ID: 929911498

View in Genome Browser
Species Human (GRCh38)
Location 2:46093426-46093448
Sequence CTTTGGAAGGGGAAATTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 919
Summary {0: 1, 1: 0, 2: 3, 3: 55, 4: 860}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929911498_929911508 13 Left 929911498 2:46093426-46093448 CCCCTCAATTTCCCCTTCCAAAG 0: 1
1: 0
2: 3
3: 55
4: 860
Right 929911508 2:46093462-46093484 CAACTCGCAGCTGGGTCTTTTGG 0: 1
1: 0
2: 0
3: 7
4: 104
929911498_929911506 5 Left 929911498 2:46093426-46093448 CCCCTCAATTTCCCCTTCCAAAG 0: 1
1: 0
2: 3
3: 55
4: 860
Right 929911506 2:46093454-46093476 ACCACATTCAACTCGCAGCTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
929911498_929911505 4 Left 929911498 2:46093426-46093448 CCCCTCAATTTCCCCTTCCAAAG 0: 1
1: 0
2: 3
3: 55
4: 860
Right 929911505 2:46093453-46093475 AACCACATTCAACTCGCAGCTGG 0: 1
1: 0
2: 0
3: 6
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929911498 Original CRISPR CTTTGGAAGGGGAAATTGAG GGG (reversed) Intronic
900958233 1:5901736-5901758 ATTTGGAATGGGAAACAGAGTGG + Intronic
901234430 1:7660308-7660330 CTTTGGAAGGCCAAAGTGGGCGG - Intronic
901668258 1:10838648-10838670 CTCAGGAAGCGGTAATTGAGGGG - Intergenic
902092514 1:13914732-13914754 CTTTGGAAGGCCAAATTGGGAGG + Intergenic
902743020 1:18453362-18453384 CTTTGTAAGGGGCATTTGACTGG - Intergenic
903225405 1:21891852-21891874 CTTTGGGAGGCCAAAGTGAGAGG - Intronic
903491340 1:23731019-23731041 TTGTGGAAGGGGAAATTTATAGG - Intergenic
903534872 1:24060283-24060305 ATTGGGAAGGGGCAATTGAGGGG - Intronic
904116870 1:28169150-28169172 CTTTGGGAGGCCAAAATGAGTGG + Intronic
905191221 1:36236537-36236559 CTTTGGGAGGGGGAAGTGGGAGG - Intronic
905467405 1:38165824-38165846 CTTTGGAAGGCCAAGGTGAGTGG + Intergenic
905782066 1:40720621-40720643 CTTTGGCAGGCCAAAGTGAGAGG + Intronic
906230962 1:44163691-44163713 CTTTGGGAGGCGAAGGTGAGGGG - Intergenic
906412290 1:45588345-45588367 CTTTGGAAAGGCAAGGTGAGTGG - Intronic
906450431 1:45941499-45941521 CTTTGGAAGGCCAAGGTGAGTGG - Intronic
908293735 1:62692594-62692616 TTTTGCAGGGGGAAATTAAGGGG + Intergenic
908845041 1:68316166-68316188 CTTTGGGAGGTCAAAGTGAGAGG + Intergenic
909475787 1:76079470-76079492 TATTGGAAGTGGACATTGAGTGG + Intronic
909715453 1:78701965-78701987 CATTGGAAGGGGAATTTGGGAGG + Intergenic
910178453 1:84455981-84456003 CTTGGGAAGGGGAAATGGATGGG + Intergenic
910891894 1:92027463-92027485 CTTTGGGAGGCTAAAGTGAGAGG + Intergenic
910893221 1:92039895-92039917 CTTTGGAAGGCCAAAGTGGGCGG - Intronic
911627492 1:100141573-100141595 CTTTGGAAGGGTAAGGTGGGAGG - Intronic
911941977 1:104058018-104058040 CTTTGGATGGGGTATTTGAGTGG - Intergenic
911982859 1:104587349-104587371 CTTTGGATGGGGTTTTTGAGCGG - Intergenic
912254380 1:108044285-108044307 ATTAGGAAGGGGAAGCTGAGTGG - Intergenic
912302019 1:108527882-108527904 CTGAGGGAGGGGAAATAGAGAGG - Intergenic
912922479 1:113882693-113882715 CTTTGGGAGGCGAAAGTGGGAGG + Intronic
913020987 1:114789847-114789869 CTTTGGATGGGGTATTTGTGTGG + Intergenic
913686938 1:121241069-121241091 CTTTGGAAAGCCAAAGTGAGAGG - Intronic
914038798 1:144028699-144028721 CTTTGGAAAGCCAAAGTGAGAGG - Intergenic
914150656 1:145039230-145039252 CTTTGGAAAGCCAAAGTGAGAGG + Intronic
914320344 1:146553301-146553323 CATTGGAAGGTGAAATAGAGAGG + Intergenic
914355885 1:146884180-146884202 CTTTGGGAGGCCAAGTTGAGTGG - Intergenic
914393787 1:147245261-147245283 ATTTGGAAGGGGAAAGTGAGGGG + Intronic
914778822 1:150764479-150764501 CTTTGGAAGGCCAAGGTGAGCGG - Intronic
915061255 1:153187870-153187892 CTTTGGATGGGGTTTTTGAGTGG + Intergenic
915270035 1:154747289-154747311 GTGTGGAAGGGGGATTTGAGGGG - Intronic
915351055 1:155226450-155226472 CCTTGGAAAAGGAAATTGGGAGG + Intergenic
915379955 1:155431515-155431537 CTTTGGGAGGTCAAGTTGAGAGG + Intronic
915404953 1:155652862-155652884 CTTTTGAATGGGAACTTCAGGGG + Intergenic
915415849 1:155742251-155742273 CTTTGGAAGGCCGAAGTGAGCGG - Intergenic
915480805 1:156183492-156183514 CTTTGGGAGGCTAAAGTGAGAGG - Intergenic
915639692 1:157215273-157215295 CTTTGGAAGGGGTTTTTGTGGGG + Intergenic
915987608 1:160482009-160482031 TCTGGGAAGGGGAAATTCAGGGG + Intergenic
916181309 1:162086177-162086199 CTTTGGAAGGGGTATTTCAGGGG + Intronic
916515756 1:165515003-165515025 CTTTTGAAGGGTACATTCAGTGG - Intergenic
916517206 1:165530413-165530435 TTCTGGAAGGGGAAGCTGAGTGG + Intergenic
917100917 1:171444371-171444393 CTTTGGGAGGCCAAAGTGAGAGG + Intergenic
917819947 1:178752405-178752427 CTTTGGGAGAGGGAAGTGAGAGG - Intronic
917947300 1:179988051-179988073 CTTTGGAAGGCCAAGGTGAGAGG + Intronic
918121422 1:181544429-181544451 CTTTAGAAGGGTAAATTATGTGG + Intronic
918466812 1:184829041-184829063 CTTTGGAAGGCCAAGTTGGGAGG - Intronic
918803059 1:188998442-188998464 CATTGGAAGGGAATATTGAGAGG + Intergenic
919598285 1:199591471-199591493 CTTTGGAAGGCCAAGGTGAGCGG + Intergenic
920226278 1:204441511-204441533 TTTTGGAAGGAGAGTTTGAGGGG + Exonic
920452650 1:206071601-206071623 CTTTGGGAGGGCAAGGTGAGAGG + Intronic
920474269 1:206259578-206259600 CTTTGGAAAGCCAAAGTGAGAGG - Intronic
920716175 1:208342441-208342463 CTTTGGAAGGACAAAGTGGGCGG - Intergenic
920885991 1:209928441-209928463 CTTTGGGAGGCGAAAGTGGGTGG + Intergenic
920905268 1:210158134-210158156 TTTCAGAAGGAGAAATTGAGTGG + Intronic
921128958 1:212202811-212202833 GCTGGGAAGGGGAAATGGAGAGG + Intergenic
921305931 1:213796818-213796840 CTTTGAAAGAGGAAATAGATAGG + Intergenic
921456583 1:215379465-215379487 CCTTGCAAGGGGACATTCAGTGG - Intergenic
922284113 1:224153675-224153697 CTTTGGGAGGGCAAAGTGGGTGG + Intronic
922403402 1:225285303-225285325 CTTTGGGAGGCCAAAGTGAGTGG + Intronic
922932680 1:229402683-229402705 CTTTGGGAGGCCAAAATGAGAGG - Intergenic
922953920 1:229583145-229583167 CTTTGGGAGGGCAAGGTGAGTGG - Intergenic
922981180 1:229828273-229828295 TTTTGGAAGGGGAAATAAGGTGG - Intergenic
923056161 1:230426675-230426697 CTGCGGAAGGGGACAGTGAGCGG - Intergenic
923430609 1:233916513-233916535 CTTTGGAAGGCTAAAGTGAGAGG - Intronic
923707697 1:236358112-236358134 CTTTGGGAGGTGAAGTTGGGTGG - Intronic
923769005 1:236920904-236920926 CTATGTATGGGGAAAATGAGAGG + Intergenic
