118154826-118154848 TTGAATAGGAATGATGAGAGTGG - Intergenic
1075100906 10:119505480-119505502 TCGGACAAAAATGAGGAGGGAGG + Intronic
1075198622 10:120382779-120382801 TAGAAGGTGAATGAGGTGGGTGG - Intergenic
1075759580 10:124845904-124845926 GAGAATGAGGATGAGGATGGCGG - Intergenic
1077114813 11:879231-879253 AAGAAAAAGAATAAGGTGGGTGG - Intronic
1077676102 11:4194060-4194082 CAGAATAAAACAGAGGAGGGAGG - Intergenic
1077871179 11:6262751-6262773 TAGCATGAGATTGAGGAAGGGGG + Intronic
1078502914 11:11900637-11900659 TAGAGTCAGAATGATGATGGTGG + Intronic
1078619054 11:12891161-12891183 TAGGATAGGAATGAGAAGGAAGG - Intronic
1079661396 11:23041321-23041343 TAGAATGAGGATGAGGAAGTGGG - Intergenic
1080281953 11:30567516-30567538 GAGAATAAGAAACTGGAGGGAGG - Intronic
1080318288 11:30975324-30975346 TTGAATAAGAATGGTGAGAGTGG - Intronic
1080907539 11:36561628-36561650 TAGAACAAAAAGGAGGAGGAAGG + Intronic
1081334701 11:41850222-41850244 GAAAATAGGAATGAGGAGAGAGG - Intergenic
1082721820 11:56687139-56687161 AAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1083759047 11:64805923-64805945 GAAAGCAAGAATGAGGAGGGGGG + Intronic
1085806193 11:79638656-79638678 GAGAAAAACAATAAGGAGGGAGG + Intergenic
1086259616 11:84923432-84923454 AAGAAGAAGAAGAAGGAGGGGGG + Intronic
1086264621 11:84983026-84983048 TTGAATAAAAAGGATGAGGGTGG - Intronic
1086427368 11:86699199-86699221 TAAAATGAGTAGGAGGAGGGGGG - Intergenic
1086574486 11:88323373-88323395 TTGAATAAGAATGGTGAGAGAGG - Intronic
1086737558 11:90325133-90325155 TTGAATAAGAATGGGGAAAGTGG + Intergenic
1087215774 11:95492062-95492084 TTGAATAAGAATGGTGAGAGTGG + Intergenic
1087288673 11:96296342-96296364 AAGAATAAAAATAAGAAGGGAGG + Intronic
1087363837 11:97194761-97194783 TTGAATAAGAGTGATGAGAGGGG + Intergenic
1088260188 11:107936338-107936360 TAAAATAAAAATGGGGTGGGGGG - Intronic
1088296576 11:108303369-108303391 TTGAATAAGAAAAAGGAGTGGGG + Intronic
1088779946 11:113124209-113124231 TAGACTGAGAAGGAGGAAGGAGG + Intronic
1088828555 11:113515961-113515983 TAGGATCAGAATGAGGGGGCTGG + Intergenic
1089535756 11:119160092-119160114 TTGAACAAGAATGTGGAGGCAGG + Intronic
1089847480 11:121469842-121469864 CAGAATATGCATGAGGTGGGAGG + Intronic
1090091260 11:123700561-123700583 TTGAATAAGAGTGATGAGAGAGG + Intergenic
1090217206 11:124979805-124979827 TTGAATAGGAATGATGAGAGAGG + Intronic
1090319362 11:125828951-125828973 TACAACTGGAATGAGGAGGGGGG + Intergenic
1090494933 11:127202166-127202188 TAGAATAGAAGTGAGGTGGGTGG - Intergenic
1090895699 11:130972789-130972811 TTGAATAAGAATGGTGAGAGAGG + Intergenic
1091337142 11:134780702-134780724 AAGAAGGAGAAAGAGGAGGGAGG - Intergenic
1091975074 12:4817769-4817791 TAGAGTAACAATGATGAGGTTGG - Intronic
1092067426 12:5603496-5603518 TAGAAGAAGAAAGAGAAAGGTGG + Intronic
1092499262 12:9029612-9029634 TAAACTTAAAATGAGGAGGGGGG - Intergenic
1092801843 12:12176189-12176211 TATAGTAAAAATCAGGAGGGGGG + Intronic
1093076881 12:14768261-14768283 TAAAATGTGAATGAGGGGGGCGG - Intronic
1093364823 12:18280928-18280950 TAGAAGAAGAAAGATGAGGAAGG + Intronic
1093411231 12:18869863-18869885 GATAATAAGAATGAGGACTGTGG - Intergenic
1093417231 12:18933880-18933902 TAGAATAAGAATGAGTTTTGGGG - Intergenic
1093693486 12:22134089-22134111 TTGAATAGGAGTGATGAGGGAGG - Intronic
1093712913 12:22347996-22348018 TATCATAAGAATCAGGAGGGAGG + Intronic
1093771814 12:23026869-23026891 TAGAACAAAAATGTGGAGGAAGG + Intergenic
1093795126 12:23301975-23301997 GAGGAAAAGAATGAAGAGGGAGG - Intergenic
1093952507 12:25179896-25179918 TTGAATAGGAATGATGAGAGTGG - Intronic
1094131239 12:27078147-27078169 AAGAATAGGAATGAAAAGGGAGG - Intergenic
1094232414 12:28122327-28122349 AAGCAGAAGAATGAGGAGGGGGG + Intergenic
1095275725 12:40280665-40280687 TATAATAAGGCTGAGGTGGGAGG + Intronic
1095701171 12:45192710-45192732 TAGAATGATAACGGGGAGGGAGG - Intergenic
1095891292 12:47236591-47236613 GAGAATAGGAGTGAGGAGGCAGG - Exonic
1095922986 12:47549499-47549521 TAGAAGGAGAGTGATGAGGGGGG + Intergenic
1096001794 12:48136186-48136208 GAGGTTAAGAATGAGGAGGGAGG - Intronic
1096010155 12:48206516-48206538 TTGAATAAGAGTGATGAGAGGGG - Intergenic
1096067974 12:48756177-48756199 TAGAAATAGACTGAGGAGGCCGG - Intergenic
1096087197 12:48873682-48873704 TGGACTAAGAATGAGGAGGGAGG + Intergenic
1096205684 12:49719694-49719716 AAGAAAAAGAAAGGGGAGGGAGG + Intronic
1096698351 12:53365542-53365564 TTGACTAAGGCTGAGGAGGGAGG - Intergenic
1097285203 12:57871934-57871956 GAGAATATGAAGGAGGAGGTAGG - Intergenic
1097620953 12:61938896-61938918 GAGACTCAGAAGGAGGAGGGTGG + Intronic
1097924614 12:65113431-65113453 TAGAATCAGAATAAATAGGGAGG + Intronic
1098460774 12:70730872-70730894 TAGAGAAAGAGAGAGGAGGGAGG + Intronic
1099398439 12:82170982-82171004 AAGAAAAAGAAGGAGGAGGAGGG + Intergenic
1099558095 12:84136398-84136420 TAGAATAAGAAAGTGGAGAAAGG - Intergenic
1099734803 12:86553500-86553522 TAACATAATAGTGAGGAGGGTGG - Intronic
1099938036 12:89151390-89151412 AAGACTCAGAATGGGGAGGGTGG + Intergenic
1100759968 12:97796640-97796662 AGAAATAAGAATGAGAAGGGTGG - Intergenic
1100913580 12:99392326-99392348 TAAAATTAGAATGGAGAGGGTGG - Intronic
1100957080 12:99920795-99920817 TAGAACAAGAAAGTGGAGGAAGG - Intronic
1100968828 12:100044702-100044724 TTGAATAGGAATGATGAGAGAGG - Intronic
1101302174 12:103494501-103494523 TAAAATAAAAAGGAGGAGGATGG + Intronic
1101410674 12:104465349-104465371 AAGAGTTAGAATGGGGAGGGTGG + Intronic
1101693011 12:107098350-107098372 AAGAAAAAGAAGGGGGAGGGAGG + Intergenic
1102823068 12:115924443-115924465 GAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1102828639 12:115973594-115973616 TATAATAGGAAAGAAGAGGGAGG - Intronic
1103022334 12:117544868-117544890 TTGAATAAGAATGGTGAGAGTGG + Intronic
1103619210 12:122175961-122175983 TAAAATATGAATAAGGAGGCCGG - Intronic
1104550046 12:129748350-129748372 GAGAATGAGACTGAGGAGGGAGG + Intronic
1105401364 13:20099160-20099182 GAGATTATGAATGAGGAGAGGGG + Intergenic
1105629444 13:22147548-22147570 AAAAATAAGAATGAGGAGATGGG - Intergenic
1106972365 13:35157209-35157231 TAAAATATGAATGGGGAGGCTGG + Exonic
1107874557 13:44778765-44778787 TAGAAAGAGAAAGAGGAGGATGG + Intergenic
