ID: 929910954

View in Genome Browser
Species Human (GRCh38)
Location 2:46089185-46089207
Sequence ATGTAGAATAAGAATGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 582
Summary {0: 1, 1: 1, 2: 2, 3: 45, 4: 533}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929910954_929910959 3 Left 929910954 2:46089185-46089207 CCCTCCTCATTCTTATTCTACAT 0: 1
1: 1
2: 2
3: 45
4: 533
Right 929910959 2:46089211-46089233 GGGCAATTTCAACCTTCGCATGG 0: 1
1: 0
2: 0
3: 2
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929910954 Original CRISPR ATGTAGAATAAGAATGAGGA GGG (reversed) Intronic
900704369 1:4070702-4070724 ATGTAGAATCAGAGAGAGGAAGG + Intergenic
901179551 1:7331845-7331867 AAGCAGAATAAGAAGGACGAGGG - Intronic
901266828 1:7917248-7917270 AAGTAGAAAAAGAAGGTGGAGGG + Exonic
901723569 1:11220606-11220628 ATGTTTAATAAGATGGAGGAAGG + Intronic
903105046 1:21070514-21070536 ATTTAGAACAAGAATGAAGTAGG - Intronic
903109424 1:21117586-21117608 ATGAATAATAAGACTGAGGGAGG + Intronic
904276418 1:29387609-29387631 AAGAAGGATAAGAATGGGGAGGG + Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904797696 1:33069822-33069844 ATATAGAATGAGAGTGGGGAAGG - Intronic
905021593 1:34818731-34818753 ATCTAAAATCAGAATGAGGCCGG + Intronic
905636551 1:39557701-39557723 GTGTATAGTAAGAATCAGGAGGG - Intergenic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
907000032 1:50843239-50843261 ATGAAGAAAAAGAATTAGGTCGG - Intronic
909253659 1:73390571-73390593 AGTTAGAAGAAGAAGGAGGAAGG - Intergenic
909399008 1:75205027-75205049 AAGGAGAATAAGAATGCAGAAGG + Exonic
909953508 1:81748962-81748984 TCCTAGAATAAGAATGAGGCCGG - Intronic
910107447 1:83646752-83646774 ATGGAGAATAAACATGAGTAGGG - Intergenic
910671813 1:89781336-89781358 ATGTATAATAATAATAAAGATGG + Intronic
910919668 1:92330103-92330125 ATGAAGAATAAGAAACTGGACGG - Intronic
911525368 1:98978349-98978371 ATGGAGAAGAAGATTGAAGATGG - Intronic
911594944 1:99788831-99788853 GAGTAGAAACAGAATGAGGAGGG - Intergenic
912157335 1:106937911-106937933 ATGGAGAGAAAGACTGAGGATGG - Intergenic
912164651 1:107028858-107028880 GTGAAGAATAATAATGAAGAAGG + Intergenic
912228636 1:107766238-107766260 AAGAAGAAGAAGAAGGAGGAGGG - Intronic
912558721 1:110535026-110535048 ATAAAGAATAATAATGATGATGG - Intergenic
915090471 1:153420733-153420755 AGGTGGAATGAGAATGAGAAAGG - Exonic
915095019 1:153456370-153456392 AGGTGGAATGAGAATGAGAAAGG + Intergenic
915585399 1:156841352-156841374 AGGTAGATCAACAATGAGGAAGG + Intronic
916636847 1:166680054-166680076 ATGGAGACTGAGAAGGAGGAGGG - Intergenic
916662750 1:166937046-166937068 CTGTAGCATCAGAATAAGGATGG + Intronic
917198170 1:172488327-172488349 AACTAGAATAAGAATTAGGAGGG + Intergenic
917289553 1:173458463-173458485 ATGTAGAAAGAGAAAGAGTAGGG + Intergenic
918174526 1:182031194-182031216 AGGTAAAATAAGCATTAGGAAGG - Intergenic
918246337 1:182662936-182662958 CTGTAGATTGAGAATGGGGAGGG + Intronic
919003462 1:191864811-191864833 ATGTTGAATAACAATGGTGAAGG - Intergenic
919509113 1:198438908-198438930 ATGTAGAATAAGAAAGGGAGAGG + Intergenic
920044946 1:203127111-203127133 ATGAAGAGGAAGAAGGAGGAAGG + Exonic
920312181 1:205054941-205054963 ATGAGGAACAAGAATAAGGAAGG + Intronic
920559439 1:206928817-206928839 TTTTAGAATAAGGAGGAGGAGGG - Exonic
920790042 1:209081424-209081446 ATGTAGAATAAAGAGGAGGGAGG - Intergenic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
921504307 1:215948656-215948678 ATGTATAATAAAAATCAAGAGGG - Intronic
921511659 1:216038493-216038515 AAATAGAATAAGAAAGTGGAGGG - Intronic
921562753 1:216677945-216677967 TTGCAGCATCAGAATGAGGAAGG - Intronic
921703757 1:218296070-218296092 AGGTAAAATCAGAATGAGGATGG + Intronic
921795415 1:219338067-219338089 ACGTAAAATGAGAATGAGGAAGG - Intergenic
922350733 1:224732946-224732968 AAGAAAAAAAAGAATGAGGAGGG + Intronic
922403382 1:225285192-225285214 ATGTGGAATGTGAATAAGGATGG - Intronic
922653820 1:227363705-227363727 AAGTGGAAAAAGAATGAGGCCGG + Intergenic
923373869 1:233340492-233340514 ATTTAGAATGAGATTGAGAAGGG + Intronic
924222839 1:241895880-241895902 CTGAATAATAAGAATGTGGAAGG - Intergenic
924223070 1:241898131-241898153 CTGAATAATAAGAATGTGGAAGG - Intergenic
924832328 1:247610207-247610229 ATGTTGAATAACAGTGGGGAAGG - Intergenic
924870927 1:248043821-248043843 ATATAGAATAAAAAAGAGCATGG + Intronic
1063741413 10:8825595-8825617 GTGTAGAAAAAGACTGAGAAGGG + Intergenic
1064031038 10:11883041-11883063 AGGTAGAATGACAATGAAGATGG + Intergenic
1064053387 10:12077679-12077701 ATGTCAATGAAGAATGAGGAGGG + Intronic
1065955567 10:30690791-30690813 ATGTAGAATGAGGCTGAGGCTGG + Intergenic
1066409358 10:35151003-35151025 TTATAGAATAAGTAAGAGGAGGG + Intronic
1068173593 10:53426893-53426915 ATATTGAATAAGAATGAGACAGG - Intergenic
1069356605 10:67593793-67593815 ATGTTGAATAGGAGTGATGAGGG + Intronic
1069479893 10:68772173-68772195 ATGTATAATAATAATTAGGCTGG - Intronic
1069950708 10:72016340-72016362 AAGAAGAAAAAGAAAGAGGAAGG + Intergenic
1070167031 10:73906694-73906716 AGGCAGAAAAAGAGTGAGGAAGG + Intergenic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070758840 10:79010584-79010606 ATGAAGAGTAAGAGTGATGATGG - Intergenic