924474101 1:244368200-244368222 CTTTGGGAGGCCAAGTTGAGTGG - Intronic
924499870 1:244627325-244627347 CTTTGGGAGGCCAAAGTGAGAGG + Intronic
924672839 1:246147216-246147238 CCTTGGACTGGGAAATTAAGAGG - Intronic
924695102 1:246391140-246391162 CTTTGGGAGGTCAAAGTGAGAGG + Intronic
924898342 1:248367572-248367594 CTTTGGAAGGCCAAAGTGGGCGG - Intergenic
1062999220 10:1898825-1898847 CTTTGCAAGGCCAAACTGAGAGG - Intergenic
1063339881 10:5252988-5253010 TTTTGCAGTGGGAAATTGAGAGG - Intergenic
1063343855 10:5293663-5293685 TTTTGCAGTGGGAAATTGAGAGG + Intergenic
1063677185 10:8151190-8151212 CTTTGGGAGGGCAAGGTGAGAGG - Intergenic
1064192667 10:13221223-13221245 CTTTGGAAGGCCAAGGTGAGTGG + Intergenic
1064744188 10:18462998-18463020 CTTTGGAAGGCCAAGTTGGGTGG - Intronic
1064967256 10:21027571-21027593 CTTTGGAAGGCTGAATTGATTGG - Intronic
1065221962 10:23505301-23505323 TTTTGAAAGGGGAACTTAAGCGG + Intergenic
1065337979 10:24674288-24674310 CTTTGGGAGGCTAAAGTGAGGGG + Intronic
1065547215 10:26833983-26834005 CTTTGGAAGGCCAAAGTGGGTGG + Intronic
1066366934 10:34786246-34786268 CATTGGGATGGGACATTGAGTGG - Intronic
1066388416 10:34959984-34960006 CTTGGGAAAGGGGAAGTGAGGGG + Intergenic
1066423352 10:35282368-35282390 CTTTGGGAGGCTAAAGTGAGAGG - Intronic
1067373008 10:45702267-45702289 CTTTGGGAGGCCAAGTTGAGAGG + Intergenic
1067386766 10:45823855-45823877 CTTTGGGAGGCCAAGTTGAGAGG - Intergenic
1067419353 10:46133396-46133418 CTTTGGGAGGCCAAGTTGAGAGG + Intergenic
1067447503 10:46360756-46360778 CTTTGGGAGGCCAAGTTGAGAGG + Intergenic
1067504704 10:46839993-46840015 CTTTGGGAGGCCAAGTTGAGAGG + Intergenic
1067589877 10:47500012-47500034 CTTTGGGAGGCCAAGTTGAGAGG - Intergenic
1067759729 10:49035588-49035610 CTTTGGGAGGCCAAAGTGAGAGG + Intronic
1067876487 10:50012220-50012242 CTTTGGGAGGCCAAGTTGAGAGG + Intergenic
1068383717 10:56295349-56295371 CCTTATAAGGGGAAAATGAGAGG - Intergenic
1068510784 10:57963391-57963413 CTTTGGAAGGGCAAGGTGGGAGG + Intergenic
1068684995 10:59860949-59860971 CTTTGGGAGGGCAAGTTGGGTGG + Intronic
1068773595 10:60848858-60848880 CTTGGGAAAGGGAATTTGAGAGG + Intergenic
1069464902 10:68629777-68629799 CTTTGGGAGGCCAAATTGGGTGG - Intronic
1069500023 10:68943818-68943840 CTTTGGAAGGTCAAAGTGGGAGG - Intronic
1069589786 10:69634595-69634617 CTTTGCAAGGGGAAAATGAAAGG - Intergenic
1069706949 10:70464869-70464891 CTTTGGAAGGCCAAAATGGGTGG - Intergenic
1070109478 10:73469917-73469939 CTTTGGAAGATGATATTAAGAGG - Intronic
1070133593 10:73672523-73672545 CTTTGGGAGGCCAAGTTGAGAGG - Intergenic
1070223399 10:74474765-74474787 CTTTGGAAGGGCGAGTTGTGAGG - Intronic
1070910785 10:80116058-80116080 CTTTGGGAGGCCAAAGTGAGTGG - Intergenic
1070997587 10:80799669-80799691 ATTTGGAAGGGGAACTGAAGTGG + Intergenic
1071608117 10:87011947-87011969 CTTTGGGAGGCCAAGTTGAGAGG + Intergenic
1071747939 10:88443039-88443061 CGTTGGATGTGGAAGTTGAGAGG - Intronic
1071806353 10:89125111-89125133 GTTTGGAAGGAGAAAGTGATAGG + Intergenic
1071819808 10:89268135-89268157 CTTTGGAAGAGGAAAATAGGAGG + Intronic
1072408696 10:95180301-95180323 CTTTGGAAGGCCAAGTTGGGTGG + Intergenic
1072704559 10:97671341-97671363 CTTTGGGAGGCCAAATTGGGAGG + Intronic
1072872405 10:99133694-99133716 CTTTGGATGGGGTCTTTGAGTGG - Intronic
1072905096 10:99445765-99445787 CTTTGGAAGGCCAAGGTGAGCGG - Intergenic
1072978852 10:100082409-100082431 CTTTGGGAGGCCAAATTGGGAGG + Intergenic
1072979751 10:100090076-100090098 CTTTGGGAGGGCAAAGTGGGTGG - Intergenic
1073272475 10:102277081-102277103 CTTTGGAAGGCCAAGATGAGAGG + Intronic
1073741207 10:106409207-106409229 CTTTGGAAGGAGACACTCAGAGG - Intergenic
1074168413 10:110907269-110907291 CTTTGGAAGGCCAAAGTGGGAGG + Intronic
1074323549 10:112426054-112426076 CTTTGTAATGAGATATTGAGTGG + Intronic
1075254817 10:120917311-120917333 GTTTGGAAGGGGATTTTCAGTGG - Intergenic
1075259859 10:120953886-120953908 CTGTGGGACAGGAAATTGAGAGG + Intergenic
1075389266 10:122080799-122080821 TTTTGGTAGCGGACATTGAGAGG + Intronic
1075558265 10:123448944-123448966 CTTTGGAAGGCCAAAGTGGGCGG + Intergenic
1075988417 10:126809732-126809754 CTTTGGGAGGCGAAAGTGGGAGG + Intergenic
1076250666 10:128981485-128981507 CTTTGCAAGAGGAAATTGATTGG - Intergenic
1076931969 10:133537347-133537369 CTTTGGCAGGGGTCACTGAGGGG + Intronic
1076987279 11:247586-247608 CTTTGGAAGGCTGAAGTGAGTGG + Intronic
1077243094 11:1521671-1521693 CTTTGGAAGGTGAAGGTGGGTGG + Intergenic
1077248186 11:1549091-1549113 CTCTGGAGGGGGACATTGAAGGG + Intergenic
1077616048 11:3674823-3674845 ATTTATAAGGGGAAATTTAGGGG - Intronic
1077892220 11:6427500-6427522 CTTTGGGAGGCCAAATTGGGAGG - Intergenic
1078163713 11:8864511-8864533 CTTTGGGAGGCCAAATTGGGAGG - Intronic
1078205527 11:9225839-9225861 CTTTGGGAGGCCAAGTTGAGTGG + Intronic
1078273529 11:9820284-9820306 CTTTGGAAGCAGAAAATGAAGGG + Intronic
1078998121 11:16725278-16725300 CTTTGGAAGGCCAAAGTGGGTGG + Intronic
1079216878 11:18521606-18521628 CTTTGGAAGGCTGAGTTGAGAGG - Intronic
1079485911 11:20935808-20935830 CTTAAGAAGGGGACATTGATAGG + Intronic
1079562719 11:21842752-21842774 CCTTGGAAGGGGTAAGTGAGAGG + Intergenic
1079782752 11:24628800-24628822 TTTTGGGAGGGCAAAATGAGCGG - Intronic
1080831299 11:35895645-35895667 CTTTGGAAGGGCAAGGTGGGCGG + Intergenic
1081114844 11:39187691-39187713 CTTTGGAAGGCCAAAGTGGGTGG + Intergenic
1081229309 11:40564819-40564841 TTTTGGCAGGGGTAATTGACTGG + Intronic
1082054772 11:47804891-47804913 CTTTGGAAGGGTAAGGTGGGAGG + Intronic
1082167589 11:48965928-48965950 CTTTGGAGTGGGAAGTAGAGGGG - Intergenic
1082839217 11:57675237-57675259 CTTTGGAGAAGGAAATTGAGGGG + Intronic
1082906582 11:58313785-58313807 GTTGGGAAAGGGAAAATGAGAGG + Intergenic
1082960252 11:58912953-58912975 CTCTGGCTGGGGAATTTGAGAGG + Intronic
1083468072 11:62862404-62862426 CTTTGGGAGGCGAAGGTGAGAGG + Intronic
1083798163 11:65030434-65030456 CTTTGGAAGGCCAAAATGGGAGG - Intronic
1084073170 11:66750946-66750968 CTTTGGGAGGCCAAAGTGAGAGG - Intronic
1084479137 11:69408266-69408288 CTTTGGAAGGCCAAGATGAGAGG - Intergenic
1084565109 11:69924182-69924204 CTTGGGGAGAGGAAAGTGAGAGG + Intergenic
1084984122 11:72852452-72852474 CTTTGGAAGGCTAAAGTGGGTGG + Intronic