1109106200 13:58253541-58253563 AAGAAGAAAAATGAGGAGGGAGG - Intergenic
1109366884 13:61367391-61367413 TTGAATAAGAATGGTGAGAGAGG - Intergenic
1110004420 13:70248489-70248511 TAGAGGAAGAATGAGGAGAGTGG - Intergenic
1110504290 13:76267492-76267514 TAGAAGGAGAAGGAGGAGGAAGG + Intergenic
1111397268 13:87678792-87678814 AAGAAAAGGAATGAGAAGGGAGG - Exonic
1111456863 13:88495887-88495909 GAGAATAAATATGAGGAAGGTGG + Intergenic
1111961542 13:94816132-94816154 ATGAATAAGAATTAGGAGGAGGG + Intergenic
1113063789 13:106354200-106354222 TAGAAGAAGACTGAAGAGGTGGG + Intergenic
1113149466 13:107246054-107246076 CAGAATGAGATAGAGGAGGGTGG - Intronic
1114360291 14:21964676-21964698 TACAATAAACATGAGGAGGCAGG + Intergenic
1115016401 14:28620374-28620396 GAGAATGAGAATGAGCAGTGGGG - Intergenic
1115113207 14:29849216-29849238 GAGGAAAAGAAAGAGGAGGGAGG - Intronic
1115470352 14:33762427-33762449 TAAAATAAAAAGGGGGAGGGAGG + Intronic
1116255844 14:42554261-42554283 GAGAAGAAGAAAGAGGAAGGAGG + Intergenic
1117140828 14:52790153-52790175 TGGAATACGAATGGGGAGAGAGG + Intronic
1117185275 14:53233779-53233801 TGGAACAAGAGAGAGGAGGGAGG + Intergenic
1118433558 14:65747742-65747764 GAGACTCAGAAAGAGGAGGGTGG + Intergenic
1118840265 14:69504617-69504639 TAGAAGAAGAAAAATGAGGGTGG - Intronic
1119106136 14:71926285-71926307 TAGAATATCAATGAAGAGGCTGG + Intergenic
1119722332 14:76899645-76899667 TAGAACAAGAGTGAGGAGGGCGG + Intergenic
1119770195 14:77215820-77215842 TAGAAGAAGTAGGAGGAGGGGGG - Intronic
1120076905 14:80169271-80169293 AAGAATAAGAACGAGGGGTGTGG - Intergenic
1120390932 14:83908015-83908037 TAGAATATGAGTGAGTAGTGAGG - Intergenic
1120673985 14:87397479-87397501 CAGAATTAGAAGGAGGAAGGGGG - Intergenic
1120992391 14:90389100-90389122 GAGAATGAGAATGAGAAGGAAGG + Intergenic
1121497457 14:94403977-94403999 TAGAATAAGAATGGAGAAGGAGG + Intergenic
1121951746 14:98176955-98176977 TAGAAAATGAATGAGGTGGGAGG - Intergenic
1122562030 14:102622641-102622663 CAGAATAAGAATGTGTGGGGCGG - Intronic
1123453303 15:20388254-20388276 TAGTATAAGAAAAATGAGGGTGG + Intergenic
1124975313 15:34524403-34524425 TAGCATAAGACAGAGGAAGGAGG - Intergenic
1125431532 15:39599527-39599549 GAGAGAAAGAAGGAGGAGGGAGG - Intergenic
1125682859 15:41543766-41543788 TAGAATAAGAATGGGTTGGCCGG + Intronic
1125786746 15:42325348-42325370 TAGAATAGAGATGAGGAAGGAGG + Intronic
1125866793 15:43058671-43058693 TAGAAAAAGAATGAAAAGGTTGG - Intronic
1126684209 15:51233191-51233213 TAGAAAAAGAATAGGGAAGGAGG - Intronic
1126970177 15:54101882-54101904 AAGTATAAGAATGGGGAGGATGG - Intronic
1127358361 15:58223479-58223501 TAGAAAAAGAAAGAGAAAGGAGG - Intronic
1127772293 15:62241810-62241832 TAGCATATGACAGAGGAGGGAGG - Intergenic
1127821477 15:62660061-62660083 TAAAATAATAATGAGAAGGTTGG + Intronic
1128484426 15:68071041-68071063 TAGAATGGGAATTAGGTGGGAGG + Intronic
1128496143 15:68199735-68199757 GAGACTAAGGATGGGGAGGGCGG - Intronic
1128565054 15:68695575-68695597 AAGAATATGAACAAGGAGGGAGG + Intronic
1130226000 15:82058839-82058861 TAGAGAAAGGAAGAGGAGGGAGG - Intergenic
1130557250 15:84931248-84931270 AAAAATAAAAAGGAGGAGGGAGG - Intronic
1130856233 15:87841987-87842009 TAGAATAAGATTGATCAAGGTGG + Intergenic
1131656561 15:94466545-94466567 CAGGATAAGAATAAGGAAGGAGG - Intronic
1131714086 15:95089717-95089739 TAGAAAAAGAAGGGGGAGGAGGG + Intergenic
1131817903 15:96241598-96241620 TAAAATATGAATGAGGAAGGAGG - Intergenic
1131901749 15:97095219-97095241 TATAATAAGAAAGTGGAGGAAGG - Intergenic
1131948488 15:97653510-97653532 CAGAATAATAGTGGGGAGGGGGG + Intergenic
1131997195 15:98144162-98144184 TAGAACAAGAAGGTGGAGGAAGG - Intergenic
1132220292 15:100100253-100100275 TCGAAGAAGCAAGAGGAGGGAGG - Intronic
1132823612 16:1891031-1891053 TAAAAAAAGAATCAGGAGGCTGG + Intergenic
1133358963 16:5158462-5158484 GAGCAAGAGAATGAGGAGGGAGG - Intergenic
1133580409 16:7139234-7139256 TAGAAAAAGAAAGAGAAGAGAGG - Intronic
1133885359 16:9822457-9822479 TAGGAAAAGAAAGAGAAGGGAGG + Intronic
1134287182 16:12872038-12872060 AGGAAGAAGAAGGAGGAGGGGGG - Intergenic
1135347398 16:21700846-21700868 GAGAATATCAGTGAGGAGGGTGG - Intronic
1135432967 16:22402250-22402272 AAGAATAAAAATGAGGGGGATGG - Intronic
1135492859 16:22924955-22924977 CAGAATAACCATGAGAAGGGAGG + Intergenic
1135915768 16:26604192-26604214 TAGGTTAGGAATTAGGAGGGTGG + Intergenic
1135942428 16:26834220-26834242 AAGAAGAAGGAAGAGGAGGGAGG + Intergenic
1135948588 16:26889841-26889863 CAGACTCAGAAAGAGGAGGGTGG - Intergenic
1136318714 16:29468724-29468746 AAGACAAAGAATGAGGAGGGTGG + Intergenic
1136433286 16:30208068-30208090 AAGACAAAGAATGAGGAGGGTGG + Intronic
1136481359 16:30543988-30544010 TAGTATAAGAATGAGTAGAAGGG + Intronic
1136730864 16:32411134-32411156 TTGAATAAGAGTGGTGAGGGAGG + Intergenic
1136991717 16:35155837-35155859 TAGAAGATGACTGAGGTGGGGGG - Intergenic
1137725735 16:50655422-50655444 GAGGATCAGAATGAGCAGGGTGG - Intergenic
1137914231 16:52411371-52411393 TAGAATTAGAATGAGGGAGAAGG - Intergenic
1138753532 16:59454149-59454171 TAGAATAAGGAAGAGCAAGGAGG - Intergenic
1138755020 16:59473750-59473772 TTGAATAAGAATGGTGAGAGTGG - Intergenic
1139989361 16:70927256-70927278 TAGAGTCAGAATGAGGTAGGAGG + Intronic
1141544147 16:84752462-84752484 AAGAATAAAAATGAGGAAGGCGG - Intronic
1141775723 16:86121615-86121637 AAGAAGAAGGAGGAGGAGGGAGG - Intergenic
1202995533 16_KI270728v1_random:106135-106157 TTGAATAAGAGTGGTGAGGGAGG - Intergenic
1203022220 16_KI270728v1_random:418477-418499 TTGAATAAGAGTGGTGAGGGAGG - Intergenic
1143448775 17:7023510-7023532 AACAAGAAGAATTAGGAGGGAGG + Intronic
1143725629 17:8843322-8843344 CAGAATAAGAAAGAGGAAGAAGG - Intronic
1143772640 17:9178454-9178476 GAGAATTAGGAAGAGGAGGGAGG - Intronic
1143901926 17:10181027-10181049 TAGAATAAGGATGAGGGTGGCGG + Intronic
1144055141 17:11533885-11533907 TAGAGTAAGAATAATGAGGCTGG - Intronic
1144110996 17:12032753-12032775 CAGAATAAGGATGGTGAGGGAGG - Intronic
1144159022 17:12538860-12538882 AAAAATAAGAATGGGGAAGGAGG + Intergenic
1146139117 17:30349551-30349573 TAGAACAAAAAGGTGGAGGGAGG - Intergenic
1146622458 17:34409659-34409681 AAGAACAAGAATGATGAGTGAGG + Intergenic