1070843607 10:79504941-79504963 AAGGAGACTAACAATGAGGATGG - Intergenic
1070902931 10:80046718-80046740 ATGTAGAAGAAGGAAGGGGAAGG + Intergenic
1070930059 10:80254659-80254681 AAGGAGACTAACAATGAGGATGG + Intergenic
1071332771 10:84576231-84576253 ATGGAGAAGAAAAACGAGGAGGG - Intergenic
1071604352 10:86974502-86974524 ATGAAGAAGAAGAGGGAGGAAGG - Intronic
1071702965 10:87962055-87962077 AGGTAGAATAAGAAATAGGAAGG - Intronic
1071786854 10:88910537-88910559 ATGTAGCATCAGAATTAGAAGGG - Intronic
1072009948 10:91293718-91293740 ATGTAGATTAAGAGGGAGGTAGG - Intergenic
1072200669 10:93155873-93155895 ATGGAGAATAAGAAAAAGGAAGG + Intergenic
1074616300 10:115072285-115072307 ATGTAAAATAAAAATAAAGAGGG + Intergenic
1075759581 10:124845907-124845929 CTGGAGAATGAGGATGAGGATGG - Intergenic
1077697465 11:4407271-4407293 ATGTTGAATAAGAGTGGTGAGGG - Intergenic
1077916554 11:6615397-6615419 ATGCAGGGTAAGAGTGAGGATGG - Intronic
1078092424 11:8273738-8273760 ATGTTGAATAATAATGATAATGG - Intergenic
1078987349 11:16608440-16608462 ATGAACAATAAGAAGGATGAAGG + Intronic
1079046554 11:17109368-17109390 TTGTTGAATAAGAATAATGATGG + Intronic
1079519290 11:21306451-21306473 AAGTATAATAATAATGATGATGG + Intronic
1080084965 11:28268443-28268465 ATGTACAATCAGAATGATAATGG - Intronic
1080357301 11:31464898-31464920 ATGTTGAATAAGAGTGGTGAAGG - Intronic
1080643361 11:34171155-34171177 GTGTAGAGTGAGGATGAGGATGG + Intronic
1080683554 11:34497055-34497077 TTGAAGAATCAGAAAGAGGATGG + Intronic
1080697371 11:34614350-34614372 TTGCATACTAAGAATGAGGATGG + Intergenic
1081385945 11:42473358-42473380 GTGTAGAATTAGGATAAGGAGGG + Intergenic
1081425664 11:42923912-42923934 ATGTTGAATAGGAATGGTGATGG + Intergenic
1082175858 11:49058645-49058667 ATATCAAATAAGAATGATGAGGG - Intronic
1084465199 11:69319250-69319272 ATGAAGAATATGAGAGAGGAAGG - Intronic
1084554433 11:69867530-69867552 ATGGAGCATCAGAATGGGGAAGG - Intergenic
1085685216 11:78615459-78615481 AGGTAGAAGAAGAATATGGAAGG - Intergenic
1086429493 11:86721540-86721562 AAGTAGACTAAGAGGGAGGAGGG + Intergenic
1086604463 11:88679897-88679919 AAGAAGATGAAGAATGAGGAAGG - Intronic
1087260215 11:96002665-96002687 ATGAAGAATAATGATGGGGATGG + Intronic
1087386058 11:97470538-97470560 ATTTAGAATACAAATGAAGATGG + Intergenic
1087771667 11:102217284-102217306 ATTTAGAAAAATAATGAGAAAGG + Intronic
1087968211 11:104445953-104445975 ATCTAGAAGAAAATTGAGGAAGG - Intergenic
1089447366 11:118564224-118564246 AAGGAGAATAACAGTGAGGAAGG - Intronic
1089761727 11:120731098-120731120 ATGTTGAATAAAAGTGGGGATGG + Intronic
1089917701 11:122174778-122174800 ATGAGGAATAAGAATAAGAATGG + Intergenic
1091310555 11:134572595-134572617 ATTTAGAATAAAAATGAGTGAGG - Intergenic
1091485945 12:888539-888561 ATGTAGGATTAGACTGTGGAAGG + Intronic
1092307259 12:7314140-7314162 ATGTAGAAGATGAAGGAAGAAGG + Intronic
1092589678 12:9940367-9940389 ATGTAGTCTAAAAATTAGGAGGG - Intergenic
1093388424 12:18587163-18587185 ATGTTGAATAGGAGTGATGAGGG - Intronic
1093693487 12:22134092-22134114 ATGTTGAATAGGAGTGATGAGGG - Intronic
1093757986 12:22874195-22874217 GTGTAGAGAAAGAAGGAGGAGGG - Intergenic
1094232411 12:28122324-28122346 AAGAAGCAGAAGAATGAGGAGGG + Intergenic
1095779866 12:46047860-46047882 ATGTAGTAAAAGAAACAGGAGGG + Intergenic
1096087196 12:48873679-48873701 AGCTGGACTAAGAATGAGGAGGG + Intergenic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1097604135 12:61731556-61731578 AAGTAAAAGAAGAATGAGCAGGG - Intronic
1097879886 12:64677120-64677142 GTGTAAATGAAGAATGAGGAAGG - Intronic
1098017834 12:66125182-66125204 ATGTAGAAGATAAATGAGAAGGG + Intronic
1098088240 12:66871798-66871820 AACTAGAATAAGATTGAGTAAGG + Intergenic
1098352366 12:69576977-69576999 ATGTGGAATAAGAATTATGATGG + Exonic
1098437390 12:70482263-70482285 ATGAAGAGCAAGAATAAGGATGG - Intergenic
1098495878 12:71135279-71135301 AAGAAGAAGAAGAAGGAGGAGGG + Intronic
1098588223 12:72181061-72181083 AGGTAGAAGAAGACTGAGAATGG + Intronic
1099359290 12:81679560-81679582 ATGTAGAAGATGAATGAAAAGGG + Intronic
1099938035 12:89151387-89151409 ATGAAGACTCAGAATGGGGAGGG + Intergenic
1100121954 12:91378912-91378934 ATTGAAAATAAGAATGTGGAGGG - Intergenic
1100715472 12:97301159-97301181 ATGGACAATAAAAATGTGGAAGG - Intergenic
1100900633 12:99236697-99236719 ATGTTGAATAGGAATAAGGAGGG + Intronic
1101142151 12:101807392-101807414 ATTTTGAATAAGAATGGTGATGG - Intronic
1101278895 12:103229642-103229664 ATGGAAAATAAAAATGTGGAAGG - Intergenic
1102243651 12:111341607-111341629 ATGCAGAAGGAGAGTGAGGAGGG + Intronic
1102754701 12:115328044-115328066 ATGTGGAAGAAAATTGAGGAAGG - Intergenic
1103840960 12:123863923-123863945 ATGTAAGAGAAGAATGAGGTAGG + Intronic
1104189823 12:126469595-126469617 ATGTTGAACAAGATTCAGGAAGG + Intergenic
1104274741 12:127315735-127315757 ATGTTGAATAAGACTGATAAAGG - Intergenic
1104550045 12:129748347-129748369 ACGGAGAATGAGACTGAGGAGGG + Intronic
1106014974 13:25860335-25860357 ATAAATAATAATAATGAGGAAGG - Intronic
1106206768 13:27604421-27604443 GTAAAGAATAAGAATAAGGAGGG + Intronic
1107684201 13:42880276-42880298 ATTTAGAGCAAGAATAAGGAAGG - Intergenic
1109167937 13:59058960-59058982 ATGTAGAATGGGAATGAAGACGG + Intergenic