1085493762 11:76947477-76947499 CTTATCAAGGAGAAATTGAGTGG + Intronic
1085574720 11:77591901-77591923 CTAAAGAAGGGGAAATTGATTGG - Intronic
1086342305 11:85858552-85858574 GTGTGGCAGGGGGAATTGAGAGG + Intronic
1087348662 11:97003534-97003556 CATTGAAAGGGGGAATTAAGGGG + Intergenic
1087712332 11:101567841-101567863 CTTTGGAAGGGGTCTGTGAGTGG - Intronic
1088158103 11:106833805-106833827 CTTTGTAATGGAAAATTGAAGGG - Intronic
1088215865 11:107508414-107508436 CTTTGGAAGGACAAAGCGAGTGG - Intronic
1088297134 11:108311450-108311472 CTTTGGGAGGCCAAAGTGAGAGG + Intronic
1088694688 11:112356527-112356549 CTTTGGGAGGCCAAAGTGAGTGG - Intergenic
1088712492 11:112521207-112521229 CTATTGAAGGGAAAACTGAGTGG + Intergenic
1088930280 11:114344340-114344362 CTTTGGAAGGGCAAGGTGGGAGG + Intergenic
1089462885 11:118663023-118663045 CTCTGGAAGGGGAACAAGAGAGG - Intronic
1089538738 11:119176771-119176793 CTTTGGGAGGCCAAAGTGAGAGG - Intronic
1089757229 11:120695854-120695876 CTCTGGAAGGAGCAATTGAAGGG + Intronic
1089934997 11:122355348-122355370 CTTTGGAAGGCCAAGGTGAGAGG - Intergenic
1090085545 11:123647230-123647252 CTTTGGGAGGCTAAGTTGAGAGG + Intronic
1091517789 12:1202412-1202434 CTTTGGGAGGTGAAAGTGGGTGG + Intronic
1091531472 12:1360837-1360859 CTTTGGGAGGCCAAAGTGAGAGG + Intronic
1091822777 12:3489141-3489163 CTTTGGAATGGGGAGTGGAGAGG - Intronic
1091845767 12:3655314-3655336 CTGTGGATGGGGAAATGGGGAGG + Intronic
1091933515 12:4416450-4416472 GTGTGGAAGGGGAACCTGAGCGG + Intergenic
1091985186 12:4905153-4905175 CTTTGGAAGGCCAAAGTGGGTGG - Intergenic
1092202801 12:6597024-6597046 CTTTGGAAGGAGGAGGTGAGCGG + Intronic
1092249747 12:6886925-6886947 CTTTGGGAGGCGAAAGTGGGTGG + Intronic
1092358755 12:7818415-7818437 CTTTGGGAGGGTGAAGTGAGTGG + Intronic
1092387468 12:8047207-8047229 CTTTGGAAGGCCAAAGTGGGCGG + Intronic
1092649969 12:10624175-10624197 CTTTGGGAGGCGAAGGTGAGAGG + Intronic
1093037029 12:14341814-14341836 CTTTGGAAGGCCAAAGTGGGTGG + Intergenic
1093114748 12:15195428-15195450 CTTAGCAAGAGGAAAATGAGTGG - Intronic
1093233887 12:16582802-16582824 CTTTGGGAGGCCAAATTGAGTGG + Intronic
1093398223 12:18709636-18709658 CTTTGGAAGGCCAAGATGAGAGG + Intronic
1093739016 12:22659334-22659356 TTTTGGGAGGGGACACTGAGGGG - Intronic
1094548709 12:31429650-31429672 CTTTGGGAGGCCAAGTTGAGTGG - Intronic
1094570287 12:31635682-31635704 CTTTGGGAGGCCAAAGTGAGAGG - Intergenic
1094613323 12:32014436-32014458 CTTTGGAAGGCCAAGGTGAGAGG + Intergenic
1095429841 12:42121386-42121408 CTTTGGGAGGCCAAGTTGAGAGG + Intronic
1095723663 12:45428367-45428389 CTTTGGAAGGCCAAGTTGGGAGG + Intronic
1095899290 12:47311284-47311306 CTTTGGGAGGACAAAGTGAGAGG + Intergenic
1096016309 12:48278882-48278904 CTTTGGTTGGGAAAATTGATAGG - Intergenic
1096017127 12:48286768-48286790 CACTAGAAGGGGAAATTGAAGGG - Intergenic
1096630269 12:52921920-52921942 CTTTGGAAGGCCAAAGTGGGAGG + Intronic
1096960582 12:55572927-55572949 CTTTGGGAGGCCAAAGTGAGAGG + Intergenic
1097161945 12:57052768-57052790 CTTTGGAAGGCTGAATTGGGAGG + Intergenic
1097428608 12:59475349-59475371 TGTTTAAAGGGGAAATTGAGAGG + Intergenic
1098372160 12:69771285-69771307 CTTTGGAAGGCCAAAGTGGGAGG + Intronic
1098560640 12:71867730-71867752 CTTTGGAAGGCCAAAATGAGAGG - Intronic
1098779801 12:74672503-74672525 CTTTGGAAGGCCAAACCGAGTGG + Intergenic
1098925976 12:76349677-76349699 CTTTGGAAGGCCAAGTTGGGAGG - Intergenic
1099861030 12:88226542-88226564 CTTAGGCAGGAAAAATTGAGTGG - Intergenic
1100360740 12:93877579-93877601 CTTTGGAAGGGGAAAGGAAGAGG - Intronic
1100476118 12:94936898-94936920 CTTTGGAAGGCCAAGTTGGGTGG + Intronic
1100543201 12:95577397-95577419 CTTTGGGAGGCCAAATTGGGCGG + Intergenic
1100551779 12:95652800-95652822 CTTTGGAAGGCCAAGGTGAGAGG - Intergenic
1100604150 12:96137379-96137401 CTTTGGAAGGCTGAAGTGAGAGG + Intergenic
1100829519 12:98504980-98505002 CTTTGGAAGGCCAAAGTGGGTGG + Intergenic
1101043783 12:100783895-100783917 ATTTGGAAGGTGGAAATGAGAGG - Intronic
1101121060 12:101580376-101580398 CTTTGGAAGGCCAAAGTGGGAGG - Intronic
1101334755 12:103786479-103786501 CTGGGGAAGGGGAAATCCAGTGG + Intronic
1101601146 12:106211640-106211662 CTTAGGATGGGGTATTTGAGTGG + Intergenic
1101618613 12:106361883-106361905 CTGTGGAAAGGGAATGTGAGGGG + Intronic
1102161923 12:110776049-110776071 CTTTGGGAGGCCAAAGTGAGAGG + Intergenic
1102479793 12:113214117-113214139 CTAGGGAGGGGGAAAGTGAGGGG + Intronic
1102644205 12:114393338-114393360 CTCTGGAAGGGCAAAGTGGGAGG - Intronic
1102690194 12:114754483-114754505 CTTTGGAAGGCCAAAGTGGGTGG - Intergenic
1103050956 12:117779056-117779078 CTTTGCAGAGGGAAATTGGGAGG - Intronic
1103068818 12:117923441-117923463 CTTTGGAAGGCCAAAGTGGGAGG + Intronic
1103398660 12:120626973-120626995 CCTGGGAAGTGGAAACTGAGTGG + Intergenic
1103405731 12:120673936-120673958 CTTTGGAAGGCCAAAGTGAGAGG + Intergenic
1103414498 12:120734993-120735015 CTTTGGAAGGCCAAAATGGGTGG - Intronic
1104108022 12:125681576-125681598 ATGTGGAAGGGGAAATGGTGGGG + Intergenic
1104366833 12:128185777-128185799 CTTTGGGAGGCGAAAGTGGGTGG - Intergenic
1104455077 12:128904431-128904453 ATTTGGAGGGGGAAAAAGAGAGG + Intronic
1104590612 12:130081643-130081665 CTTTGGCAGGGAAGATTAAGTGG - Intergenic
1105574790 13:21640273-21640295 CTTCGGAAGGGAAAATGGAGGGG + Intergenic
1105775643 13:23657794-23657816 CTTTGGGAGGCTGAATTGAGAGG - Intronic
1106235750 13:27858718-27858740 CTTTGGAAGGCCAAAATGGGAGG + Intergenic
1106731976 13:32551139-32551161 CTTTGGGAGGGCAAAGTGGGGGG + Intergenic
1106972370 13:35157249-35157271 CCTTGGAATGGGCTATTGAGAGG - Exonic
1107036450 13:35907404-35907426 CTTTGGAAGGCTAAGGTGAGAGG - Intronic
1107076085 13:36322201-36322223 CTTTGGAAGGCCAAATTGGGCGG + Intronic
1107470152 13:40684196-40684218 CTTTGGAAGGCCAAAGTGGGTGG - Intergenic
1108243334 13:48490063-48490085 CTTTTGCAGGGGAAATGGAAAGG + Exonic
1109010883 13:56942591-56942613 CTTTGGCAGGAGAAACTGAAAGG + Intergenic
1109292113 13:60488820-60488842 CTTTGGAAGGCCAAAGTGAGCGG - Intronic
1109975333 13:69824745-69824767 ATGTGGAAGGTGAAATTGACTGG + Intronic
1110222570 13:73089288-73089310 CTTTGGAAGGGCAAGGTGGGAGG - Intergenic
1110224526 13:73105794-73105816 CTTTGGAAGGCCAAAGTGGGTGG - Intergenic