1147254320 17:39173150-39173172 AAGAAAAAGAACCAGGAGGGAGG + Intergenic
1147517395 17:41133941-41133963 TATAATAAGAGTGAGGAGTTTGG + Intergenic
1148514108 17:48199988-48200010 AAGAATTAGATTGAGGAGGAAGG + Intronic
1148989716 17:51654911-51654933 TAGAATTAGAAAGAGGTGGTGGG - Intronic
1149114165 17:53071729-53071751 GAGAAGAAGAAAAAGGAGGGAGG + Intergenic
1149785799 17:59433901-59433923 AAGAAGAAGAAGGAGGAGAGGGG - Intergenic
1150423613 17:65058955-65058977 AAGAAGAAGAAGGAGGAAGGAGG + Intergenic
1150472427 17:65448477-65448499 TAAGATAAGAATGAGGGTGGGGG + Intergenic
1151131471 17:71901604-71901626 TAGACTAGGAATAGGGAGGGAGG - Intergenic
1151947536 17:77327727-77327749 TAGAAAAAAAAAGAGGAGGGTGG - Intronic
1151998188 17:77625402-77625424 TTGAATAAGAGTGGTGAGGGTGG + Intergenic
1152328569 17:79657134-79657156 GAGGAGAAGAATGAGGAGGAAGG + Intergenic
1153606742 18:6841276-6841298 AAGAATAAGAAGGAATAGGGAGG - Intronic
1155089943 18:22497871-22497893 TTGAATAAGAGTGATGAGAGTGG - Intergenic
1155420888 18:25654805-25654827 TAGAATAAGAATAGGGAGTCAGG - Intergenic
1156161553 18:34365149-34365171 GAGAGTCAGAATCAGGAGGGAGG + Intergenic
1156284403 18:35676654-35676676 TAAAGGAAGAAAGAGGAGGGTGG + Intronic
1156965380 18:43085049-43085071 TAGAATGAGAAGGAAGCGGGAGG + Intronic
1156970416 18:43147603-43147625 TAGAATAACAATGTGCAGGCTGG + Intergenic
1156977391 18:43238911-43238933 TAAAATAAAAATGAGAAGGGTGG - Intergenic
1157055651 18:44225568-44225590 TTGAATAAGAATGGTGAGAGAGG + Intergenic
1159380290 18:67647859-67647881 TAAAATAACATTGTGGAGGGGGG - Intergenic
1159965193 18:74588064-74588086 TTGAAGAATAATGTGGAGGGTGG - Intergenic
1160101691 18:75925984-75926006 TAAAGTAAGATTGAGGAAGGAGG - Intergenic
1161270310 19:3386006-3386028 TATAATCAGAATGAGGAGGATGG - Intronic
1161509588 19:4663110-4663132 TAGAATGAGGATGAGGTGGGTGG - Intronic
1161509621 19:4663243-4663265 TAGAATGAGGATGGGGTGGGTGG - Intronic
1161509660 19:4663422-4663444 TAGAATGAGGATGGGGTGGGTGG - Intronic
1161509681 19:4663508-4663530 TAGAATGAGGATGGGGTGGGTGG - Intronic
1161509707 19:4663598-4663620 TAGAATGAGGATGGGGTGGGTGG - Intronic
1161509738 19:4663727-4663749 TAGAATGAGGATGGGGTGGGTGG - Intronic
1161509751 19:4663772-4663794 TAGAATGAGGATGGGGTGGGTGG - Intronic
1162766512 19:12923054-12923076 TAGGAGAAGAGTGAGGAGGCTGG - Intronic
1162841320 19:13358538-13358560 TGGGATAAGAAAGAGGGGGGAGG + Intronic
1163113058 19:15173042-15173064 AAGAAGAAGAGGGAGGAGGGAGG - Intronic
1164423164 19:28115545-28115567 TATAAAAAGGATGAGGAGGAAGG - Intergenic
1164471539 19:28540012-28540034 TTGAATAAGAATAATGAGAGTGG - Intergenic
1164592025 19:29512499-29512521 GAGAACAAGGATGAGGAGGAAGG + Intergenic
1164592065 19:29512643-29512665 GAGAACAAGAATGAGGAGGAAGG + Intergenic
1164592167 19:29513051-29513073 TAGAGGAAGGATGAGGAGGAAGG + Intergenic
1164801061 19:31077120-31077142 TATAAAAATAATGAGGTGGGTGG - Intergenic
1164876236 19:31692590-31692612 TAGAATGACAATGACCAGGGTGG + Intergenic
1164918320 19:32069886-32069908 GAGAAAAAGATTGGGGAGGGCGG - Intergenic
1166006059 19:39907672-39907694 TAGAATTAGAGTGAAGAGGCCGG + Intronic
1166285009 19:41820226-41820248 TTGAATAAGGATGATGAGAGTGG + Intergenic
1167723674 19:51196604-51196626 GAGACTCAGAATGAGGAAGGGGG - Intergenic
1168331240 19:55570424-55570446 TAAAAAAGGAATGAAGAGGGTGG + Intergenic
1168673669 19:58260580-58260602 AAGAATAAGAATAAGCAGGGAGG - Intronic
925672104 2:6321757-6321779 TTGAATAGGAATGATGAGAGTGG - Intergenic
926390883 2:12391424-12391446 TAAAAAGAGAGTGAGGAGGGAGG - Intergenic
926481996 2:13410978-13411000 TAGTATAAGAAAAATGAGGGTGG - Intergenic
926574462 2:14564708-14564730 AAGAAGAAGAAACAGGAGGGAGG + Intergenic
927610406 2:24533484-24533506 TAGAATAGGAATGGTGAGAGAGG + Intronic
928479675 2:31669261-31669283 GAGACTCAGAATGGGGAGGGTGG - Intergenic
928576597 2:32661805-32661827 TTGAATAGGAATGGTGAGGGAGG + Intronic
928599807 2:32893446-32893468 TAGAATAAAAAGGCAGAGGGGGG + Intergenic
929015018 2:37485283-37485305 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
929361605 2:41098569-41098591 GAGAAAATGAATGAGGAGGAGGG - Intergenic
929910953 2:46089182-46089204 TAGAATAAGAATGAGGAGGGAGG - Intronic
930357972 2:50345561-50345583 TAGAATAAAAATTGGGAGTGGGG + Intronic
930436415 2:51349421-51349443 TTGAAAAAGAATGAGGTTGGAGG + Intergenic
930529908 2:52576048-52576070 TTGAATAAGAGTGAAGAGAGTGG + Intergenic
930581855 2:53221074-53221096 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
930731909 2:54735976-54735998 TGGAAAAAGAATGGGGAAGGAGG + Intronic
930774832 2:55161410-55161432 CAGGATATGAATGAGGTGGGAGG + Intergenic
931476569 2:62593887-62593909 TAGAACAAAAATGTGGAGGAAGG + Intergenic
932537942 2:72619495-72619517 TTTAAAAAGAATGAGGAGGAGGG + Intronic
932993133 2:76812794-76812816 AAGAATAAGGAGGAGGAGGGGGG - Intronic
933173442 2:79151136-79151158 TAGAATAGAAATGGGGAGAGAGG + Intergenic
933427973 2:82137412-82137434 TAGAATAATAATGAGAGGGGAGG + Intergenic
933488659 2:82955954-82955976 GAGAAGAAGAAAGAGGAAGGAGG + Intergenic
933550294 2:83768146-83768168 TTGAATAAGAGTGATGAGAGAGG - Intergenic
933904904 2:86882295-86882317 GAGACTCAGAAGGAGGAGGGTGG + Intergenic
936367324 2:111869867-111869889 GAGACTCAGAAGGAGGAGGGTGG - Intronic
936773906 2:115949183-115949205 TTGAATAAGAGTGATGAGAGAGG + Intergenic
936894861 2:117415811-117415833 TTGAATAAAAGTGGGGAGGGTGG + Intergenic
937448561 2:121980003-121980025 TTGAATAAGAGTGAAGAGAGTGG + Intergenic
937844607 2:126565809-126565831 TAGAATGAGACTGAGAAGGTTGG + Intergenic
938157750 2:128956089-128956111 AAGTATAAGAATGAGGTGGTAGG - Intergenic
938225753 2:129614714-129614736 AAGAACAGGAAGGAGGAGGGGGG + Intergenic
938301968 2:130221755-130221777 TAGAACAAGAAGGTGGAGGAAGG + Intergenic
938454733 2:131452697-131452719 TAGAACAAGAAGGTGGAGGAAGG - Intergenic
938592561 2:132753582-132753604 TATAATAAGAATGTGGGGAGAGG - Intronic
939114735 2:138047526-138047548 TAGACTAAGATTGAGGATGAAGG + Intergenic
939280071 2:140052541-140052563 GAGAAGAAGAAAGAGGAGGAAGG + Intergenic
939359700 2:141154028-141154050 TAGAATGGAAATGAGGAGAGAGG + Intronic