1109399010 13:61800055-61800077 ATGGAGAATGAGAAGGAGAATGG + Intergenic
1110002766 13:70226483-70226505 ATGTAGAATAAAAAGAATGATGG - Intergenic
1111096223 13:83518544-83518566 ATGGAAAAGAAAAATGAGGAGGG + Intergenic
1111218462 13:85175369-85175391 CTGCTGAAGAAGAATGAGGAAGG + Intergenic
1112185224 13:97121648-97121670 AAAGAGAATAAGAATGTGGAAGG - Intergenic
1112383761 13:98918793-98918815 AAGTAGAACAAGAAAGAGGAAGG + Intronic
1112482682 13:99791605-99791627 CTGTAAAATAAGAGTAAGGATGG + Intronic
1112597305 13:100819287-100819309 ATGTAAAATAAAATTTAGGAGGG + Intergenic
1112722881 13:102265141-102265163 ATGGAGGATGAGAATGAGAAAGG - Intronic
1112757973 13:102660935-102660957 ATATAGAAAAAGAATGAAGTTGG + Intronic
1113329591 13:109315543-109315565 AAGTTGAATAAGGATGTGGAGGG - Intergenic
1113673189 13:112188868-112188890 CTGTAGACTAGGAAAGAGGAAGG + Intergenic
1114151452 14:20044555-20044577 ATGTCAAATAATAATCAGGACGG - Intergenic
1114737886 14:25061751-25061773 ATAAAGAAAAAGAAAGAGGAAGG + Intergenic
1115725441 14:36210550-36210572 ATGTAGAGTAAGAAAGAGAAGGG + Intergenic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1117872474 14:60215740-60215762 ATGGAGAATGTGAATGAGGTTGG - Intergenic
1118385585 14:65253139-65253161 ATGTGGAATAAGAATGTGGTGGG + Intergenic
1118522938 14:66607091-66607113 ATGAATAATAAGAATGAATAAGG + Intronic
1119552274 14:75523629-75523651 ATGTCGGATGAGAAAGAGGAGGG - Intronic
1119722331 14:76899642-76899664 AGCTAGAACAAGAGTGAGGAGGG + Intergenic
1119925383 14:78488764-78488786 ATGAAGAAGAAGAAAGGGGAGGG + Intronic
1120120522 14:80674330-80674352 CTCTATAATAAGAATGATGATGG - Intronic
1120668029 14:87330335-87330357 AATGAGAATAATAATGAGGATGG - Intergenic
1121878621 14:97478741-97478763 ATGTAGAATAGGAAAGAAAAGGG + Intergenic
1121880853 14:97499256-97499278 ATTTAGAAGAAGAAGGAAGAAGG + Intergenic
1122001576 14:98661061-98661083 ATGTAAAATAAGAATAAGCAAGG + Intergenic
1125076924 15:35630315-35630337 AAGTAAAAAAAGAAGGAGGATGG + Intergenic
1125470091 15:39993924-39993946 ATGTTGGATGAGAATTAGGAAGG + Intronic
1125470099 15:39993975-39993997 ATGTTGGATGAGAATGAGGAAGG + Intronic
1125612590 15:40981934-40981956 AGGGAGGAGAAGAATGAGGAAGG - Intronic
1125621154 15:41063391-41063413 AAGTAGAAAAACAATTAGGAAGG + Intronic
1126403315 15:48296647-48296669 ATGAGGAACAAGGATGAGGAAGG + Intronic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1127762634 15:62153962-62153984 AGGTAGAAGAAAAATGGGGAAGG + Intergenic
1128160521 15:65420746-65420768 CTGTAGAAGGAGAATGATGATGG - Intronic
1128720752 15:69946636-69946658 AGGTAGAATAAGAATCAAGAAGG + Intergenic
1130617959 15:85430682-85430704 AATTAGGATAAGAATGAAGAAGG - Intronic
1130690286 15:86076347-86076369 ATGTTGAATAGGAAAGAGCAAGG + Intergenic
1131656562 15:94466548-94466570 ATTCAGGATAAGAATAAGGAAGG - Intronic
1132219049 15:100091276-100091298 ATGAAGAATAATTATGAGGTAGG + Intronic
1134194837 16:12151664-12151686 ATGTAAAACCATAATGAGGAGGG - Intronic
1134264608 16:12682415-12682437 CTGTAGAATATGCAAGAGGAGGG + Intronic
1136318713 16:29468721-29468743 GTGAAGACAAAGAATGAGGAGGG + Intergenic
1136433285 16:30208065-30208087 GTGAAGACAAAGAATGAGGAGGG + Intronic
1136730863 16:32411131-32411153 ATGTTGAATAAGAGTGGTGAGGG + Intergenic
1137002070 16:35237837-35237859 ATGCAGAATCAGAATGAAGTAGG - Intergenic
1137011581 16:35326999-35327021 ATGCGGAATAAGAATGAAGCAGG - Intergenic
1137018390 16:35397988-35398010 ATGTGGAATCAGAATGAAGCAGG - Intergenic
1137593027 16:49705424-49705446 TTGCAGAACAAGAATGTGGATGG + Intronic
1137914234 16:52411399-52411421 AAATAGATTTAGAATGAGGAAGG - Intergenic
1138337849 16:56267138-56267160 AGGTAGAAGAAGAGGGAGGAGGG + Intronic
1139640817 16:68290280-68290302 AAGGAGAATAGGAAAGAGGAAGG - Intronic
1140761598 16:78113825-78113847 AAATAGAATGAGGATGAGGATGG + Intronic
1141215128 16:82016603-82016625 AGGTAGAATAACACTGAGAAGGG - Intergenic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1202995534 16_KI270728v1_random:106138-106160 ATGTTGAATAAGAGTGGTGAGGG - Intergenic
1203022221 16_KI270728v1_random:418480-418502 ATGTTGAATAAGAGTGGTGAGGG - Intergenic
1142906401 17:3045315-3045337 ATGTAGACTAAGAAGTGGGAGGG - Intergenic
1142930719 17:3282022-3282044 ATGGAGAAAAACAATGAAGAGGG - Intergenic
1143448774 17:7023507-7023529 ATGAACAAGAAGAATTAGGAGGG + Intronic
1143901925 17:10181024-10181046 GTCTAGAATAAGGATGAGGGTGG + Intronic
1143993614 17:10988128-10988150 GTGTAGAAGAGGAATAAGGAAGG - Intergenic
1145262360 17:21361970-21361992 TGGTAGAAGAAGAAAGAGGAGGG - Intergenic
1147000306 17:37358046-37358068 AAGTAGAAACAGAATCAGGAAGG + Intronic
1147788499 17:42997829-42997851 AACTAGAATAAGCATGAGGGAGG - Intergenic
1148299076 17:46530442-46530464 ATCTGGAATAGGAAAGAGGAGGG + Intronic
1148616230 17:49002142-49002164 ATGTTGACTAAAAATGAGGTGGG + Intronic
1148682730 17:49484025-49484047 ATGGAGAAGAAGAGAGAGGAAGG - Intergenic
1148891883 17:50813560-50813582 AGGTAGTAGAAGAATTAGGAAGG + Intergenic
1149003770 17:51783583-51783605 AAGGAGAATAAGAAAGAAGAAGG + Intronic
1149652843 17:58287909-58287931 ATTTTTAAAAAGAATGAGGAAGG - Intergenic