1110755408 13:79168085-79168107 CTTTGGGAGGCCAAAGTGAGTGG + Intergenic
1111158781 13:84365353-84365375 CTTTGTAAGGGAAAACTTAGTGG + Intergenic
1111553636 13:89850494-89850516 CTTTGGAAGTGGTCAGTGAGTGG - Intergenic
1111620803 13:90722913-90722935 ATTTGGAAAGGGAATTTAAGAGG + Intergenic
1111768934 13:92571793-92571815 CTTTGGGAGGCGAAGGTGAGTGG + Intronic
1111817182 13:93168528-93168550 CTTTGGAAGGCCAAAGTGGGCGG + Intergenic
1112021389 13:95374151-95374173 CTTTAAAAGGGTAAATTGTGTGG - Intergenic
1112186367 13:97131833-97131855 CTTTGGGAGGTGAAATTCACAGG + Intergenic
1112206184 13:97325485-97325507 CTTTGGGAGGGCAAAGTGGGAGG + Intronic
1112278571 13:98043366-98043388 CTTTGGGAGGCCAAAGTGAGTGG - Intergenic
1112279646 13:98051344-98051366 CTTTGGAAGGCGAATGTGGGTGG + Intergenic
1112492412 13:99879328-99879350 CTTGGAATGTGGAAATTGAGTGG - Intronic
1113163051 13:107405150-107405172 TTTGGGGAGGGGAAATTGAATGG - Intronic
1114161270 14:20170378-20170400 CTTTGAAAGGCCAAGTTGAGTGG + Intergenic
1114202047 14:20530681-20530703 CTTTGGGAGGTGAAAACGAGCGG + Intergenic
1114239070 14:20849381-20849403 CTTTGGAAGGGGACATTTTTTGG - Intergenic
1114433906 14:22686961-22686983 CTTTGGATGGGGTCTTTGAGTGG - Intergenic
1114571845 14:23674946-23674968 CTTTGGAAGGTCGAAGTGAGAGG - Intergenic
1114645312 14:24252765-24252787 CTTGGGGTGGGGAAACTGAGGGG - Intronic
1115521789 14:34240187-34240209 CTTTGGGAGGCCAAAGTGAGTGG + Intronic
1115826793 14:37287495-37287517 CTTTGGAAGGCCAAGGTGAGAGG - Intronic
1116175778 14:41468874-41468896 CTTTGGTAGGTGAATTTGAAAGG - Intergenic
1116417252 14:44693874-44693896 CTTTGGATGGGGTCTTTGAGTGG - Intergenic
1117018820 14:51548630-51548652 TTTTGGAAGGGGAAATGTGGGGG + Intronic
1117681803 14:58210995-58211017 TTTTGGAAGGGAAAATTGAAAGG - Intronic
1117768618 14:59108714-59108736 CTTTGGGAGGCCAAATTGGGTGG + Intergenic
1117875183 14:60244837-60244859 CTTTGGAAGGCCAAAGCGAGTGG - Intergenic
1117970730 14:61248455-61248477 CTGTGGAAGGGCAGATGGAGGGG + Intronic
1118269370 14:64327961-64327983 CTTTGGAAGGGCAAAGCGGGTGG + Intronic
1118345631 14:64938854-64938876 CTTTGGTTGGGGATATTGGGAGG - Intronic
1118835042 14:69471713-69471735 CTTTGGCATGGGAAAGTGTGGGG - Intergenic
1119819799 14:77605252-77605274 CTTTGGAAGGCCAAACTGGGAGG - Intronic
1120820790 14:88910244-88910266 CTGTGGAAGGGGAAAGTGGCTGG - Intergenic
1121360929 14:93258826-93258848 CTTTGGAAGGCCAAGGTGAGTGG - Intronic
1121820025 14:96958738-96958760 CTGTGGGAGGGGACTTTGAGGGG - Intergenic
1121874465 14:97438821-97438843 CTTTGGAAGATTTAATTGAGAGG - Intergenic
1122303422 14:100745599-100745621 CTTTGGGAGGCCAAGTTGAGAGG - Intergenic
1123133751 14:106009012-106009034 CTTTGGGAGGGCAAAGTGGGTGG + Intergenic
1123789556 15:23706942-23706964 CTTTGGAAGGCCAAGTTGGGTGG - Intergenic
1124425598 15:29560035-29560057 TGTGTGAAGGGGAAATTGAGAGG + Intronic
1124451038 15:29791268-29791290 CTTTGGGAGGGCAAGGTGAGCGG - Intronic
1125012922 15:34899612-34899634 CTTTGGGAGGTGAAGTTGGGAGG - Intronic
1125209961 15:37202895-37202917 CTTAGGAGGGGCAATTTGAGAGG - Intergenic
1125315197 15:38424060-38424082 CTTTGGGAGGCCAAAGTGAGTGG + Intergenic
1125888781 15:43250166-43250188 TTTCAGAAGAGGAAATTGAGTGG - Intronic
1127494615 15:59498091-59498113 CTTTGGGAGGCCAAAGTGAGAGG - Intronic
1127814580 15:62596492-62596514 CTTTGGGAGGCCAAAGTGAGTGG + Intronic
1128359471 15:66951042-66951064 CTCTGGAAGTGGAAATGAAGAGG - Intergenic
1128459796 15:67858198-67858220 CTTTGGGAGGGCAAGGTGAGAGG + Intergenic
1129357945 15:75004931-75004953 CTTTGGAAGGCGGAGTTGGGCGG + Intronic
1130143836 15:81256585-81256607 CTTTGGGAGGCCAAATTGGGGGG - Intronic
1130428579 15:83823538-83823560 CTTTGGGAGGGAAAATTGACAGG - Intronic
1130535372 15:84781289-84781311 CTTTGGAAGGCCAAGGTGAGTGG - Intronic
1131263246 15:90900742-90900764 CTTTGGAAGGCCAAAGTGGGGGG + Intergenic
1131636651 15:94239937-94239959 CTTTGGAAAGGAAATTGGAGAGG - Intronic
1131813689 15:96200966-96200988 ATGTGGAAGGGGATATGGAGAGG - Intergenic
1132993050 16:2807299-2807321 CTTTGGGAGGCCAAAGTGAGAGG - Intergenic
1133135004 16:3704768-3704790 CTTTGGAAGGCCAAGTTGGGAGG + Intronic
1133143383 16:3764824-3764846 CTTTGGAAGGCCAAAGTGGGAGG - Intronic
1133346048 16:5071202-5071224 CTTTGGGAGGTGAAATTGGAGGG + Intronic
1133419068 16:5630211-5630233 CTTTGGGAGGTCAAAGTGAGTGG + Intergenic
1133597982 16:7311288-7311310 ATTAGGAAGGGGAACTGGAGTGG + Intronic
1133687756 16:8182458-8182480 CTTTGGAAGGCCGAATTGGGTGG - Intergenic
1134006401 16:10821281-10821303 CCTGGGAAGGGGATATTGGGAGG + Intergenic
1134541810 16:15073220-15073242 CTTTGGGAGGCCAAAGTGAGAGG + Intronic
1134855609 16:17516257-17516279 CTTTGGAAGGCCAAAATGAGAGG - Intergenic
1135045307 16:19150395-19150417 CTTTGGAGGTGGGAATTGAGAGG + Intronic
1135664894 16:24327313-24327335 CTTTGGGAGGGCAAAGTGAGAGG + Intronic
1136189598 16:28607906-28607928 CTTTGGGAGGCCAAATTGGGTGG - Intronic
1136422157 16:30141677-30141699 CTTTGGAAGGCCAAAGTGGGTGG - Intergenic
1136506665 16:30708770-30708792 CTTTGGGAGGCCAAAGTGAGAGG - Intronic
1136689313 16:32017403-32017425 CTTTGGAAGGCCAAAGTGGGTGG + Intergenic
1136789904 16:32960941-32960963 CTTTGGAAGGCCAAAGTGGGTGG + Intergenic
1136879908 16:33892995-33893017 CTTTGGAAGGCCAAAGTGGGTGG - Intergenic
1137355925 16:47763647-47763669 CTCTGGAAGGGGAAGTAGGGGGG - Intergenic
1137436408 16:48457489-48457511 CTTTGGAAGGCCAAGGTGAGAGG + Intergenic
1137705643 16:50533983-50534005 CTTTGGAAGGGAAAGATGATCGG + Intergenic
1137969882 16:52974736-52974758 CTTTGGATGGGGTTTTTGAGTGG + Intergenic
1138854826 16:60677633-60677655 CTTTGGAAGGCCAAGGTGAGCGG + Intergenic
1138947627 16:61871405-61871427 CTTTGGAAGGCCAAGGTGAGAGG - Intronic
1139434836 16:66930408-66930430 CTTTGGGAGGGCTGATTGAGAGG + Intergenic
1139479916 16:67224871-67224893 CATTGAAAGGGGAATTTGGGAGG - Intronic
1139607849 16:68032724-68032746 CTTTGGAAGGCCAAAGTGGGTGG + Intronic
1139978131 16:70831264-70831286 CTTTGGGAGGCCAAGTTGAGTGG + Intronic
1140087990 16:71813322-71813344 CTTTGGGAGGGCAAAGTGGGAGG - Intergenic
1140311168 16:73849974-73849996 CTTTGGGAGGCCAAAGTGAGTGG - Intergenic
1140427500 16:74873287-74873309 CTTTAGAAGGCAAAAGTGAGGGG - Exonic