939585766 2:144003656-144003678 TTGAGAAAGAATGAGGAGAGGGG + Intronic
939743554 2:145940202-145940224 CCAAATAAGAAGGAGGAGGGAGG - Intergenic
940038992 2:149339752-149339774 GAGAATAAGGATGAGCAGGGGGG - Intronic
940154485 2:150639776-150639798 TAAAATAAGAATCAACAGGGTGG + Intergenic
940437935 2:153676980-153677002 TTGAATAAGACTGATGAGAGTGG - Intergenic
940545975 2:155085861-155085883 CAGACTCAGAAGGAGGAGGGTGG + Intergenic
941146218 2:161849438-161849460 TTGAATAAGAATGGTGAGAGTGG + Intronic
941293893 2:163711806-163711828 TAGATTAAGAATGAGGTTAGAGG + Intronic
941299356 2:163782210-163782232 TAGAAAATGAATGATGAGAGGGG - Intergenic
941753015 2:169153068-169153090 TATAACAACAGTGAGGAGGGAGG - Intronic
942224796 2:173805586-173805608 CAGAATCAGAATCAGCAGGGTGG - Intergenic
943309144 2:186305002-186305024 TATACTAAAAATGAGGAGGTAGG - Intergenic
943670115 2:190650601-190650623 TATAAGAAGTATGAGGAGAGAGG + Intronic
943898970 2:193407535-193407557 TTGAATAGGAATGATGAGAGAGG - Intergenic
944541856 2:200761611-200761633 AAGAATAAGGATGAAGAGGGTGG + Intergenic
944674515 2:202023913-202023935 TAGAATAATAAGGGGGAGGCAGG + Intergenic
944934282 2:204551541-204551563 GAGAAAGAGAAAGAGGAGGGAGG - Intronic
945199744 2:207269469-207269491 TAGGATAAGTATGTGGAGGGTGG - Intergenic
945359159 2:208875725-208875747 TTGAATAAGACTGGTGAGGGTGG + Intergenic
945441392 2:209884319-209884341 TATAATAATAAAGAGGAAGGTGG + Intronic
945520266 2:210818810-210818832 TTGAATATGAATGTGGAAGGAGG + Intergenic
945579690 2:211577914-211577936 TTGAATAGGAATGATGAGAGAGG - Intronic
945615309 2:212058894-212058916 TTGAATAAGAGTGATGAGAGAGG - Intronic
945719627 2:213403660-213403682 TTGAATAGGAATGATGAGAGGGG - Intronic
946617385 2:221524429-221524451 GAGAATGAGAATGAGGATGTAGG + Intronic
946859014 2:223982309-223982331 GAGACTCAGAAGGAGGAGGGTGG + Intronic
946876890 2:224138469-224138491 AGGAACAAGAGTGAGGAGGGAGG + Intergenic
947147020 2:227077703-227077725 AAAAAAAAGAAGGAGGAGGGAGG + Intronic
947240238 2:227986644-227986666 TAGAATAAGAAATTAGAGGGAGG + Intronic
947248064 2:228072066-228072088 TAGAATAAAAAAGTGGAGGAAGG + Intronic
947286757 2:228525329-228525351 AAGAATGAGAGGGAGGAGGGAGG + Intergenic
947458847 2:230284371-230284393 CAGAATGAGAATGAGAAGGCAGG + Exonic
947538845 2:230960518-230960540 GAGAAAAAGAATTAGTAGGGAGG + Intronic
947921390 2:233877942-233877964 TAGAGTAAGAAAAGGGAGGGGGG - Intergenic
947970600 2:234319921-234319943 GAGAAGAAGGAGGAGGAGGGAGG - Intergenic
948746782 2:240102208-240102230 GAGACTAAGAAAGGGGAGGGTGG + Intergenic
1169009847 20:2241368-2241390 AAGAAAAAGAGGGAGGAGGGAGG - Intergenic
1169045544 20:2531887-2531909 GAGAAGGAGAAGGAGGAGGGGGG + Intergenic
1169160274 20:3371718-3371740 TAGAATAAGAATTAGGAAAAGGG - Intronic
1169344773 20:4821523-4821545 CAGAATAAAAATGAGGGGAGTGG + Intronic
1169417853 20:5432967-5432989 TAGAATAAAAAGGTGGAGGAAGG - Intergenic
1169768994 20:9181167-9181189 TAGAATGTTAGTGAGGAGGGTGG - Intronic
1170058150 20:12229827-12229849 GAGATTGAGGATGAGGAGGGAGG - Intergenic
1170236721 20:14114594-14114616 TATAAGAAGATTGAGGAAGGTGG + Intronic
1170832263 20:19852680-19852702 TAGATTAAGAATGATCAGAGAGG - Intergenic
1172038693 20:32028776-32028798 TAGAGGAAGAAGGAGAAGGGGGG + Intronic
1172289680 20:33767024-33767046 CAGCATAAGAATGAGCAGGTAGG + Exonic
1172602382 20:36192800-36192822 TAGAGTAGCCATGAGGAGGGAGG + Intronic
1172949656 20:38714681-38714703 TAGAATAAACATGTGGGGGGCGG + Intergenic
1173038712 20:39439013-39439035 TTGAGTAAGAATGATGAGAGTGG + Intergenic
1173398521 20:42703184-42703206 GAGAATAAGAATGTGGAGAAAGG + Intronic
1173808812 20:45943601-45943623 TGGAATTGGGATGAGGAGGGTGG + Intronic
1174317243 20:49713015-49713037 TAGAGGAAGAAAGGGGAGGGAGG + Intronic
1174694907 20:52547350-52547372 TTGAATAGGAATGGTGAGGGAGG - Intergenic
1174723880 20:52841045-52841067 AAGAATAAGGAAGAGGAGAGGGG - Intergenic
1175298908 20:57928882-57928904 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
1175779448 20:61672955-61672977 TAGAAGAAGAAGAAGGAGGCAGG + Intronic
1177689586 21:24488118-24488140 TGGAAGAAGAAAGAGGAGAGTGG + Intergenic
1177798747 21:25806706-25806728 TAGAATAAAAAGGTGGAGGAAGG + Intergenic
1179516304 21:41909953-41909975 TAGGTTACGAAGGAGGAGGGAGG - Intronic
1180262078 21:46678318-46678340 TAGCATTAGACTGAGAAGGGAGG - Intergenic
1180541610 22:16453998-16454020 TTGAATAAGAATGGTGAGAGAGG - Intergenic
1180570333 22:16710676-16710698 TTGAATAAGAGTGGGGAGAGAGG - Intergenic
1180690092 22:17706733-17706755 TGAAAAGAGAATGAGGAGGGAGG - Intronic
1180872540 22:19154653-19154675 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
1181911733 22:26243817-26243839 GAGAAGAAAAATGAGCAGGGAGG + Intronic
1182724464 22:32432244-32432266 TTGATTAAGAGTGAGGATGGAGG - Intronic
1183138920 22:35917402-35917424 TACACTAAGAATGAGGGGAGGGG + Intronic
1183868086 22:40720119-40720141 TAGAAGGAGAAGGAGGAGGAAGG - Intergenic
1184966765 22:47980774-47980796 TAGCATAAAAGTAAGGAGGGAGG - Intergenic
949102540 3:163456-163478 GAGAAGAAGATGGAGGAGGGAGG - Intergenic
950415377 3:12866243-12866265 TAGAAGAGGAATCAGGATGGGGG - Intronic
950417007 3:12874531-12874553 TAGAAGAGGAATGAAGATGGGGG - Intergenic
950453145 3:13076849-13076871 GGGAATAAGATTTAGGAGGGTGG - Intergenic
950925900 3:16741659-16741681 TTGACTGAAAATGAGGAGGGAGG + Intergenic
951040838 3:17987511-17987533 TGGAATCAGAAAGAGGAGAGAGG - Intronic
951284984 3:20799817-20799839 TTGAATAAGAATGATGACAGTGG + Intergenic
951654529 3:24990716-24990738 AAGAGTAATAATGAGGAGGCAGG - Intergenic
952332341 3:32375643-32375665 TAGAAAAAGAAAGAGCTGGGAGG + Intergenic
953041748 3:39261708-39261730 TAGAATAAGCATGAAGTGAGTGG + Intergenic
953328619 3:42033658-42033680 TAGAATAAGACTGTGTAGTGTGG + Intronic
953374650 3:42418578-42418600 AAAAATAAGAAAAAGGAGGGAGG + Intergenic
953621673 3:44538121-44538143 ATGAAGAAGCATGAGGAGGGAGG + Intergenic
953894077 3:46781224-46781246 TATAATAAGAATGGTGAGAGTGG - Intronic
955006845 3:54976597-54976619 AAGAAGAAGAATAAGGAGGATGG - Intronic
955256881 3:57341198-57341220 TTGAATAAGAGTGATGAGAGTGG - Intronic
955318602 3:57958844-57958866 CAGAAAAAGAATGAGGAAGGAGG - Intergenic