1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG + Intergenic
1150472424 17:65448474-65448496 CTGTAAGATAAGAATGAGGGTGG + Intergenic
1151947537 17:77327730-77327752 ATTTAGAAAAAAAAAGAGGAGGG - Intronic
1151998187 17:77625399-77625421 ATGTTGAATAAGAGTGGTGAGGG + Intergenic
1153405093 18:4729134-4729156 ATGTAGGATAACAGTGAGTAGGG - Intergenic
1154957757 18:21276065-21276087 AAACAGAATGAGAATGAGGAAGG - Intronic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1156665012 18:39394182-39394204 ATGTTGAATAAGAGTGAGAGAGG - Intergenic
1156768543 18:40689609-40689631 AAGGAGAAAAAGAAGGAGGAGGG - Intergenic
1157543338 18:48528838-48528860 CTGTAAAATGAGAATGATGATGG + Intergenic
1157669416 18:49515737-49515759 ATGTCCTATAAGAATGAGAATGG + Intergenic
1157769054 18:50328442-50328464 ATGTAGTATAATAATTAGAAGGG + Intergenic
1158313547 18:56185491-56185513 AGGTAGAATAAAAAAGAGAAAGG + Intergenic
1158549393 18:58422319-58422341 TTCTGGAAGAAGAATGAGGAAGG - Intergenic
1159338860 18:67108199-67108221 AGGTAGAATAATAATGAAGAAGG + Intergenic
1159391302 18:67796041-67796063 AAGGAGAATGAGAATGAGAATGG - Intergenic
1159483314 18:69019758-69019780 ATGTTGAATAGAAATGACGAGGG + Intronic
1161509589 19:4663113-4663135 CTGTAGAATGAGGATGAGGTGGG - Intronic
1161509719 19:4663640-4663662 CTGTAGAATGAGGATGAGGTGGG - Intronic
1161890543 19:7032933-7032955 ATTCAGAGTAGGAATGAGGATGG - Exonic
1161890908 19:7037800-7037822 ATTCAGAGTAGGAATGAGGATGG + Exonic
1161892628 19:7051661-7051683 ATTCAGAGTAGGAATGAGGATGG - Exonic
1161892991 19:7056261-7056283 ATTCAGAGTAGGAATGAGGATGG + Exonic
1162010056 19:7807667-7807689 AGGTAAAATGAGAATGAGGGCGG - Intergenic
1162139466 19:8577264-8577286 ATCTGGAAGAAGAAAGAGGAGGG - Intronic
1162254900 19:9482415-9482437 AAGTATAATAAAAATAAGGAAGG + Intronic
1162422362 19:10573089-10573111 CTGCAGAGAAAGAATGAGGAGGG + Intronic
1164143759 19:22497072-22497094 AAATAGAATAAAAATGATGATGG - Intronic
1164441853 19:28284985-28285007 ATGAAGGAGAAGAAGGAGGATGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1167608262 19:50493215-50493237 AGGTAGAAGGAGAATGGGGAGGG + Intergenic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
1168701363 19:58441462-58441484 AAGTGGAATAAGCATGAGTAGGG + Intergenic
925243977 2:2362810-2362832 ATGTACCATATTAATGAGGATGG - Intergenic
926893104 2:17655227-17655249 ATGATGAAAATGAATGAGGATGG + Exonic
926961272 2:18360894-18360916 TTGTGGAATAAGTTTGAGGAAGG + Intronic
927002024 2:18806331-18806353 ATCTAAAATAAGAATGTGGCAGG + Intergenic
927041129 2:19231366-19231388 ATGTAAAGTAAGAATGACAATGG + Intergenic
927235619 2:20871882-20871904 AGGTAGCAAAAGAATGAAGAAGG + Intergenic
927273461 2:21239463-21239485 ATGGAGAAGAAGAAGAAGGAAGG - Intergenic
928576596 2:32661802-32661824 ATGTTGAATAGGAATGGTGAGGG + Intronic
928746750 2:34424904-34424926 AGGTAGAATAGGAAAGAGAAAGG + Intergenic
928773384 2:34729484-34729506 ATGTAGAATAATAGATAGGATGG - Intergenic
929269055 2:39952739-39952761 ATCTGTAAAAAGAATGAGGAAGG + Intergenic
929868832 2:45740772-45740794 AGGTAGAATCAGAATGAGGCAGG - Intronic
929910954 2:46089185-46089207 ATGTAGAATAAGAATGAGGAGGG - Intronic
929988470 2:46762845-46762867 ATGAAGAAAATGAATGAGAATGG - Exonic
929997791 2:46839833-46839855 ATGTGGTAGAAGAATGAGGTGGG + Intronic
930309555 2:49722151-49722173 ATGTAGAATACAAATGAAAACGG + Intergenic
930436414 2:51349418-51349440 ATTTTGAAAAAGAATGAGGTTGG + Intergenic
930530534 2:52582878-52582900 ATGAGGAATAAGAATTATGAAGG - Intergenic
930624306 2:53679469-53679491 ATGGAGAAGAAAGATGAGGATGG - Intronic
930731908 2:54735973-54735995 AGGTGGAAAAAGAATGGGGAAGG + Intronic
930732432 2:54741133-54741155 CTGGACAATAAGAATGAGGAGGG - Intronic
932307207 2:70712622-70712644 ATGTGGAAGAAGAATTAGGCTGG + Intronic
932460755 2:71880435-71880457 ATGTAGAGGGAGCATGAGGAAGG - Intergenic
932486061 2:72085101-72085123 ATGTAGAATGAGAAGCAGGGTGG + Intergenic
932641745 2:73454767-73454789 TTGTAGAATAAAAATGTGCAGGG - Intronic
932993136 2:76812797-76812819 AGGAAGAATAAGGAGGAGGAGGG - Intronic
933002700 2:76945917-76945939 GTGAAGAACAAGAATGAGAAGGG - Intronic
933130836 2:78672806-78672828 CATTAGAATAAGAATAAGGATGG + Intergenic
934128564 2:88922830-88922852 ATGAAGAAAAAGGAGGAGGACGG + Intergenic
935551182 2:104457066-104457088 ATGTAAAATGAAAATGAGTATGG - Intergenic
936268604 2:111030929-111030951 GAGTAAAATAAGAATGAAGAAGG - Intronic
936727947 2:115344921-115344943 AAGTAGAGTAAGAGAGAGGAAGG - Intronic
936894860 2:117415808-117415830 ATGTTGAATAAAAGTGGGGAGGG + Intergenic
937533216 2:122854917-122854939 ATGTAGAATGATAGTGAGAAAGG - Intergenic
939430451 2:142099074-142099096 ATATAGAATAAAAATGAGAATGG + Intronic
939468212 2:142585393-142585415 ATGAAGAATAACCATGAAGATGG + Intergenic
939918717 2:148081782-148081804 ATGTAGAATAAGAATGGGGAAGG - Intronic
940077247 2:149756178-149756200 AGATAGCATAAGAAGGAGGAAGG - Intergenic
940545974 2:155085858-155085880 ATGCAGACTCAGAAGGAGGAGGG + Intergenic
940556348 2:155233362-155233384 ATGTATAATATGAATGCAGAAGG - Intergenic
941399804 2:165016735-165016757 ATGTATATTTAGAAAGAGGAAGG - Intergenic
942756311 2:179345428-179345450 TTGTACAAGAAGAAGGAGGAAGG - Intergenic