1140447253 16:75040361-75040383 CTTTGGGAGGACAAAGTGAGAGG - Intronic
1141060342 16:80861331-80861353 CTTTGGAAGGTCAAGGTGAGAGG + Intergenic
1141668162 16:85476854-85476876 CTTTGGAAGGCCAAGGTGAGAGG - Intergenic
1142527966 17:558222-558244 CTTTGGAAGGCCAAGGTGAGTGG + Intronic
1142635592 17:1255380-1255402 CTTTGGGAGGCCAAAGTGAGGGG + Intergenic
1142645004 17:1305928-1305950 CTTGGGAAGGGGAGATTGGTGGG + Intergenic
1143019762 17:3911229-3911251 CTTTGGGAGGCCAAAGTGAGCGG - Intronic
1143767422 17:9146740-9146762 ATTTGGAGGAGGAAAGTGAGGGG + Intronic
1143842297 17:9742425-9742447 TTTTGGAAGGCCAAAGTGAGAGG - Intergenic
1143913659 17:10273004-10273026 CTTTGGAAGGTCAAGGTGAGCGG - Intergenic
1144100592 17:11938840-11938862 CTTTGGGAGGTCAAAATGAGAGG - Intronic
1144530926 17:16038679-16038701 CTTTGGGAGGGTAAGTTGGGTGG - Intronic
1144554904 17:16273605-16273627 CAGTGGCAGGGGAAATTGAGAGG + Intronic
1145351403 17:22087644-22087666 CTTTGCAAGAGGAAAAAGAGAGG - Intergenic
1145407158 17:22611740-22611762 CTTTGGGAGGGCAAAGTGGGAGG - Intergenic
1145832349 17:27926907-27926929 CTTTGGGAGGCCAAAGTGAGAGG + Intergenic
1146373818 17:32281264-32281286 CACTGGAGGGGGAGATTGAGGGG + Intronic
1146809463 17:35891648-35891670 CTTTGGGAGGCCAAAGTGAGAGG - Intergenic
1147152155 17:38523537-38523559 CTTTGGAAGGCCAAAGTGGGTGG + Intergenic
1147152308 17:38524733-38524755 CTTTGGAAGGTGGAAGTGGGAGG + Intergenic
1147250391 17:39149750-39149772 CTGGGGAAGGGGGAATTGGGAGG - Intronic
1147411424 17:40255566-40255588 CTTTGGGAGGCCAAAGTGAGTGG - Intronic
1147593481 17:41701071-41701093 CTTTGGGAGGGCAAAGTGGGAGG - Intergenic
1147603687 17:41761566-41761588 CTTTGGAAGGCCAAAGTGGGTGG + Intronic
1147624699 17:41892495-41892517 CTGGGGAAGGGGAAGCTGAGGGG + Intronic
1147848695 17:43424374-43424396 CTTTGGAAGGCTGAAGTGAGAGG + Intergenic
1147982476 17:44283034-44283056 CTTTGGGAGGCCAAAGTGAGAGG - Intergenic
1148151621 17:45399921-45399943 CTTTGGAAGGGCAAGGTGGGAGG + Intronic
1148741932 17:49897915-49897937 CTAGGGAAGGGGAAGGTGAGAGG + Intergenic
1148931272 17:51129165-51129187 CTTTGGAAGGCCAAGGTGAGTGG + Intergenic
1149693875 17:58601003-58601025 CTTTGGGAGGCGAAAGTGGGAGG + Intronic
1149783713 17:59418400-59418422 CTTTGGGAGGCCAAAGTGAGCGG + Intergenic
1149829494 17:59859283-59859305 CTTTGGGAGGGCAAAGTGGGAGG - Intergenic
1149907654 17:60541333-60541355 CTTTGGAAGGCCAAGGTGAGAGG + Intergenic
1149913686 17:60588927-60588949 CTTTGGGAGGCCAAATTGGGTGG - Intergenic
1149950640 17:60981077-60981099 CTTTGGGAGGGGGAAGTGGGAGG - Intronic
1150119414 17:62587450-62587472 ATTTGGAAGGGGAAAAACAGTGG + Intronic
1150237297 17:63603460-63603482 CTTTGGAAGGCCAAGGTGAGTGG + Intronic
1150290279 17:63977235-63977257 CTTTGGAAGGCCAAAGTGGGAGG + Intergenic
1150354402 17:64470808-64470830 ATTTGCAAGGAGAAAATGAGAGG - Intergenic
1150503228 17:65671267-65671289 CTCCCGAAGGGGAAATTGGGAGG + Intronic
1151082467 17:71344633-71344655 GTCTGGAAGTGGAAATGGAGGGG - Intergenic
1151604537 17:75128314-75128336 CTTTGGAAGGCTGAAGTGAGTGG - Intronic
1151641526 17:75398989-75399011 CTTTGGGAGGGCAAAGTGGGCGG - Intronic
1152059110 17:78056091-78056113 CTTTGGGAGGCCAAAGTGAGAGG - Intronic
1152199580 17:78937500-78937522 CTTTGGAAGGCCAAGGTGAGTGG - Intergenic
1152491788 17:80639809-80639831 CTTTGGAAGGTGAAATGGATAGG + Intronic
1153200273 18:2640548-2640570 CTTTGGAAGGCTAAAATGGGTGG - Intergenic
1153519436 18:5938020-5938042 CATTTGAAGGGGAAATTCAAGGG + Intergenic
1153524154 18:5979083-5979105 CTTGGGAAGGGGCAAAAGAGTGG + Intronic
1153762061 18:8341007-8341029 CCTTGGGTGGGGAAACTGAGAGG + Intronic
1154225704 18:12501715-12501737 CTTTGGAAGGCGGAGGTGAGAGG + Intronic
1154344176 18:13528554-13528576 CTTTGGAAGGTGAAGGTGGGTGG - Intronic
1155260061 18:24033007-24033029 CGTTGGAAGGTGAAGTCGAGTGG + Intronic
1155320976 18:24618516-24618538 CTTTGGGAGGCCAAAGTGAGTGG - Intergenic
1156049519 18:32915366-32915388 CTTTGGAAGGTGAAAGTGTAGGG + Intergenic
1156355497 18:36336926-36336948 CTTTGGGAGGCCAAAGTGAGTGG + Intronic
1156363765 18:36407111-36407133 CCTTGGAGGAGGAAACTGAGAGG - Intronic
1156425621 18:37008859-37008881 CTTAAGAAGGGGAAAAAGAGAGG + Intronic
1157093335 18:44662019-44662041 CTTAGGAAGGGGAAAATAATTGG - Intergenic
1157378523 18:47189498-47189520 CTTTGGAAGGACAAGGTGAGAGG - Intergenic
1157646925 18:49283809-49283831 CTTAGGAAGGAGAATCTGAGAGG - Intronic
1158684467 18:59600648-59600670 CTTTGAGAGAGGAAATTTAGTGG - Intronic
1158861365 18:61595129-61595151 CTGAGGAAGGAGAAAATGAGGGG + Intergenic
1158892091 18:61882325-61882347 TTTTGGAAGGGGAATTTTATAGG - Intronic
1158984091 18:62795781-62795803 GATTAGAAGGTGAAATTGAGTGG - Intronic
1159817095 18:73088041-73088063 CTTTGGGAGGCAAAAGTGAGTGG + Intergenic
1160950258 19:1663490-1663512 CTTTGGAAGGCCAAAATGAGAGG - Intergenic
1160962293 19:1728175-1728197 CTTTGGGAGGCCAAAGTGAGCGG - Intergenic
1161011907 19:1963749-1963771 CTTTGGAAGGCCAAAGTGGGTGG - Intronic
1161329691 19:3680543-3680565 CTTTGGGAGGCCAAAGTGAGTGG - Intronic
1161525763 19:4754056-4754078 CTTTGGAAGGCCAAGGTGAGTGG - Intergenic
1161927145 19:7309445-7309467 CTTGGGCAGGGAAAATTGGGGGG + Intergenic
1162331491 19:10032611-10032633 CTCTCGAAGGGGAAATTGCTGGG + Intergenic
1162563481 19:11431689-11431711 CTTTGGGAGGCCAAAGTGAGCGG + Intronic
1162630038 19:11920354-11920376 CTTTGGGAGGCCAAAGTGAGTGG - Intergenic
1163086689 19:14986272-14986294 CTTTGGGAGGCCAAAGTGAGTGG + Intronic
1164103433 19:22080221-22080243 CTTTGGAAGAACAAAGTGAGAGG - Intronic
1164889980 19:31814933-31814955 CTTTGGAAGGCCATATTGATTGG + Intergenic
1165052817 19:33153306-33153328 CTTTGGGAGGCCAAAGTGAGAGG - Intronic
1165287458 19:34853695-34853717 CATGGGAAGGGGACATTGTGGGG - Intergenic
1165341223 19:35213675-35213697 CTTTGGGAGGCCAAAGTGAGTGG - Intergenic
1165496284 19:36153801-36153823 CTTTGGAAGGCCAAAGTGGGCGG - Intergenic
1165631930 19:37308612-37308634 CTTTGGAAGGCCAAGTTGGGTGG - Intergenic
1165657153 19:37544167-37544189 CTTCGGAAGGGCAGAGTGAGAGG - Intronic
1165892147 19:39119701-39119723 CTTTGGGAGGTGAAAGTGGGAGG + Intergenic
1165911394 19:39230429-39230451 CTTTGGAAGGCCAAGGTGAGAGG - Intergenic