955510923 3:59679524-59679546 ATGAGTAAGAAGGAGGAGGGTGG + Intergenic
955599033 3:60624512-60624534 GAGAATAGGAATGAAGAGAGAGG + Intronic
956058224 3:65323000-65323022 TAGAAAAAGAAAAAGGAGGCCGG - Intergenic
956130997 3:66053817-66053839 TGGAATAAGAAAGAGGGGGCTGG - Intergenic
956240947 3:67130101-67130123 TAGTAAAGGAAGGAGGAGGGGGG - Intergenic
957951536 3:87133600-87133622 TTGAATAAGAGTGATGAGAGAGG + Intergenic
958605933 3:96358474-96358496 TTGAATAGGAATGAGGTGGGAGG + Intergenic
958624162 3:96603373-96603395 TTGAATAAGAGTGGTGAGGGAGG + Intergenic
958786284 3:98599721-98599743 TACAATAAGAAAAAGAAGGGAGG - Intergenic
959034658 3:101346940-101346962 TAAAAAAAGGAGGAGGAGGGAGG + Intronic
959166965 3:102792512-102792534 AAGAAAAAGAAGGAGGAGTGAGG + Intergenic
960414089 3:117362798-117362820 TTGAATAGGAATGATGAGAGAGG - Intergenic
960425765 3:117506134-117506156 TAAGATAAGAATGAAGAGAGAGG - Intergenic
960659656 3:120043847-120043869 TAGATGGAGAAGGAGGAGGGAGG - Intronic
962474179 3:135741194-135741216 TAAAAAAAGATTTAGGAGGGAGG - Intergenic
962607149 3:137042057-137042079 TGGAAAAAGAGTGAGAAGGGAGG - Intergenic
962694086 3:137930498-137930520 GAGAGAAAGAAAGAGGAGGGAGG + Intergenic
962863263 3:139424264-139424286 TTGAATAAGAGTGATGAGAGTGG - Intergenic
962883896 3:139605209-139605231 ATGAATAAGGATGAGGAGGAAGG - Intronic
962922421 3:139963088-139963110 GAGAATGAGGAGGAGGAGGGGGG + Intronic
963341972 3:144047137-144047159 TTGAGTAAAAAGGAGGAGGGAGG - Intronic
963347855 3:144117258-144117280 TAAAGTAAGAATGAGGGGGTGGG - Intergenic
963665892 3:148185458-148185480 TAGAATAATAATGAGAAGTTGGG - Intergenic
965085932 3:164098248-164098270 TTGAATAAGAGTGGTGAGGGTGG + Intergenic
966103861 3:176311209-176311231 TAGGCTAGAAATGAGGAGGGCGG + Intergenic
966286855 3:178307478-178307500 AAGAATAAGAATGAAAGGGGAGG + Intergenic
966341127 3:178925924-178925946 TTGAATAAGAATGGTGAGAGAGG - Intergenic
966666513 3:182477860-182477882 TAGAAAAAGACTGAGAAGGAGGG - Intergenic
966963289 3:184963109-184963131 AAGAAAAAGAATAAGGAGGGAGG - Intronic
967281135 3:187824769-187824791 CAGTATATGCATGAGGAGGGTGG - Intergenic
967292743 3:187937069-187937091 TAGAGTAAAAATAAAGAGGGAGG - Intergenic
967331155 3:188290989-188291011 TAGCATCAGAAGGAGGTGGGTGG + Intronic
967336688 3:188352048-188352070 TAGAAGAAAAATGACAAGGGGGG - Intronic
967439040 3:189485649-189485671 TATTCTAAGAAAGAGGAGGGAGG - Intergenic
967987683 3:195107507-195107529 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
968696087 4:2028551-2028573 TTGAATAAGAGTGATGAGAGAGG + Intronic
970347005 4:15162134-15162156 AAGAATAAGCAGGAGGAGGTGGG - Intergenic
970759533 4:19468148-19468170 TAGAATCATGATGAGAAGGGAGG - Intergenic
971107672 4:23544478-23544500 TTGAATAGGAATGATGAGAGAGG - Intergenic
971428295 4:26537487-26537509 TAGAATAAGCATGGGAATGGGGG - Intergenic
971449903 4:26790203-26790225 TAGAATAAGAGAGAGTACGGAGG - Intergenic
971655249 4:29336003-29336025 TAGAAGAAAAAGGAGGAAGGAGG - Intergenic
971756745 4:30717560-30717582 AGGAATGAGAGTGAGGAGGGCGG + Intergenic
971799205 4:31266652-31266674 TAGTAGAAGAAAGAGGAGGATGG - Intergenic
971903357 4:32693409-32693431 TATAGTAAGAATGATGAGGGAGG + Intergenic
971963542 4:33520784-33520806 TAAAAAAAGAATGAGAAGTGAGG - Intergenic
972256165 4:37357977-37357999 TAGAACAAGTATGAATAGGGAGG + Intronic
972767937 4:42168983-42169005 TAGAATAAAAATGGGGAGTAAGG - Intergenic
973399345 4:49625014-49625036 TTGAATAGGAGTGAGGAGAGAGG - Intergenic
973588352 4:52414441-52414463 GAGAACAAGAGTGAGGAGTGAGG + Intergenic
973769749 4:54195507-54195529 AAGAAAGAGAATGAAGAGGGAGG + Intronic
974053269 4:56960969-56960991 TAGAAGAGGACTGAGGAGTGGGG + Intergenic
974229280 4:59088959-59088981 AAAAAGAAGAAGGAGGAGGGGGG - Intergenic
974229283 4:59088962-59088984 TAGAAAAAGAAGAAGGAGGAGGG - Intergenic
974239902 4:59233538-59233560 TTGAATAAGAGTGATAAGGGAGG + Intergenic
974385803 4:61201161-61201183 AAGAAAAAGAAAGAGAAGGGGGG + Intergenic
974562836 4:63543584-63543606 TTAAATAAGAATGATGAGAGTGG - Intergenic
974677076 4:65105801-65105823 TTGAATAAGATTGAGGAAAGTGG - Intergenic
975036241 4:69686447-69686469 TTGAATAAGAGTGATGAGAGAGG + Intergenic
975471260 4:74771164-74771186 TAGAAAAAGAAAGAAGAGGAGGG + Intronic
975630984 4:76402165-76402187 GAAAAAAAGAATGAGGAGAGAGG + Intronic
975795239 4:78000148-78000170 GAGAAGAAGAATGAAGAGGAGGG + Intergenic
976392222 4:84517475-84517497 TAGAATAAGGATAAAGAGAGGGG - Intergenic
976561967 4:86511893-86511915 AAGGAGAAGAATGAGGAGGAAGG + Intronic
976682534 4:87773174-87773196 TTGAATAGGAATGGGGAGAGAGG - Intergenic
976759442 4:88532460-88532482 TAGAATAAAAAGGTGGAGGAAGG - Intronic
976761666 4:88555805-88555827 TACGATGAGAATGAGGAGAGAGG + Intronic
977752410 4:100625254-100625276 TTGAATAAGAGTGGGGAGAGAGG - Intronic
978505974 4:109456428-109456450 TTGAATAGGAATGATGAGAGAGG + Intronic
978637917 4:110832905-110832927 GAGAAGAAGAAAGAGGAGGCAGG + Intergenic
979012684 4:115391359-115391381 TTGAATAGGAATGATGAGGGAGG - Intergenic
979618312 4:122769520-122769542 TAGAATCACAAAGATGAGGGAGG - Intergenic
979718479 4:123870117-123870139 TAAAGGATGAATGAGGAGGGGGG + Intergenic
980111054 4:128637246-128637268 GATAATAAGAATGATGATGGTGG - Intergenic
980225152 4:129974041-129974063 TAGAACAAAAAGGAGGAGGAAGG - Intergenic
980647645 4:135663477-135663499 TAGACTGAGCATGTGGAGGGAGG - Intergenic
981120048 4:141039370-141039392 TAGAGAAAGAAAGGGGAGGGAGG + Intronic
981284091 4:142994985-142995007 TTGAATAGGAGTGAGGAGAGGGG - Intergenic
982290411 4:153775830-153775852 TTGAATAAGAATGGAGAGAGTGG + Intergenic
982715361 4:158801479-158801501 TGGTATGAGAATGAGCAGGGTGG + Intronic
982843083 4:160217476-160217498 TTGAATAAGAGTGATGAGAGTGG + Intergenic
983172051 4:164547319-164547341 TTGAATAAGAGTGGTGAGGGAGG - Intergenic
983351243 4:166592901-166592923 GAGGAAAAGAAAGAGGAGGGGGG - Intergenic
983418583 4:167489193-167489215 TTGAATAAGAATGGTGAGAGAGG + Intergenic
983591147 4:169412861-169412883 TGGAATAAGACTGAGAGGGGTGG + Intronic
983653166 4:170053614-170053636 TGGAAGAAGAAGGAGGGGGGAGG - Intergenic