942761397 2:179402539-179402561 ATATAGAATAAGAAAGATTAAGG - Intergenic
943173213 2:184431688-184431710 ATGTAGAAGAGGAATCAGAATGG + Intergenic
943218704 2:185075782-185075804 ATGTAGAATGAGGAGGAGGAGGG + Intergenic
943789917 2:191920862-191920884 ATGATGGATAAGGATGAGGAAGG + Intergenic
944698711 2:202226791-202226813 ATGTACAATATTCATGAGGAGGG + Intronic
944752815 2:202728642-202728664 AAGTAGAATAGGGATTAGGATGG + Intronic
945801741 2:214441190-214441212 ATGCACAATAAGAAAGAGAAGGG + Intronic
946115496 2:217458427-217458449 AAGGAGAATAAGAAAGAGGCTGG - Intronic
946349214 2:219137713-219137735 ATGGAAAATAAGAATAAGAATGG - Intronic
946849015 2:223886901-223886923 ATCTAAAATAAGAAATAGGAAGG - Intronic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
947245792 2:228046905-228046927 ATGTGGAATCATAATGAGGTTGG - Intronic
947952006 2:234156235-234156257 AAGAAGAAAAAGAAAGAGGAGGG - Intergenic
947985892 2:234447136-234447158 TTGGAGTAGAAGAATGAGGATGG + Intergenic
1171093127 20:22305024-22305046 ATGGAAAAGAAGAAAGAGGAAGG - Intergenic
1172602381 20:36192797-36192819 ATGTAGAGTAGCCATGAGGAGGG + Intronic
1173707420 20:45122651-45122673 ATGAAGAAGAAGAAGGAGGGAGG - Intergenic
1174523699 20:51154910-51154932 AAGTGGACTAAGAGTGAGGAAGG - Intergenic
1174694908 20:52547353-52547375 ATGTTGAATAGGAATGGTGAGGG - Intergenic
1174725341 20:52855838-52855860 ATGAAGAAAAACAATGAGGAAGG - Intergenic
1174849093 20:53974454-53974476 ATGTGGAATAAAAATTAGAATGG - Intronic
1174923231 20:54727644-54727666 AAGGAGAAAAACAATGAGGATGG - Intergenic
1175479915 20:59303385-59303407 ATGCAGGATAAGAATCAGAAAGG - Intronic
1176328747 21:5527122-5527144 CTGTAGAATAAAAATTAGGCTGG - Intergenic
1176399010 21:6293829-6293851 CTGTAGAATAAAAATTAGGCTGG + Intergenic
1176438147 21:6695275-6695297 CTGTAGAATAAAAATTAGGCTGG - Intergenic
1176462409 21:7022345-7022367 CTGTAGAATAAAAATTAGGCTGG - Intergenic
1176485970 21:7404123-7404145 CTGTAGAATAAAAATTAGGCTGG - Intergenic
1177279720 21:18965384-18965406 AAATAGAATAAAAATGATGAAGG + Intergenic
1177469542 21:21540582-21540604 ATCTAGAATAAGAATGAAACAGG - Exonic
1178226277 21:30722866-30722888 TTGTAAAAAGAGAATGAGGATGG - Intergenic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1180239100 21:46487452-46487474 ATGTGTAATAAGAATGGGCATGG - Intronic
1180861083 22:19083388-19083410 GTGAAGAAGAGGAATGAGGAGGG - Intronic
1181693147 22:24577280-24577302 ATGAAGAATAAGACTGGGGGTGG + Intronic
1182637411 22:31739514-31739536 ATGCAGGATAAAAATCAGGAAGG - Intronic
1182791109 22:32953830-32953852 ATGTTGATGAAGAAGGAGGAGGG - Intronic
1182806383 22:33074172-33074194 ATAAAGAAGAAGAGTGAGGAGGG - Intergenic
1183285619 22:36960890-36960912 AAGTGGAATGAGAATGAGGGTGG - Intergenic
1184805157 22:46790381-46790403 ATTAAGAATACGAATGAGGTGGG - Intronic
1184980226 22:48090411-48090433 TTGTAAAAGAAGAATGAGAATGG + Intergenic
1185408317 22:50670040-50670062 ATTTAGAAAAAGAATCAGGCTGG + Intergenic
950320188 3:12044670-12044692 ATGTAGACTTATAATGAAGAGGG - Intronic
950675998 3:14554814-14554836 CTGCACAATCAGAATGAGGATGG + Intergenic
951232717 3:20198513-20198535 ATTTGGTATAAGAGTGAGGAAGG + Intergenic
952047335 3:29338731-29338753 TTATGGAATAAGGATGAGGAAGG - Intronic
953939963 3:47085445-47085467 AGGTTGTCTAAGAATGAGGAGGG - Intronic
954000151 3:47550124-47550146 ATGAAGAAGAAGAAGGAGAAGGG - Intergenic
954005315 3:47585940-47585962 ATGGAGAAAATGAATGAAGAAGG - Exonic
954056100 3:48027209-48027231 ATGTAAAATAAAAAAGAGTAAGG + Intronic
954893837 3:53958336-53958358 CTGTTGAAGAAGACTGAGGAGGG - Intergenic
954952064 3:54484270-54484292 ATGGAGAATAGGAAGGAGAATGG - Intronic
957192623 3:77029351-77029373 ATGTAGAAGAAAAATGATGAGGG + Intronic
958605932 3:96358471-96358493 ATGTTGAATAGGAATGAGGTGGG + Intergenic
958624161 3:96603370-96603392 ATGTTGAATAAGAGTGGTGAGGG + Intergenic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959365312 3:105450954-105450976 ATGTAGAGGGAGAATTAGGATGG + Intronic
959577719 3:107952286-107952308 ATTTAGAAGAAGAATAAGGAGGG + Intergenic
961177213 3:124845497-124845519 GTGAAGAATGAGAATGTGGAAGG - Intronic
961227536 3:125265893-125265915 ATGTAAAACAAGAAAGAGTAGGG + Intronic
961414730 3:126749039-126749061 AAGGAGACAAAGAATGAGGAGGG + Intronic
961488250 3:127232546-127232568 ATGCAGGATGAGATTGAGGAGGG - Intergenic
961935986 3:130584444-130584466 TTCTAGAATGAGAATGAGGAGGG - Intronic
962672101 3:137718856-137718878 ATGTTGAATAAGAGTGGTGAGGG + Intergenic
963896889 3:150695993-150696015 ATTTTGAAAAAGAATAAGGAGGG + Intronic
963974762 3:151468322-151468344 ATTTAAAATGAGAATGAGAAAGG - Intergenic
964799227 3:160535020-160535042 ATGTAGATTAAGATTAATGACGG - Intronic
965148317 3:164936065-164936087 GTGCATAATAAGAATGAAGAAGG - Intergenic
965301827 3:167014490-167014512 ATGTAGAATGAGAAATGGGAAGG - Intergenic
965477576 3:169176319-169176341 ATGAAATATAAGAATGAGGTAGG + Intronic
965550775 3:169962850-169962872 ATGAAGAAGAAGAAGGAGCAAGG - Intergenic
965690783 3:171354675-171354697 ATGTAGATTAAGACTGCTGAGGG + Intronic
966316573 3:178653399-178653421 ATAAAGAATAAGAATTAGAAGGG - Intronic
966373908 3:179276128-179276150 ATGTAGGACAAGAATGGAGAGGG - Intergenic