1166047579 19:40238505-40238527 CTCTGTAAGGGGAAGCTGAGCGG + Intronic
1166414585 19:42585049-42585071 CTTTGGGAAGGCAAATTGGGAGG + Intronic
1166866491 19:45841225-45841247 TTTTGGAAGGCCAAGTTGAGGGG - Intronic
1166965008 19:46524290-46524312 CTTTGGGAGGCCAAATTGGGAGG - Intronic
1167150227 19:47704516-47704538 CTTTGGGAGGCCAAATCGAGTGG + Intergenic
1167378198 19:49123376-49123398 CTTTGGAAGGCCAAGGTGAGAGG - Intronic
1167417606 19:49384780-49384802 CTTTGGAAGGCCAAGTTGGGTGG - Intergenic
1167598046 19:50437573-50437595 CCTTGGAAGGGGAAAAAGGGAGG + Intronic
1168020350 19:53604597-53604619 CTTTGGAAGGCTAAGGTGAGCGG + Intergenic
1168530740 19:57126925-57126947 CTTTGGATGGGGTTATTGTGTGG + Intronic
1168697176 19:58410129-58410151 CTTCGCATGGGGAAAATGAGGGG - Intronic
925337358 2:3108140-3108162 CTTTGCAAGTGGAAGTGGAGCGG - Intergenic
925340606 2:3132786-3132808 CTTTGGAAGGGAAAGTGGGGAGG + Intergenic
925870484 2:8265705-8265727 CATTGGAAAGGGAACTTGAAGGG + Intergenic
926184702 2:10680029-10680051 CTTTGGAAGGGCGAGTTGGGCGG + Intronic
926483339 2:13426956-13426978 CTTTGGATGGGGATTTTGGGTGG + Intergenic
926589898 2:14729451-14729473 CTTTTGGAGGAAAAATTGAGAGG - Intergenic
926634930 2:15168870-15168892 CTTTGGGAGGCCAAAGTGAGTGG - Intronic
926757415 2:16247314-16247336 CTTTGGGAGTGGAAAGGGAGTGG - Intergenic
926858555 2:17283541-17283563 CCTTGGAAAGGGAAATTCAGAGG + Intergenic
927245276 2:20952431-20952453 CATTTCAAGGGGAAATGGAGGGG + Intergenic
927342337 2:21996619-21996641 CTTTGGAAGGCCAAAGTGGGTGG + Intergenic
927430491 2:23022783-23022805 TTGTGGAAGGAGAGATTGAGTGG + Intergenic
928508446 2:31978661-31978683 CTTTGGAAGGCCAAGGTGAGAGG - Intronic
929354142 2:40999070-40999092 GTTCCGAAGGGGAAATTGAGCGG + Intergenic
929911498 2:46093426-46093448 CTTTGGAAGGGGAAATTGAGGGG - Intronic
930688007 2:54330101-54330123 CTCTGGTAGTGGAAATTGGGAGG + Intronic
931064194 2:58565960-58565982 CTTTGGAAGGCCAAGATGAGAGG - Intergenic
931430704 2:62206631-62206653 CTTTGGGAGGTGGAAGTGAGAGG - Intronic
931667151 2:64617699-64617721 TTTTGGAAGGGGAGATTGGAGGG - Intergenic
931878474 2:66540539-66540561 CTTTGGAAGGCCAAAGTGGGTGG - Intronic
932040700 2:68296308-68296330 CTTTGGAAGGCCAAGATGAGAGG + Intronic
932147993 2:69341194-69341216 CTTTGGGAGGGCAAAGTGGGAGG - Intronic
932472152 2:71966819-71966841 CTTTGGAAGGCCAAAGTGGGTGG - Intergenic
932932887 2:76063018-76063040 CTTTGGGAGGCCAAATTGGGTGG - Intergenic
933081494 2:77993461-77993483 CTTTGGAAGAAGATAGTGAGTGG - Intergenic
933834895 2:86237936-86237958 CTTTGGAAGGCCAAGGTGAGTGG + Intronic
934069565 2:88371531-88371553 CTTTGGAAGACGGAGTTGAGAGG - Intergenic
934479007 2:94618113-94618135 CTTTGGAAGGGGTTTTTGTGGGG + Intergenic
934619376 2:95794629-95794651 CTGTGGGAGGTGAAATCGAGAGG + Intergenic
934641516 2:96029928-96029950 CTGTGGGAGGTGAAATCGAGAGG - Intronic
934705120 2:96471731-96471753 CTTTGGAAGGTGGAAGTGGGAGG - Intergenic
935382338 2:102465387-102465409 CTTTGGGAGGCCAAAGTGAGAGG - Intergenic
935819043 2:106875419-106875441 CTTTGGGAGGACAAAATGAGTGG - Intronic
937132228 2:119522582-119522604 AAATGGAAGGGGAAAATGAGAGG - Intronic
938044619 2:128106791-128106813 CTTTGGAAGGGGCAGGTGGGTGG - Intronic
938211725 2:129471281-129471303 CTTTGGAAGGCCAAGATGAGTGG + Intergenic
938339976 2:130529209-130529231 CTTAGGAAATGGAACTTGAGAGG + Intergenic
938349859 2:130591539-130591561 CTTAGGAAATGGAACTTGAGAGG - Intergenic
938419257 2:131131030-131131052 CTTTGGGAGGCGAAAGTGGGAGG - Intronic
938803364 2:134784030-134784052 CTTTGGGAGGCCAAGTTGAGAGG - Intergenic
938942152 2:136178749-136178771 CTTTGGCAGGGAAAATAAAGAGG + Intergenic
940218913 2:151330440-151330462 CTTTGAAAGTGGAAATTATGAGG + Intergenic
940727139 2:157347133-157347155 CTTTGGAAGGACAATTTGACTGG - Intergenic
941107605 2:161375786-161375808 CTTTGGGAGGTCAAAGTGAGTGG + Intronic
941875737 2:170430921-170430943 CTTCAGAAGTGGAAATAGAGAGG + Intronic
941930057 2:170929727-170929749 CTTTGGAAGCTAAAAATGAGGGG - Intronic
942467701 2:176225882-176225904 CTTTGGAAGGCGGAAATGGGAGG - Intergenic
942598998 2:177620886-177620908 CTTTGGAAGGCCAAAGTGGGAGG - Intergenic
942646484 2:178115907-178115929 CTTTGGAAGGTCAAAGTGGGAGG + Intronic
943766363 2:191666739-191666761 CCTTTGAAGGGGAAATTGGTAGG - Intergenic
944182963 2:196915582-196915604 ATATGGAAGGGCAAAGTGAGAGG - Intronic
944295227 2:198053834-198053856 CTTTGGAAGGGGAACTGGTTTGG + Intronic
944609688 2:201389854-201389876 CTTTGGCAGCTGAGATTGAGGGG - Exonic
944737587 2:202581821-202581843 CTTTGGGAGGTGAAAGTGGGAGG + Intergenic
946237336 2:218332275-218332297 CAGTGGAAGGCAAAATTGAGAGG + Intronic
946400688 2:219466916-219466938 CTGAGGGAGGGGAAACTGAGAGG - Intronic
947079487 2:226380335-226380357 ATTTGGAAAAGGAAATTGATTGG - Intergenic
947147603 2:227082615-227082637 CTTTGTAATGTGAAATGGAGAGG + Intronic
947225743 2:227838852-227838874 TTTTGGATGGGGATTTTGAGTGG + Intergenic
947570032 2:231226477-231226499 CTTTGGAAGGGGATAGGAAGGGG + Intronic
947697984 2:232208782-232208804 CTTTGGGAGGCCAAGTTGAGAGG + Intronic
947840322 2:233203646-233203668 CTTTGGGAGGCCAAAGTGAGAGG + Intronic
948231048 2:236349733-236349755 GTTTGGAGGAGGAAAATGAGTGG + Intronic
948531635 2:238611712-238611734 CTTTGGAGGGGGAGAAAGAGTGG + Intergenic
948633842 2:239321220-239321242 CTTTGGAAGGTGAAGGTGGGCGG + Intronic
948715637 2:239859640-239859662 CTTTTGCAGGGGAAATGGAGAGG - Intergenic
948935268 2:241159785-241159807 CTTTGGGAGGCCAAATTGGGAGG + Intronic
1169121747 20:3100808-3100830 CTTTGGGAGGCCAAAGTGAGAGG - Intergenic
1169349858 20:4859445-4859467 CTTGGGAAGGGGCAATGGTGTGG + Intronic
1169452776 20:5726403-5726425 CTTTGGAAGGCCAAGGTGAGTGG - Intergenic
1169473083 20:5905111-5905133 CTTTGGGAGGTGAAGATGAGAGG + Intergenic
1169677890 20:8174985-8175007 CTTTAGCACAGGAAATTGAGGGG + Intronic
1169839915 20:9923968-9923990 CTTTGGGAGGCCAAAGTGAGTGG + Intergenic
1169858725 20:10130248-10130270 CTTTGGAAGGCCAAGGTGAGAGG + Intergenic
1170554862 20:17506766-17506788 CTTTGGGAGGGCAAGGTGAGTGG - Intronic
1171799202 20:29595090-29595112 CTTTGGGAGGGCAAGTTGGGTGG + Intergenic
1171999823 20:31765212-31765234 CTTTGGGAGGCCAAAATGAGAGG + Intronic
1172151081 20:32790903-32790925 CTTTGGGAGTGGGAGTTGAGAGG - Intronic