984036644 4:174677195-174677217 TAGAATAACAATCAGGAGACTGG + Exonic
984283075 4:177695971-177695993 TAGATTAAGAATGATTAGGTCGG + Intergenic
985157363 4:187003528-187003550 TTGAATAAGAATGGTGAGAGAGG - Intergenic
985219033 4:187683045-187683067 TGCAAGGAGAATGAGGAGGGTGG + Intergenic
985478997 5:95586-95608 TAGAATAAGGCTGGGAAGGGAGG - Intergenic
985967418 5:3348184-3348206 TAGCAGAAGTATAAGGAGGGAGG - Intergenic
986030248 5:3886586-3886608 AGAAATAAGAATGAGGTGGGAGG - Intergenic
987055704 5:14189429-14189451 TAGAATTGGATTGAGGAGGGCGG + Intronic
987225810 5:15840352-15840374 TTGGAAAAGAATGAGGAGGAGGG - Intronic
987430241 5:17824181-17824203 TTGAATAAGAGTGATGAGGGAGG - Intergenic
987832220 5:23109567-23109589 TAGAATAAGAGTGATGAAAGTGG - Intergenic
988222805 5:28370953-28370975 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
988626457 5:32880673-32880695 TTGAATAAGAGTGGTGAGGGTGG + Intergenic
988889024 5:35594335-35594357 GAGACTCAGAATGGGGAGGGTGG - Intergenic
988975536 5:36512132-36512154 TTGAATAAGAGTGGTGAGGGAGG - Intergenic
989296474 5:39833134-39833156 AAGAGAAAGAGTGAGGAGGGAGG + Intergenic
990300623 5:54445989-54446011 TAGAACAAAAAGGAGGAGGAAGG + Intergenic
991055861 5:62319360-62319382 AAGAATAAGACTGAAGAGGCAGG - Intronic
991282862 5:64936137-64936159 TTGAATAGGAATGATGAGAGAGG + Intronic
991320371 5:65366967-65366989 AAGAAAAAGAATGATGCGGGGGG + Intronic
991480815 5:67077292-67077314 TTAAATCAGAATGGGGAGGGAGG - Intronic
992403614 5:76434344-76434366 GAGACTCAGAAAGAGGAGGGTGG - Intronic
992418626 5:76578606-76578628 TAGAAAAAGAATGATGTGGCCGG - Intronic
992961460 5:81960101-81960123 TAAAATAAAAGTGAGGAGAGGGG - Intergenic
993041715 5:82822187-82822209 CAGAATAAGCTTGAGGAGGAGGG - Intergenic
993420334 5:87693737-87693759 TTGAATAGGAATGATGAGAGAGG + Intergenic
993590374 5:89788095-89788117 TAGAACAAAAATGTGGAGGAAGG + Intergenic
994156614 5:96510981-96511003 TAGAATCAGAGAGAGGAGAGAGG - Intergenic
994913680 5:105945620-105945642 AAGAAGAAGAAAGAAGAGGGAGG + Intergenic
995190629 5:109316108-109316130 TAGAAGAACAATGAGCAGGCTGG + Intergenic
995578681 5:113571017-113571039 TTGAATAAGAGTGATGAGAGAGG + Intronic
995621611 5:114031880-114031902 TAAAATAAGAGTGTGGAGGTAGG - Intergenic
996338688 5:122412485-122412507 TAGGAGAAAAATGAGGAGAGAGG - Intronic
996538130 5:124600346-124600368 GAGAATAAAAATGTGAAGGGTGG + Intergenic
997037088 5:130205830-130205852 TGGAATGAGAAGGAGGAGGGTGG - Intergenic
997739906 5:136244193-136244215 AAGAAGAAGAAGGAGGAGGAGGG - Intronic
997876316 5:137550937-137550959 TTGAATAAGAATGGTGAGAGAGG - Intronic
998204664 5:140149946-140149968 TAGGATGAGACTGATGAGGGTGG + Intergenic
998608607 5:143663578-143663600 TAGAAAAAGAATGAGCAAAGGGG - Intergenic
998695921 5:144639427-144639449 TAGAAGAGGAATGAGGAGTTAGG + Intergenic
999429587 5:151514688-151514710 GAGAGTGGGAATGAGGAGGGAGG - Intronic
999578520 5:153007973-153007995 TTCAATAAAAATGAGAAGGGAGG + Intergenic
999700594 5:154224337-154224359 TAGAATAAGAATGATGAATGGGG - Intronic
1000018017 5:157295472-157295494 TAGAATTAGAAGGAAGGGGGAGG - Intronic
1000507433 5:162138689-162138711 TTGAATAAGAGTGACGAGAGAGG + Intronic
1000733511 5:164868053-164868075 TAAAATACGAATGAGAAGGTTGG - Intergenic
1000810448 5:165855025-165855047 TAGAGTAAGAGTGGGGATGGAGG + Intergenic
1001044709 5:168362936-168362958 TAGAAAAAAGAAGAGGAGGGAGG - Intronic
1001732160 5:173968567-173968589 TAGAGAAAGAATCAGGAGGTGGG + Intergenic
1001735890 5:174000768-174000790 AAGAAGGAGAATGAGGTGGGGGG + Intronic
1002392952 5:178930011-178930033 AAGAGCAAGAGTGAGGAGGGAGG + Intronic
1002969139 6:1996159-1996181 AAGAATGAGAAAGAGGAAGGAGG - Intronic
1003769863 6:9288308-9288330 TAGAATAACAATGTGGAGGAAGG + Intergenic
1004198805 6:13529339-13529361 TTGAATGGGATTGAGGAGGGAGG + Intergenic
1004404979 6:15324478-15324500 AAGAAGAAGAAAAAGGAGGGGGG - Intronic
1004961602 6:20796537-20796559 TTGAATAAGAATAAGGTTGGAGG + Intronic
1005083625 6:21981564-21981586 CAGAACAAGAAAGAGGAGGCAGG - Intergenic
1005140092 6:22621870-22621892 AAGACTGAGAATGAGGTGGGTGG - Intergenic
1005764769 6:29000182-29000204 TAGAAAAATAATGAAGAGGAAGG - Intronic
1006217374 6:32455965-32455987 TTGAATAAGAATGGTGAGGGAGG - Intergenic
1007060165 6:38932725-38932747 GAGAAAAAGAATGACAAGGGAGG + Intronic
1007870865 6:45036375-45036397 TATACTAAGAATAAGGAGAGTGG + Intronic
1007901918 6:45421400-45421422 CACAAAAAAAATGAGGAGGGGGG - Intronic
1008153008 6:47978106-47978128 AAGAAAAATAATGAGAAGGGGGG - Intronic
1008186388 6:48396393-48396415 TTGAATAAAAGTGAGGAGAGAGG + Intergenic
1008246760 6:49184687-49184709 AAGAAGAAGAAGGAGGTGGGGGG - Intergenic
1008871644 6:56279173-56279195 AAGAACAAGAGTGAGGTGGGAGG - Intronic
1010670459 6:78680404-78680426 TTGAATAGGAGTGATGAGGGAGG - Intergenic
1010817808 6:80379550-80379572 TTGAATAAGAGTGATGAGAGTGG - Intergenic
1010876548 6:81114086-81114108 TTGAATAAGAGTGGGGAGAGAGG + Intergenic
1011377284 6:86703127-86703149 TTGAATAAGAATGAAGAGAGAGG + Intergenic
1012058913 6:94452435-94452457 TTGAATAAAAGTGATGAGGGTGG - Intergenic
1013521264 6:110935907-110935929 TAGAATCAGAATGGGGAGGGAGG - Intergenic
1014490721 6:122058497-122058519 TTGAATTAGAATGAGGAGAAAGG + Intergenic
1014925515 6:127266430-127266452 AAGAAAAAAAATGGGGAGGGGGG - Intergenic
1014999773 6:128200827-128200849 AAGAAGAAGGATGAGGAGGAGGG + Intronic
1015141067 6:129932385-129932407 GAGAAAAAGAAAGAGGAGGGAGG + Intergenic
1015391596 6:132688539-132688561 TAGGAAAAGATTGAGGAGGCAGG + Intronic
1016072556 6:139757368-139757390 TTGAATCAGAATATGGAGGGTGG - Intergenic
1016231393 6:141809426-141809448 TAGAATATGACCGAGGAGGCAGG + Intergenic
1017055395 6:150431435-150431457 TAGAACCAGAAGCAGGAGGGGGG + Intergenic
1017586940 6:155936878-155936900 TAGAGAGAGAAGGAGGAGGGAGG + Intergenic
1017646932 6:156547877-156547899 TACAATAAGAAGTAGGAGGTTGG + Intergenic
1018005218 6:159615797-159615819 GGAAATAAGAATGAGGAAGGAGG + Intergenic
1018292244 6:162303894-162303916 GAGGATAGGAATGAGGAGGGAGG + Intronic
1018306713 6:162464895-162464917 TTTATTAAGAAGGAGGAGGGGGG - Intronic
1019600185 7:1878733-1878755 CTGAATAAGAATGGGGGGGGGGG - Intronic