966531983 3:180991263-180991285 AGGTATCATGAGAATGAGGAAGG - Intergenic
966564320 3:181359467-181359489 ATGCTGAATAAGATTGAAGAGGG + Intergenic
966905010 3:184515792-184515814 ATGTTGAATAATAATGATCATGG + Intronic
968466777 4:755874-755896 CTGAAGAAGAAAAATGAGGAGGG - Intronic
969072032 4:4547265-4547287 ATCTAGAACAAGAATCAGGTAGG - Intergenic
971303382 4:25460480-25460502 ATGTAGAAAATGAAAAAGGAGGG - Intergenic
971399322 4:26261429-26261451 AAGTAGAAAAGAAATGAGGAAGG + Intronic
971688771 4:29805312-29805334 GTGTAAGATAAGAAAGAGGAAGG - Intergenic
972134476 4:35875076-35875098 ATTAAAAATAAGTATGAGGATGG + Intergenic
973059413 4:45701994-45702016 ATGTAGAAAAACAATGACTATGG + Intergenic
973128324 4:46617322-46617344 GTGGAAAAGAAGAATGAGGAAGG + Intergenic
973544080 4:51962787-51962809 AAGAAGAAGAAGAATGAGAAAGG - Intergenic
973555809 4:52081560-52081582 ATGGAGAATAAGAATAAAAAGGG - Intronic
973656845 4:53056832-53056854 AGGAAGAGTAATAATGAGGAAGG + Intronic
973996225 4:56462124-56462146 ATGAAGAATCAAAATGAGGACGG + Intergenic
974239901 4:59233535-59233557 ATGTTGAATAAGAGTGATAAGGG + Intergenic
974347669 4:60702607-60702629 ATGTAGACTAATAGGGAGGAAGG + Intergenic
975077297 4:70226992-70227014 ATTTAGAAGAAGAAAGAGGCAGG - Intronic
975829562 4:78355301-78355323 ATGTATAATAAGTATGTGGGGGG - Intronic
975938713 4:79614148-79614170 ATGTAGAATTAAGATAAGGATGG - Intergenic
976366110 4:84234139-84234161 ATGGAGAATAAAAATGATGAAGG + Intergenic
977656404 4:99526034-99526056 ATGTTGAATAGAAATGATGAGGG + Intronic
978835350 4:113142722-113142744 ATGAAGAAAAAGAAAGAGGGGGG + Intronic
979012685 4:115391362-115391384 ATGTTGAATAGGAATGATGAGGG - Intergenic
979048927 4:115904848-115904870 ATGTTGAAGGAGAATGAAGAGGG + Intergenic
979430159 4:120619954-120619976 ATGTAGAATAAGAATAAATTTGG - Intergenic
980105542 4:128584848-128584870 TTGGAGAATTAGACTGAGGATGG + Intergenic
980242595 4:130196412-130196434 ATATAGAATAAGAATGATAAGGG - Intergenic
980395671 4:132211733-132211755 ATGAAGTATAAGAAATAGGAAGG + Intergenic
981166710 4:141567730-141567752 CTGTAGGATCAGAATGGGGAGGG - Intergenic
981309443 4:143282410-143282432 ATAAAGATTAAGAAAGAGGAGGG + Intergenic
981454758 4:144940567-144940589 CGGTAGAATAGGAATGAGGATGG - Intergenic
981491158 4:145340792-145340814 ATGTTAAATAAGGATGAGGATGG + Intergenic
981766654 4:148258470-148258492 ATCTAGACCAAGAATGGGGAAGG - Intronic
981818521 4:148859221-148859243 ATGTTGAAAATGAATGATGATGG + Intergenic
982855964 4:160383500-160383522 ATGAAAAACAAGAATGGGGAGGG - Intergenic
983172052 4:164547322-164547344 ATGTTGAATAAGAGTGGTGAGGG - Intergenic
983193403 4:164778957-164778979 ATGTAAAATAATATTGAGAATGG + Intergenic
983712051 4:170730277-170730299 AAATAAAATAAAAATGAGGATGG + Intergenic
983990322 4:174110856-174110878 CTGTATAATAAGAATGAAAAAGG - Intergenic
984076018 4:175180876-175180898 ATGTTGAATAGGAGTGATGAAGG + Intergenic
984736478 4:183113268-183113290 ATGTAGAAACAGAGGGAGGAGGG + Intronic
984937914 4:184905543-184905565 ATGTGGAATAAGGATGAGGATGG - Intergenic
985733020 5:1561470-1561492 TTGGATAATAAGAATGTGGAGGG + Intergenic
986252044 5:6068975-6068997 ATGTCCCATAGGAATGAGGATGG + Intergenic
986656724 5:10020186-10020208 TTGTAAAATAGGAATGAGGATGG + Intergenic
987055703 5:14189426-14189448 CTGTAGAATTGGATTGAGGAGGG + Intronic
987430242 5:17824184-17824206 ATGTTGAATAAGAGTGATGAGGG - Intergenic
988307461 5:29511216-29511238 ATTAAGAATAAGAATAAAGATGG - Intergenic
988626456 5:32880670-32880692 ATGTTGAATAAGAGTGGTGAGGG + Intergenic
988975537 5:36512135-36512157 ATGTTGAATAAGAGTGGTGAGGG - Intergenic
988976123 5:36517264-36517286 ATGTAGAAAAAGAAGTAAGATGG - Intergenic
989252150 5:39329909-39329931 ATGTATAATAATAATGAGTTTGG + Intronic
989760659 5:45012318-45012340 ATATTGAAAAAGAATAAGGAAGG - Intergenic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990897708 5:60716402-60716424 ATGTTGAATAAAAATAATGAAGG - Intergenic
991536829 5:67678498-67678520 GAGTAGAATAAGAAAGAGAATGG + Intergenic
991584163 5:68185909-68185931 ATTTAAAATAAGAATGACAATGG + Intergenic
992892466 5:81216164-81216186 ATGCAGATTAAGAATTAAGAAGG + Intronic
994214748 5:97125156-97125178 TTGTAGAATAAGCAGGAGGCTGG + Intronic
994798597 5:104339934-104339956 ATTTACAACAAGAAAGAGGAAGG - Intergenic
995394996 5:111678076-111678098 ATGTAGTATGAGAATAAGGTAGG - Intronic
996028025 5:118672012-118672034 AAGTAGAACAATAATGAGTAAGG - Intergenic
996811716 5:127522930-127522952 ATTTAAAATAAAAATGAGGCTGG - Intronic
996942280 5:129022657-129022679 TTACAGAATAAAAATGAGGAGGG + Intronic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
998922583 5:147085816-147085838 ATTTGCAATAGGAATGAGGAAGG + Intergenic
999115265 5:149157433-149157455 ATAAAGAATCAGAAGGAGGAAGG - Intronic
1000839020 5:166193129-166193151 ATGCAGATTAAGAATGGGGAAGG + Intergenic
1001363989 5:171118957-171118979 ATGTTGAATAAGAGTGAGAGTGG + Intronic
1001853999 5:174995041-174995063 ATGGAGAATAAGTATAAAGATGG + Intergenic
1002652548 5:180711271-180711293 ATGAAGAATAATAATGAGAATGG + Intergenic
1002953670 6:1841141-1841163 ATGTAGTAAAAGAATAAGGGTGG + Intronic
1004027520 6:11833603-11833625 GTGAAGAATCAGAGTGAGGAAGG + Intergenic