1172292549 20:33786723-33786745 CTTTGGAAGGTGAAGGTGGGTGG + Intronic
1172549563 20:35788477-35788499 CTTTGGAAGGCCAAGGTGAGAGG - Intronic
1173526737 20:43738525-43738547 CTTTGGAAGGGTAAGGTGGGTGG + Intergenic
1173594392 20:44249279-44249301 CTTTGGGAGGCCAAAGTGAGTGG - Intronic
1173687766 20:44936206-44936228 CTTTGGAAGGCCAAAGTGGGAGG - Intronic
1174469488 20:50745748-50745770 CTTTGGAAGGGCGAGGTGAGAGG - Intronic
1175285137 20:57832846-57832868 CTTTGGGAGGCCAAAGTGAGTGG - Intergenic
1175338416 20:58211585-58211607 CTTTGGAAGGCCAAAGTGGGTGG + Intergenic
1176165517 20:63671300-63671322 CTTTGGGAGGCCAAAGTGAGTGG - Intronic
1176665566 21:9684011-9684033 CTTTGGGAGGCCAAATTGGGTGG + Intergenic
1176802772 21:13448318-13448340 CTTTGGGAGGCCAAGTTGAGTGG + Intergenic
1177012760 21:15748541-15748563 CTTTGGAAGGCCAAAGTGAAAGG - Intronic
1177013508 21:15756289-15756311 CTTTGGAAGGGAAAACGGGGAGG + Intronic
1178069716 21:28950755-28950777 CTTTGGAAGGCCAAAGTGAGAGG - Intronic
1178978521 21:37241449-37241471 GAGTGGAAGAGGAAATTGAGGGG + Intronic
1179001580 21:37465591-37465613 CTTTGGGAGGCCAAAGTGAGTGG + Intronic
1179150226 21:38803574-38803596 CTTTGGAAGGGGAAATAGGGAGG + Intergenic
1179195941 21:39162579-39162601 CTTTGGGAGGCCAAAGTGAGAGG + Intergenic
1179343359 21:40533417-40533439 GTTTGGATGGGGAAATAGATAGG - Intronic
1179542514 21:42092865-42092887 TTTCAGAAGAGGAAATTGAGGGG + Intronic
1180910808 22:19448639-19448661 CTTTGGGAGGCCAAAGTGAGAGG - Intergenic
1181502788 22:23327751-23327773 CTTTGGAAGGTGAAGAGGAGAGG + Intergenic
1181533052 22:23528059-23528081 CTTTGGGAGGCCAAGTTGAGTGG - Intergenic
1181653582 22:24276131-24276153 CTTTGGAAGGTGAAGAGGAGAGG + Intronic
1181662582 22:24363468-24363490 CTTTGGAAGGCCAAGGTGAGAGG - Intronic
1182407679 22:30151034-30151056 TTTTGGAAGAGGAGATAGAGAGG - Intronic
1182578838 22:31291628-31291650 CTTTGGAGGAGGAGATGGAGAGG + Intronic
1182844596 22:33419935-33419957 CTTTGGGAGGCCAAAGTGAGTGG - Intronic
1183005113 22:34894835-34894857 CTTTGGCAGTGGAAATTCTGGGG - Intergenic
1183212731 22:36460886-36460908 CTTTGGAAGGCCAAAGTGGGTGG + Intergenic
1183307897 22:37092737-37092759 CTTTGGGAGGCCAAGTTGAGCGG - Intronic
1184087547 22:42274259-42274281 CTTTGCAAGGGGACAGTGCGTGG - Intronic
1184123418 22:42469148-42469170 CCTTTGAAGGGGAATCTGAGCGG + Intergenic
1184354004 22:43966081-43966103 CTTTGGAAGGCCAAGTTGGGAGG - Intronic
1184791089 22:46700480-46700502 CTTTGGGAGGGCAAGGTGAGAGG + Intronic
949367637 3:3300501-3300523 ATTTGGTAGGAAAAATTGAGAGG - Intergenic
949921406 3:9005906-9005928 CTTTAAAAGGGTAAATTGTGTGG + Intronic
950346911 3:12303800-12303822 CTTTGGTGGGAGAAATGGAGTGG + Intronic
950825613 3:15816950-15816972 CTTTGGGAGGCCAAAGTGAGAGG + Intronic
951126776 3:18994176-18994198 CTTTGGAAGGCCAAAGTGGGTGG + Intergenic
951544929 3:23815223-23815245 CTCTGGAAGGGCAAAGTGGGTGG - Intronic
952059503 3:29490679-29490701 GTGTAGAAGGGGAAATGGAGTGG + Intronic
952477799 3:33729148-33729170 CTTTGGAAGGGTGAAGTGGGAGG + Intergenic
952687350 3:36164901-36164923 CTTTGGAAGGTGAAGGTGGGTGG + Intergenic
952772953 3:37018844-37018866 CTTTGGGAGGCCAAAGTGAGAGG - Intronic
952959148 3:38578995-38579017 CTTTGGATGGGGAGATTCACAGG + Intronic
953716677 3:45321899-45321921 CTCTGGAGGGGAAAATTAAGAGG + Intergenic
953780689 3:45867598-45867620 CTTTGGGAGGAGGAAGTGAGAGG + Intronic
954209145 3:49084187-49084209 CTTTGGAAGGTGGAAGCGAGTGG - Intronic
954310643 3:49764136-49764158 CTTTGGGAGGTGAACGTGAGAGG + Intronic
954552636 3:51494799-51494821 CTTTGGAAGGCCAAGTGGAGAGG - Intronic
954647321 3:52139584-52139606 CTTTGGAAGGACAAATGAAGGGG - Intronic
954815216 3:53274950-53274972 CTTTGGGAGGCGAAGGTGAGAGG - Intergenic
955005858 3:54967763-54967785 CTTTGGGAAGTGAAATTTAGTGG - Intronic
955310196 3:57879099-57879121 CTTTGAAAGGCCAAATTGGGAGG - Intronic
955985557 3:64570572-64570594 CTTAGGTAGGGGAAGTTGGGAGG + Intronic
956227011 3:66971904-66971926 CTTTGCAAGGGGTAATTTTGTGG - Intergenic
956587830 3:70882972-70882994 CTTTGGAAGGCCAAAGTGGGCGG + Intergenic
956753093 3:72360372-72360394 CTTTGGGAGGTGAAAGTGGGAGG - Intergenic
956819808 3:72943925-72943947 CTTTGGAAGGCCAAAATGGGAGG - Intronic
956833621 3:73077478-73077500 CTGAGGAAGGGGAATTTGATAGG - Intergenic
957220378 3:77374963-77374985 CTTTGGAAGGCTGAAGTGAGAGG + Intronic
957333209 3:78792854-78792876 CTTTGGAAGGCGAAGGTGGGAGG + Intronic
957622689 3:82614942-82614964 CCATACAAGGGGAAATTGAGAGG - Intergenic
957807530 3:85169235-85169257 CTTTGGAAGGCCAAGGTGAGTGG - Intronic
959412355 3:106040431-106040453 CTTTGGAATGGGGCACTGAGTGG - Intergenic
959461165 3:106627840-106627862 CAAGGGAAGGGGAAATTAAGTGG - Intergenic
959801879 3:110504798-110504820 CTTTGGGAGGCGAAGGTGAGAGG + Intergenic
959915491 3:111812374-111812396 CTCTGCAAGGGGAAATGGAGAGG + Intronic
960130158 3:114047416-114047438 CTTTGGAAGGCCAAAATGGGAGG + Intronic
960176926 3:114528638-114528660 CACTGGAATGGGAAACTGAGAGG + Intronic
960279705 3:115767508-115767530 CTTTTGAAGGAGAAAGTGAAAGG + Intergenic
960764510 3:121111404-121111426 CTTTGGATGGGGTTTTTGAGGGG + Intronic
960827984 3:121812245-121812267 CTTTGGATGGGGATTTTGTGTGG - Intronic
960898026 3:122526731-122526753 CTTTGGGAGGCCAAAGTGAGAGG - Intergenic
961099762 3:124188601-124188623 CTTTGGATAGGGAGAATGAGAGG + Intronic
961975661 3:131022564-131022586 CTTTGGAAGGCCAAAGTGGGAGG - Intronic
962064486 3:131964194-131964216 CTTTGGATGGGGTTTTTGAGTGG - Intronic
962163190 3:133021289-133021311 TTTTGGAGGGGCAGATTGAGAGG - Intergenic
962536755 3:136335745-136335767 CTTTGGAAGGCCAAGGTGAGTGG - Intronic
962562102 3:136617253-136617275 GTGTAGCAGGGGAAATTGAGAGG + Intronic
963833320 3:150031874-150031896 GTTTGGGAGGGGAACATGAGTGG - Intronic
964065138 3:152568850-152568872 CTTTGGGAGGCCAAAGTGAGAGG + Intergenic
964391151 3:156199988-156200010 CTTTGGATGGGGTTTTTGAGTGG + Intronic
964394237 3:156228800-156228822 CTGTGGAAGGAGAAATAGGGTGG - Intronic
965589025 3:170344832-170344854 CTTTGGAAGGCCAAGGTGAGAGG + Intergenic
966679860 3:182630372-182630394 CTTTGAAAGACTAAATTGAGTGG + Intergenic
966766107 3:183464036-183464058 CCTTGGAAGGGGAAATGTGGAGG - Intergenic