1019772948 7:2895121-2895143 AAAAAAAAGAATGAGAAGGGTGG - Intergenic
1020011513 7:4808084-4808106 GAGAGGAAGAAGGAGGAGGGAGG - Intronic
1020264180 7:6549394-6549416 AAGATTAAGAATGAGGAGCCTGG - Intronic
1020906017 7:14065658-14065680 AAAAAAAAGAATGAGGAGGAAGG - Intergenic
1021024960 7:15654450-15654472 TTGAATAAGAGTGGTGAGGGAGG + Intronic
1021351399 7:19598521-19598543 TTGAATAGGAATGAGGACAGTGG + Intergenic
1021362095 7:19728180-19728202 GAGAGAAAGAAAGAGGAGGGAGG - Intronic
1022018923 7:26379497-26379519 AAAAATAAGAATGAAGAGGGGGG - Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022828959 7:34045515-34045537 AAGAATGAGAATGAGGGGGCAGG + Intronic
1022846623 7:34216333-34216355 TAGAACAAGAAGGTGGAGGAGGG - Intergenic
1023088596 7:36597053-36597075 TAGGATAAGAATAAGGATGGAGG - Intronic
1023227731 7:37988945-37988967 TAGAACAAGAAGGTGGAGGAAGG - Intronic
1023378618 7:39584136-39584158 TAAAATAATAATGGGGTGGGGGG - Intronic
1023584392 7:41714247-41714269 AAGAAAGAGAAAGAGGAGGGAGG + Intergenic
1024690780 7:51800548-51800570 AAAAATAAGAATGAAGATGGAGG - Intergenic
1024721000 7:52137360-52137382 AAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1024721003 7:52137363-52137385 AAGAAGAAGGAGGAGGAGGGGGG + Intergenic
1024818792 7:53303192-53303214 TACTATAAGAAGGAGGTGGGAGG + Intergenic
1025767409 7:64468345-64468367 TAAAATAAAAAGGAGGTGGGGGG + Intergenic
1025955499 7:66179603-66179625 AAGAATAAGAGTGAGTAGGCCGG + Intergenic
1026158947 7:67852194-67852216 TAGAATAAGGAAGATGAGGAGGG + Intergenic
1026905066 7:74058102-74058124 AAGAATGAGAAGGAGGAGGAGGG - Intronic
1028733997 7:94186085-94186107 TTGAATAGGAATGGTGAGGGAGG + Intergenic
1029180759 7:98700053-98700075 AAGAAAAAGAAAAAGGAGGGAGG + Intergenic
1029330160 7:99846614-99846636 TTGAATAAGAATGGTGAGAGTGG + Intronic
1029410095 7:100403964-100403986 GAGAAACAGAATGGGGAGGGAGG - Intronic
1029815212 7:103086893-103086915 GAGAATAAGACAGAAGAGGGAGG + Intronic
1030482201 7:110119365-110119387 TAGATTTAGAATGAAGAGAGTGG + Intergenic
1031838615 7:126709479-126709501 AAGAAGAAGAAGGAGGAGGGAGG + Intronic
1032670417 7:134077292-134077314 TAGAATAAAAAGGTGGAGGAAGG - Intergenic
1032756171 7:134892858-134892880 TAGAAGAGGGATGAGGAGAGGGG - Intronic
1032908741 7:136404483-136404505 AGGAAAAAGGATGAGGAGGGAGG - Intergenic
1032921721 7:136556635-136556657 TAGAATGAGAAAGAGAAGAGTGG - Intergenic
1033078825 7:138275220-138275242 TTGAATAAGAGTGATGAGAGTGG - Intergenic
1033446104 7:141423533-141423555 TAGAATATGGAGGAGGAGGAGGG + Intronic
1033454331 7:141488950-141488972 GAGAAAGAGAAGGAGGAGGGAGG + Intergenic
1033706842 7:143897281-143897303 TAGGCTAAGGATGAGGAGGAAGG - Intronic
1033890469 7:146006537-146006559 TAGAAGAAGAAGAAGGAGGAGGG - Intergenic
1035599135 8:885659-885681 TTGAATAAGAGTGATGAGAGAGG + Intergenic
1035949533 8:4004998-4005020 TAGAATAAGAGTCACTAGGGAGG - Intronic
1036057555 8:5274600-5274622 TGGAACAAAAATGATGAGGGGGG + Intergenic
1036735731 8:11314070-11314092 TAGAATAAGAGTGAGAATAGAGG + Intronic
1037277719 8:17199663-17199685 AAGAAGAAGAAGAAGGAGGGAGG - Intronic
1037401186 8:18496808-18496830 GAAAATAAGAATGAAGTGGGAGG + Intergenic
1037958182 8:23074913-23074935 GAGAAGGAGAATGAGAAGGGAGG - Intergenic
1038832021 8:31072441-31072463 TAGCAAGAGAATGAGGTGGGTGG + Intronic
1038884031 8:31643129-31643151 AAGAATGAGAATGAGAATGGGGG + Intronic
1039366682 8:36935294-36935316 TAGAGTAGGAATGAGGGGGCTGG - Intronic
1039390854 8:37179863-37179885 GAGAAGAAGAAAGAAGAGGGAGG - Intergenic
1040399682 8:47036299-47036321 AAGAATGAGAGTGAGGTGGGAGG + Intergenic
1040564803 8:48555891-48555913 AAGAAAGAGAAAGAGGAGGGAGG - Intergenic
1041061551 8:54039706-54039728 TAGAAAAAGAACATGGAGGGGGG - Intergenic
1041166553 8:55098139-55098161 GAGAGTAAGAATGGGGAAGGAGG + Intergenic
1041554420 8:59136706-59136728 AAGAAAAGAAATGAGGAGGGAGG + Intergenic
1042110065 8:65371814-65371836 TTGAATAGGAATGATGAGAGTGG - Intergenic
1042438153 8:68792205-68792227 TAGAATTAGAATGATGAGAAAGG + Intronic
1042635615 8:70870007-70870029 TATGATATGAATGAGGAGGCTGG + Intergenic
1042826197 8:72982454-72982476 GAGACTTAGAATGAGGAGTGTGG - Intergenic
1042889335 8:73589969-73589991 GGGAAGAAGAAAGAGGAGGGAGG + Intronic
1042904786 8:73761712-73761734 TATAATAAGACTTTGGAGGGAGG - Intronic
1043729835 8:83662781-83662803 TAGAAAGAGAATGAGACGGGAGG + Intergenic
1043855012 8:85255092-85255114 GAGAAGAAGAAGGAGGAGGAAGG - Intronic
1044351945 8:91176738-91176760 TAGAACAAAAAGGTGGAGGGAGG - Intronic
1044784035 8:95775839-95775861 AAAAATAATAATGAGGAGGTTGG + Intergenic
1044985527 8:97753315-97753337 GAGAAGAAGAAGGAGGAGGTCGG + Intergenic
1045358754 8:101412946-101412968 TGGATTAAGAAGGAAGAGGGAGG - Intergenic
1045965816 8:108023066-108023088 TAAAATAAGAATGAAGAGAGAGG + Intronic
1046127727 8:109931203-109931225 TTGAGTAAGAATGAGATGGGAGG + Intergenic
1046152477 8:110246157-110246179 TTGAATAGGAATGAGGAGAGTGG + Intergenic
1046172548 8:110530033-110530055 TTGAATAAGAGTGATGAGAGTGG + Intergenic
1046238965 8:111465190-111465212 GAGACTCAGAATGTGGAGGGTGG + Intergenic
1046574103 8:116003916-116003938 TAAAACAAGAAACAGGAGGGAGG + Intergenic
1046684606 8:117211131-117211153 TTGAATAAGAGTGATGAGAGAGG - Intergenic
1046764071 8:118050869-118050891 AAGAATTAGAAGGTGGAGGGAGG + Intronic
1047189168 8:122662177-122662199 GAGCATAAGAGTGAGGGGGGAGG - Intergenic
1047580858 8:126213839-126213861 TTGAATAAAAATGTGGAGGAGGG + Intergenic
1047626041 8:126657109-126657131 AAGAGTAAGAATGAGGATGCTGG - Intergenic
1047774669 8:128059958-128059980 TAGAATAAGAATTTAGAGGCTGG + Intergenic
1048039211 8:130709176-130709198 GAGAATTAGAATGAGGAGGGTGG + Intergenic
1048081403 8:131132034-131132056 TAGGATAAGAATAAGCAAGGTGG - Intergenic
1048284451 8:133130916-133130938 TGGAGGAAGAAAGAGGAGGGGGG + Intronic
1048558914 8:135511391-135511413 AAGAATAATAATGAGGAGGATGG - Intronic
1048694395 8:137008904-137008926 CAGAATAAGCATGAGGAGGAAGG - Intergenic
1048811735 8:138294231-138294253 GAGAATCAGAAAGAGGAGAGTGG + Intronic
1048921865 8:139238668-139238690 TAGAATAAGAAGGTGGAGAATGG + Intergenic
1049974245 9:846535-846557 TAGAATAAGATTGGCTAGGGAGG - Intronic