1004090754 6:12498240-12498262 ATAAATAATAATAATGAGGAAGG + Intergenic
1005213665 6:23499145-23499167 ATGTAGAAAAAGAATGGACAAGG - Intergenic
1005364762 6:25065762-25065784 ATGTTTAATAAGAATAAAGATGG - Intergenic
1005433590 6:25784020-25784042 ATCTGGAGTAACAATGAGGAAGG + Intronic
1005870875 6:29974050-29974072 ATATAGAATTAGAAAGAGGCTGG + Intergenic
1006046122 6:31300211-31300233 ATGAAGAATAAGAGTGCAGACGG + Intronic
1006217375 6:32455968-32455990 ATCTTGAATAAGAATGGTGAGGG - Intergenic
1007046176 6:38776512-38776534 ATGTATATTAAAAATGAGGCTGG - Intronic
1008200392 6:48580769-48580791 ATTTAGAGAAAAAATGAGGAAGG + Intergenic
1008326394 6:50187350-50187372 AGGCAGAATGACAATGAGGATGG - Intergenic
1008350610 6:50485081-50485103 ATGTTGAATAAGAATAATGAGGG - Intergenic
1008712241 6:54241782-54241804 TTGTAGATTAAGAATAAAGAAGG + Intronic
1008979638 6:57468163-57468185 ATGTTGAATAGGAATGGTGAGGG + Intronic
1009425281 6:63506962-63506984 AGGGAGTAGAAGAATGAGGAAGG + Intergenic
1009860665 6:69326840-69326862 AGGGAGGATAAGGATGAGGAGGG + Intronic
1010186677 6:73152331-73152353 AGGTAGAAAATGAAAGAGGAAGG - Intronic
1010853492 6:80807489-80807511 AGTTAGTATGAGAATGAGGAAGG + Intergenic
1011146407 6:84222445-84222467 ATGTAGAATGAGATTGAAAAAGG - Intronic
1011466355 6:87661425-87661447 ACCTAGAATTAGAATGAGCAAGG + Intronic
1011856004 6:91692259-91692281 ATTAAGAGTAAGAATAAGGAAGG + Intergenic
1012500073 6:99878991-99879013 ATGTAGCATAAAAATAAAGAAGG - Intergenic
1012696646 6:102392117-102392139 ATGTTTAATGAGAATGAAGAAGG - Intergenic
1013041319 6:106436587-106436609 AAGTAGAATAAGATTGCGGCCGG - Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015542429 6:134328635-134328657 ACTTAGAAAAAGAATGAGGCTGG - Intergenic
1015710141 6:136130327-136130349 CAGTAGAAAAGGAATGAGGAAGG - Intronic
1015996487 6:138999903-138999925 ATGTAGAATGAGAAGCAGAAAGG + Intergenic
1016527325 6:145016807-145016829 ATGTAAAATAAGAATTAAGGAGG + Intergenic
1016904310 6:149133753-149133775 ATGGAGGATGAGGATGAGGATGG - Intergenic
1017055392 6:150431432-150431454 ATGTAGAACCAGAAGCAGGAGGG + Intergenic
1017092335 6:150771114-150771136 AAGAAAAATAAGAATGAGGGTGG + Intronic
1017462952 6:154668337-154668359 AGGAAGAAAAAGAAGGAGGAGGG + Intergenic
1020190027 7:5988450-5988472 AGGGAGAATGAGAATGAGGCAGG + Intronic
1020292895 7:6736225-6736247 AGGGAGAATGAGAATGAGGCAGG - Intergenic
1021024959 7:15654447-15654469 ATGTTGAATAAGAGTGGTGAGGG + Intronic
1021280259 7:18708282-18708304 ATGGAGAAAAAGAGGGAGGAAGG + Intronic
1022018926 7:26379500-26379522 AAGAAAAATAAGAATGAAGAGGG - Intergenic
1023088597 7:36597056-36597078 ACTTAGGATAAGAATAAGGATGG - Intronic
1023174253 7:37420387-37420409 ATTTAGAATGAGAATGGGCAGGG - Intronic
1024130130 7:46343052-46343074 CTGCTGAAGAAGAATGAGGAAGG - Intergenic
1024928594 7:54645150-54645172 ATGTGGAATGAGAAGGAGAAGGG + Intergenic
1026275659 7:68873507-68873529 ATGTAGATTGAGATTGAGGTTGG + Intergenic
1026675186 7:72422658-72422680 ATGAAGAATAAGAATGAAACAGG - Intronic
1027587146 7:80072510-80072532 ATGTTGAATAAAAGTGATGAAGG - Intergenic
1027636362 7:80680293-80680315 ATATAGAAAGTGAATGAGGAAGG + Intergenic
1028311746 7:89346951-89346973 ATGTAAAATAAGAATGTGTGTGG + Intergenic
1028359573 7:89951625-89951647 ATGTCCAATACTAATGAGGAGGG + Intergenic
1028573959 7:92325220-92325242 ATATAGACTAAGAGTGGGGAAGG - Intronic
1028733996 7:94186082-94186104 ATGTTGAATAGGAATGGTGAGGG + Intergenic
1029815211 7:103086890-103086912 ATGGAGAATAAGACAGAAGAGGG + Intronic
1030014200 7:105201975-105201997 ATGAAGAGTAAGAGGGAGGATGG + Intronic
1030922570 7:115410284-115410306 ATGTAGATTGAGCATGTGGAGGG - Intergenic
1031790686 7:126099344-126099366 AAGTAGAAGAAGAATTAAGAAGG - Intergenic
1031798170 7:126205273-126205295 AAGTAGCATAAGTTTGAGGAAGG + Intergenic
1031838614 7:126709476-126709498 AGGAAGAAGAAGAAGGAGGAGGG + Intronic
1032585023 7:133138429-133138451 ATTTAAAAAAAAAATGAGGAAGG - Intergenic
1032719967 7:134542845-134542867 ATATATAATAAAAATGTGGATGG - Intergenic
1032819555 7:135511634-135511656 ATGTACCAAAAGAATGAGGCCGG - Intergenic
1033163086 7:139014547-139014569 ATGTAGAGTTATCATGAGGAAGG + Intergenic
1033895852 7:146069003-146069025 ATGCAGAATAAGTTTGAGGGAGG + Intergenic
1035060539 7:156066256-156066278 ACGTGGAATGAGGATGAGGATGG - Intergenic
1035944959 8:3952240-3952262 CAGGAGAATAAGAGTGAGGAAGG - Intronic
1036057552 8:5274597-5274619 ATGTGGAACAAAAATGATGAGGG + Intergenic
1036920382 8:12847981-12848003 ATGTTGAGTGAGAATTAGGATGG + Intergenic
1037469627 8:19194680-19194702 ATAAAGAAGAAGAATGACGAGGG + Intergenic
1039564831 8:38543855-38543877 AGGGAGAATAGGAAAGAGGAGGG + Intergenic
1039674505 8:39646885-39646907 AAGTAGAAGGAGAATGAAGAGGG + Intronic
1040399681 8:47036296-47036318 ATGAAGAATGAGAGTGAGGTGGG + Intergenic
1041880302 8:62741963-62741985 TTGTAGAATAAGGAAGAAGAGGG - Intronic
1042142671 8:65695317-65695339 ATGTAGGATAATTATAAGGATGG + Intronic
1043503952 8:80884610-80884632 AGGAAGAAGAAGAAAGAGGAAGG + Intergenic
1043714967 8:83470677-83470699 CAGTAGAAAAAGAATGAGCAAGG - Intergenic
1044275461 8:90294392-90294414 AGGTAGAAGAAAAAAGAGGAAGG - Intergenic
1044298059 8:90551355-90551377 TTGTAAAACAAGAATGATGATGG - Intergenic
1046106840 8:109676243-109676265 ATGTTGAATAGGAGTGATGACGG - Intronic
1046489555 8:114932303-114932325 ATGTTGAAACAGAAAGAGGAGGG - Intergenic
1046760716 8:118017217-118017239 ATGTATAAGGAGAATGAGGTAGG - Intronic
1046817553 8:118601458-118601480 AAATAGAATAATAATGAGGAGGG - Intronic
1046937158 8:119895529-119895551 CTGTAGTATAAGCATGAGAATGG + Intronic
1046978576 8:120311665-120311687 ATACAGAATAAGAATTTGGAAGG + Intronic
1047083720 8:121493479-121493501 ATGTTGGAGAAAAATGAGGATGG + Intergenic
1047362790 8:124184378-124184400 AGGTGGAAGAAGAATGAGGTTGG + Intergenic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1048081404 8:131132037-131132059 CTGTAGGATAAGAATAAGCAAGG - Intergenic
1048196613 8:132336704-132336726 ATACAGAATAATTATGAGGAGGG - Intronic
1048748504 8:137643585-137643607 ATGTTGAAAAGGAGTGAGGAAGG + Intergenic
1050169589 9:2801496-2801518 ATGAAGATTGAGAATAAGGATGG + Intronic
1050447611 9:5742112-5742134 ATGTAGGAAAAGAATTAGCAAGG - Intronic
1050855752 9:10352384-10352406 AAGAAGAATAGGAATGAGAATGG - Intronic
1051432046 9:16989325-16989347 ATGATGAAGAGGAATGAGGAAGG - Intergenic
1051538696 9:18190010-18190032 ATCTAGAACAAGAATGAGCCTGG + Intergenic
1052179500 9:25506671-25506693 ATGGAGAAGAAGAAAGAGAAAGG + Intergenic
1052406837 9:28072033-28072055 ATGTAGAAGGAGGATGAAGATGG - Intronic
1052551488 9:29955834-29955856 ATGGAGACTCAGAATGGGGAGGG - Intergenic
1054719388 9:68589223-68589245 ATGTTGAATAGGAGTGAGAAAGG + Intergenic
1054999010 9:71427224-71427246 CTTTAGAGTAAGACTGAGGAGGG - Intronic
1055131661 9:72782416-72782438 ATGTTGAATAAGAATAGTGAGGG - Intronic
1055367195 9:75557145-75557167 AAGAAGATAAAGAATGAGGAAGG + Intergenic
1055370626 9:75594426-75594448 ATGGAGAATAAGAATAGGAAAGG - Intergenic
1056513353 9:87327100-87327122 AGGAAGAAGAAGGATGAGGAGGG + Intergenic
1056643793 9:88392635-88392657 AGGTAGAAAAAGAGGGAGGAAGG - Intronic
1057258452 9:93569354-93569376 AAGTAGAATAAAACTGAGGGAGG - Intergenic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1058805744 9:108589800-108589822 ATGGAGAACAAGAGTGAAGAAGG + Intergenic
1059441582 9:114310494-114310516 ATGTATGATAAGAATCACGATGG + Intronic
1059760244 9:117330613-117330635 ATGTAGAATGACACAGAGGAAGG - Intronic
1060695943 9:125708955-125708977 ATGGAGAGTAAGATTTAGGAAGG - Intergenic
1062298894 9:135852752-135852774 TTGAAGAATAAGAATGTGCAGGG - Intronic
1185714378 X:2329499-2329521 ATTTAGAGTAAGGATCAGGATGG + Intronic
1186115178 X:6297800-6297822 ATGTGGAAACAGAACGAGGAAGG + Intergenic
1186443703 X:9607739-9607761 AAGTAGAACATGAAAGAGGATGG + Intronic
1187947027 X:24436023-24436045 AGGTAGGATAAGGATGAGGTAGG - Intergenic
1188342171 X:29017303-29017325 CTGTAGAATAAGAATGAACGTGG + Intronic
1188389455 X:29601749-29601771 TTCCAGAATAAGAAAGAGGATGG + Intronic
1188626637 X:32293259-32293281 ATGTTGAATAAGACTAGGGATGG + Intronic
1189209563 X:39273140-39273162 ATGTTGAATAAGAGTGGTGAGGG + Intergenic
1189590464 X:42505768-42505790 ATTTGGAAGCAGAATGAGGATGG + Intergenic
1189972335 X:46430951-46430973 ATGTATAGTAAGAATGCAGAAGG + Intergenic
1191020569 X:55855917-55855939 ATGTTGAATAGGAGTGATGAGGG + Intergenic
1191163637 X:57363599-57363621 ATGTTGAATAGGAGTGATGAGGG + Intronic
1192354251 X:70385154-70385176 AGGTAGAAAAATAATTAGGATGG + Intronic
1192432246 X:71120237-71120259 ATCTAGATTAAGAAGGAGGATGG - Intronic
1192717288 X:73657653-73657675 ATGTTGAATAGGAATGGTGAGGG + Intronic
1194336441 X:92652954-92652976 TTGTTGAATAATACTGAGGATGG - Intergenic
1194549793 X:95282805-95282827 ATGAAGAATAATACAGAGGATGG - Intergenic
1194989294 X:100528206-100528228 ATTTAGAATCAAAATGGGGAAGG - Intergenic
1195109082 X:101627564-101627586 ATTTAGATTAAAAATGAGGTAGG + Exonic
1195345161 X:103942558-103942580 TTGAGGAATAAGAATGAGGTGGG - Intronic
1196005886 X:110836761-110836783 ATGAAAAAGAGGAATGAGGAGGG + Intergenic
1196330347 X:114465644-114465666 ATCTAGAATATGAATGAGTGGGG + Intergenic
1196610794 X:117712516-117712538 ATGTGGAAAAAGGATGAGAAAGG + Intergenic
1196760751 X:119198486-119198508 AAGAAGAATGAGAATGAGCAAGG + Intergenic
1196935595 X:120727546-120727568 ATGTACAATAAGAAAGAAAATGG + Intergenic
1197523051 X:127523601-127523623 ATGTTGAATAGGAATGGTGAGGG - Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1198045735 X:132900603-132900625 ATGTAGAAAAATGATGAGAAAGG + Intronic
1198626089 X:138576661-138576683 ATATAGACAAAGAATGATGAGGG - Intergenic
1198681383 X:139186427-139186449 TGGTAGAGTAAGAATGAAGATGG - Intronic
1198806551 X:140500668-140500690 ATGTAAAACAAGGAAGAGGAGGG + Intergenic
1199350972 X:146799271-146799293 ATGTAGAATAAGAAAGACCAAGG - Intergenic
1199387873 X:147243980-147244002 ATGGAGAAAAAGAAGAAGGAAGG - Intergenic
1200644870 Y:5769702-5769724 TTGTTGAATAATACTGAGGATGG - Intergenic
1200691282 Y:6307670-6307692 ATCAAGAAGAAGAAAGAGGATGG - Intergenic
1200757015 Y:6999607-6999629 AAGTAGAATATGAAAGAGGATGG + Intronic
1201043990 Y:9867046-9867068 ATCAAGAAGAAGAAAGAGGATGG + Intergenic
1201317122 Y:12658436-12658458 AGGTAGAACAAGAATGAAGTGGG + Intergenic
1201865630 Y:18650820-18650842 ATGTAGAATAAAAATAGGGAAGG - Intergenic