1050169812 9:2803578-2803600 TTGAATAAGAAGGAAGAAGGTGG - Intronic
1050193511 9:3055487-3055509 TAGAATAAGATAAAGAAGGGAGG + Intergenic
1050226429 9:3462496-3462518 TTGAGTAAAAATGGGGAGGGAGG - Intronic
1050290362 9:4148165-4148187 TATAATAAGAAAAAGGGGGGAGG - Intronic
1050826334 9:9951105-9951127 TAGAATAAGATGTAGGAGGAGGG + Intronic
1051197734 9:14581570-14581592 TTGAATAAGAGTGGGGAGGCTGG - Intergenic
1051274322 9:15384370-15384392 TAGAATTAAAATGATGAGGCCGG + Intergenic
1051516716 9:17937925-17937947 TAACAGAAGTATGAGGAGGGGGG + Intergenic
1052099422 9:24426382-24426404 TAGAATATGAAAAAGGAGAGAGG - Intergenic
1052158951 9:25231039-25231061 TTGAATAAGAGTGATGAGAGAGG + Intergenic
1055101877 9:72474147-72474169 GAGAATATGTATGAGCAGGGAGG - Intergenic
1055131660 9:72782413-72782435 TTGAATAAGAATAGTGAGGGTGG - Intronic
1055491454 9:76808995-76809017 AAGAATATGAACTAGGAGGGAGG - Intronic
1056009902 9:82317043-82317065 TAGAACAAAAATGTGGAGGAAGG + Intergenic
1056240746 9:84644099-84644121 TAGAATAAAAAGGTGGAGGAAGG - Intergenic
1056958262 9:91099764-91099786 TAGAAAATGAAAGAGGAGGAGGG + Intergenic
1057937663 9:99254234-99254256 TAGGAGGAGAATGGGGAGGGTGG - Intergenic
1058196991 9:101989360-101989382 TTGAATAAGAGTGATGAGAGAGG - Intergenic
1058243105 9:102591845-102591867 TATAATGAGAAATAGGAGGGTGG - Intergenic
1058276495 9:103048042-103048064 GAGAATCAGAAGGGGGAGGGTGG + Intergenic
1059022843 9:110595574-110595596 TGGAATAAGAATGGTGAGAGAGG + Intergenic
1059179596 9:112199385-112199407 TAGAATAAGTAGGAGTAGGCTGG - Intergenic
1059677467 9:116553122-116553144 AAGAAGAAGAAAGAGGAGGAAGG - Intronic
1059855457 9:118392468-118392490 TAAAATAAAAATCAGGAAGGAGG - Intergenic
1061645385 9:131996751-131996773 TAGAGTAAGGAGGAGGAGGTTGG - Intronic
1062638457 9:137503850-137503872 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
1062638470 9:137504014-137504036 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
1185814985 X:3146310-3146332 AAGAAGAAGAAGGAAGAGGGAGG - Intergenic
1186138407 X:6544971-6544993 TTGAATAAGAGTGATGAGAGAGG + Intergenic
1186410713 X:9342600-9342622 AAGACTAAGAGGGAGGAGGGAGG - Intergenic
1186593601 X:10957024-10957046 TTGAATAGGAATGATGAGAGTGG - Intergenic
1186788035 X:12971585-12971607 GAGAAGAAGGAAGAGGAGGGAGG - Intergenic
1187029299 X:15469319-15469341 AAGAAAAAGAAAGGGGAGGGAGG - Intronic
1187117173 X:16364159-16364181 TTGAATAGGAATGATGAGAGAGG - Intergenic
1187319578 X:18227699-18227721 GAGAAAAAGAGAGAGGAGGGAGG + Intergenic
1187947026 X:24436020-24436042 TAGGATAAGGATGAGGTAGGAGG - Intergenic
1188228381 X:27630340-27630362 CAGAATAATAATGAGTAAGGAGG + Intronic
1188518605 X:31013468-31013490 TAGAGTAAGGATGGGGTGGGAGG - Intergenic
1188520596 X:31033695-31033717 TGGAAGAAGAATGAAGAGGCAGG - Intergenic
1188771093 X:34155563-34155585 TTGAATAAGAGTGATGAGAGAGG + Intergenic
1188796837 X:34477546-34477568 TTGAATAAGAATGATGAGAAAGG + Intergenic
1188900740 X:35730135-35730157 TCGAATAAGAATGGTGAGAGAGG + Intergenic
1189020234 X:37328996-37329018 TAGGAAAAGAAGGAGGAAGGGGG + Intergenic
1189209564 X:39273143-39273165 TTGAATAAGAGTGGTGAGGGAGG + Intergenic
1189213899 X:39306966-39306988 TGGGATAAGACAGAGGAGGGAGG + Intergenic
1189574256 X:42334272-42334294 TAGAATAGGAGTGATGAGAGAGG + Intergenic
1189998706 X:46664033-46664055 TAAAATAATAATGACGGGGGTGG + Intronic
1190369672 X:49728393-49728415 TTGAAGAAGAATGATGAGAGTGG + Intergenic
1190497179 X:51037847-51037869 TAGGAAAAGGATGAGGAGGAGGG + Intergenic
1190508961 X:51157591-51157613 GACTATAAGAATGGGGAGGGTGG + Intergenic
1190585872 X:51941338-51941360 TTGAATAAGAGTGATGAGAGAGG - Intergenic
1190668053 X:52713495-52713517 AAGAAGAAGAATAAGGTGGGAGG - Intergenic
1190671364 X:52744909-52744931 AAGAAGAAGAATAAGGTGGGAGG + Intergenic
1191020570 X:55855920-55855942 TTGAATAGGAGTGATGAGGGAGG + Intergenic
1191163638 X:57363602-57363624 TTGAATAGGAGTGATGAGGGTGG + Intronic
1192190437 X:68988209-68988231 AAGAATAAGAAAGGAGAGGGAGG + Intergenic
1192436443 X:71146103-71146125 AAGAAAAAGGAAGAGGAGGGAGG - Intronic
1192561388 X:72130288-72130310 AGGAACAAGAATGAGGAGGAAGG - Exonic
1193719108 X:84967413-84967435 TTGAATAAGAGTGATGAGAGAGG + Intergenic
1194620628 X:96166489-96166511 TAGAACAAGAATGAGCATTGAGG - Intergenic
1194636192 X:96347403-96347425 TTGAATAGGAATGGGGAGAGAGG + Intergenic
1194989293 X:100528203-100528225 TAGAATCAAAATGGGGAAGGAGG - Intergenic
1195058043 X:101165749-101165771 TAGAAGAAAAATCAGGAGGCTGG + Intergenic
1195711766 X:107778658-107778680 TAAACTAAGAAAGCGGAGGGGGG + Intronic
1196872710 X:120127849-120127871 TTGAATAACAAGGACGAGGGTGG + Intergenic
1196982160 X:121227009-121227031 TTGAATAAGAGTGATGAGAGAGG + Intergenic
1197099234 X:122632418-122632440 TTGAATAAGAATGGTGAGAGTGG + Intergenic
1197280983 X:124535592-124535614 TATAATAAGAATAATGAGGATGG - Intronic
1197327758 X:125115342-125115364 TTGAATAGGAGTGAGGAGAGAGG - Intergenic
1197368360 X:125595325-125595347 TTGAATAAGAGTGATGAAGGTGG - Intergenic
1197523050 X:127523598-127523620 TTGAATAGGAATGGTGAGGGAGG - Intergenic
1197607201 X:128597951-128597973 TAGAAGAAGGAAGAGCAGGGTGG - Intergenic
1197653496 X:129090442-129090464 TAGAAAGAGGATGAGGGGGGTGG + Intergenic
1197672343 X:129292037-129292059 TTGAATAGGAATGATGAGAGAGG - Intergenic
1197989999 X:132307816-132307838 TTGAATAAGAATGGTGAGAGAGG + Intergenic
1198038326 X:132823428-132823450 GAGACTCAGAAGGAGGAGGGTGG - Intronic
1198094141 X:133361833-133361855 AAGAGAAAGAATGAGGAGGCAGG + Intronic
1198467512 X:136916910-136916932 AAGAATAAGAAGAAGGAGGAGGG - Intergenic
1198744132 X:139872271-139872293 TAAAATAAAAATGTGGGGGGGGG + Intronic
1198806552 X:140500671-140500693 TAAAACAAGGAAGAGGAGGGAGG + Intergenic
1198852251 X:140977330-140977352 GAAAATAAGAAAGAGGAGGAGGG - Intergenic
1199028289 X:142965549-142965571 CAGAAAATGAATTAGGAGGGGGG - Intergenic
1199502813 X:148527746-148527768 TAGAATGAGGATGAGGTGGCGGG - Intronic
1199841465 X:151653691-151653713 AAGAAGAAGAAGGAGGAGGAGGG - Intronic
1200142016 X:153907118-153907140 TAGGGAGAGAATGAGGAGGGAGG - Exonic
1200738837 Y:6831310-6831332 AAGAAAAAGAAAGAAGAGGGAGG - Intergenic