967277844 3:187794186-187794208 CATTGGAAGGGGAGAGTGAGTGG + Intergenic
967957981 3:194892663-194892685 CTTTGGAAGGCCAAAGTGAGAGG - Intergenic
967975884 3:195034660-195034682 CTTTGGAAGGGGAACCGGGGAGG + Intergenic
968058248 3:195709481-195709503 CTTTGGGAGGCCAAAATGAGAGG + Intergenic
968390266 4:187068-187090 CTTTGGATGGGGTTATTGTGGGG + Intergenic
968823454 4:2874981-2875003 CTTTGGAAGGCCAAGGTGAGAGG + Intronic
970726007 4:19045504-19045526 CTTTGGGTGGTGAAATTGACAGG + Intergenic
971300150 4:25435160-25435182 CTTTGGGAGGCCAAATTGAGTGG + Intergenic
971656682 4:29355472-29355494 CTTTGGAAGGCTGAGTTGAGTGG - Intergenic
972261138 4:37408980-37409002 CTTTGGATGGGGTCTTTGAGTGG - Intronic
972346555 4:38197221-38197243 CTTTGGGAGGCCAAAGTGAGAGG - Intergenic
972456192 4:39257978-39258000 CTTTGGTGGGGGATATTGACTGG - Intronic
972701617 4:41499574-41499596 CTTTGGAAGGGCAAGGTGGGGGG + Intronic
973556720 4:52091457-52091479 CTTTGGATGGGGTCTTTGAGTGG + Intronic
973783880 4:54317256-54317278 CTTTGGAAGGCCAAAATGAAAGG - Intergenic
973943412 4:55933061-55933083 CTCTGGAAGTGGAAATGAAGTGG - Intergenic
975387638 4:73776298-73776320 TTTTGGCAGGGGAAAATAAGGGG + Intergenic
975614690 4:76234664-76234686 CTTTGGCAGGCCAAGTTGAGAGG + Intronic
975674499 4:76812610-76812632 CGTGGGAAGGGGAAGTGGAGAGG - Intergenic
975887945 4:78987851-78987873 CTCTGAAAAGGGAACTTGAGGGG + Intergenic
976031084 4:80754522-80754544 GTTTTCAAGGGGAAAGTGAGAGG + Intronic
976104451 4:81601874-81601896 CTTTGGAAGGCTAAAGTGGGTGG + Intronic
976185207 4:82436440-82436462 CTTTGGAAGGCCAAGGTGAGAGG + Intronic
976319571 4:83698263-83698285 CTTTGGAAGGTGAAGTTGAGAGG - Intergenic
976650901 4:87433566-87433588 CTTAAGAAGGGCAAATTGACTGG + Intronic
976901278 4:90179624-90179646 CTTTGGGAGGCCAAATTGAGAGG - Intronic
977282404 4:95057532-95057554 CTTTGGAGGGAGAATTTGATTGG + Intronic
977344543 4:95800662-95800684 CTTTGGGAGGTGAAGGTGAGAGG - Intergenic
977425653 4:96863837-96863859 CTTTGGATGGGGTTTTTGAGTGG - Intergenic
978441231 4:108736167-108736189 CTTTGGAAGGCGAAGGGGAGAGG - Intergenic
978805580 4:112796591-112796613 CTTTGGGAGGCCAAAGTGAGAGG - Intergenic
978816033 4:112906663-112906685 ATTTGGTAGGGAAAATTGAAGGG + Intronic
979199095 4:117955128-117955150 GTTTGGCAGAGGAAATGGAGAGG + Intergenic
979764088 4:124444791-124444813 CTTTGGATGGGGATATTGAATGG + Intergenic
980902790 4:138920977-138920999 CTTTGGAAGGCCAAGGTGAGTGG + Intergenic
981103862 4:140858595-140858617 CTTTGGAAGGCCAAGGTGAGAGG + Intergenic
981175929 4:141683325-141683347 CTTTGGAAGGGCAAGGTGGGTGG + Intronic
981393997 4:144224438-144224460 CTTTGGAAGGCCAAAGTGGGTGG - Intergenic
981542264 4:145858386-145858408 CTTTGGGAGGGCAAAGTGGGAGG + Intronic
982433714 4:155356015-155356037 CTTTGGAAGGCCAAAGTGGGTGG + Intronic
982516648 4:156359601-156359623 CTTTGGAAGGCGAAGGTGGGTGG - Intergenic
982749996 4:159149498-159149520 CTTTGGGAGGTCAAATTGGGTGG - Intronic
982771279 4:159399632-159399654 CTTGGGAAGCTGAAATTGAGAGG + Intergenic
983028334 4:162765818-162765840 CCTTGAAAGGGGAAAAAGAGAGG + Intergenic
983219370 4:165030263-165030285 CTTTGGAAGACCAAATGGAGAGG - Intergenic
983634808 4:169886732-169886754 CTTTGGAAGGCCAAGTTGGGCGG - Intergenic
984024360 4:174524851-174524873 CAGTGGCAGTGGAAATTGAGAGG - Intergenic
984253578 4:177363987-177364009 CTTTGGAAGGCCAAAGTGGGAGG - Intergenic
984376605 4:178938604-178938626 CTTTGGAAGGCCGAGTTGAGGGG + Intergenic
984376621 4:178938687-178938709 CTTTGGAAGGCCGAGTTGAGGGG + Intergenic
985209687 4:187579506-187579528 CTTTGGGAGGCCAAAGTGAGTGG + Intergenic
985244546 4:187966756-187966778 CTTTGCAAAGGGAGAATGAGAGG + Intergenic
986940144 5:12938617-12938639 CTATGGAAGTGGAAGTTTAGAGG - Intergenic
987128741 5:14840862-14840884 CTATGGAAAGGGAAAATGAACGG + Intronic
988214899 5:28259178-28259200 CTTTGGAAGGCCAAAGTGGGAGG + Intergenic
988299548 5:29404354-29404376 CTTTGGAAAGGGAAGGTAAGAGG + Intergenic
988306981 5:29505450-29505472 CTTTGGAAGGGCAAGGTGCGTGG + Intergenic
988465362 5:31485771-31485793 GTGTGGAGGGGGAAATTGATCGG - Intronic
988512167 5:31873969-31873991 CTTTGGAAGGCCAAAGTGGGCGG - Intronic
988521178 5:31946945-31946967 CTTTGGGAGGGAGAAGTGAGAGG - Intronic
989414261 5:41155220-41155242 TTTTAGAAGTAGAAATTGAGAGG - Intronic
989600587 5:43197027-43197049 CTTTGGGAGGCCAAAGTGAGAGG - Intronic
990522301 5:56591942-56591964 CTTTGGAAGGCCAAGGTGAGTGG - Intronic
990771360 5:59250085-59250107 CTTTGGGAGGCCAAAGTGAGAGG - Intronic
990917950 5:60931550-60931572 CTTTGGGAGGTGAAGGTGAGAGG - Intronic
990989155 5:61668464-61668486 AATTGGAAGGGGAGAATGAGTGG + Intronic
991275375 5:64840893-64840915 CTTTGTAAGGGAGAATTGACAGG + Intronic
991378072 5:65987287-65987309 CTTTGGGAGGCTGAATTGAGTGG + Intronic
992694964 5:79276978-79277000 CTTTGGAAGGCCAAAGTAAGAGG - Intronic
992831060 5:80593893-80593915 CTTTGGGAGGGCAAAGTGGGTGG + Intergenic
992834835 5:80630019-80630041 CTTTGGAAGGCCAAGGTGAGTGG + Intronic
993404052 5:87488783-87488805 CTTTGGATGGGGTTTTTGAGTGG - Intergenic
993469096 5:88285259-88285281 CTTTGGGAGGCTAAAGTGAGAGG + Intergenic
993739204 5:91517006-91517028 ACTTGTAAGGGGAAATAGAGGGG + Intergenic
994114935 5:96051139-96051161 CTTGGTAAGGGGAAATAAAGTGG + Intergenic
994622375 5:102178784-102178806 CTTTGGATGGGGTCTTTGAGTGG + Intergenic
996051272 5:118936559-118936581 CTTTGGAAGGCCAAGATGAGAGG + Intronic
996323980 5:122251965-122251987 CTTTGGATGGGGTCTTTGAGTGG + Intergenic
996378226 5:122837910-122837932 CTTTGGAAGGCCAAATTGGGTGG + Intergenic
996534308 5:124561425-124561447 CTTTGGGAGGCCAAAGTGAGAGG + Intergenic
996703650 5:126475067-126475089 CTTTAGAAGGGGAACTTGATTGG - Intronic
996857866 5:128030299-128030321 CTTTGGGAGGGAAAAGTGGGAGG + Intergenic
996932664 5:128908894-128908916 CTTTGGGAGGCCAAAGTGAGTGG - Intronic
997161242 5:131611424-131611446 CTTTGGGAGGCCAAAGTGAGTGG + Intronic
997163846 5:131637415-131637437 CTTTGGGAGGCCAAATTGAGTGG - Intronic
997264115 5:132485153-132485175 CTTTGGAAGGCGAAGGTGGGTGG - Intronic
997317885 5:132953080-132953102 CTTTGGGAGGGCAAGGTGAGAGG + Intronic
997767863 5:136523368-136523390 CTTTGGAATGGGAAATTTGGGGG + Intergenic
998306932 5:141087529-141087551 CTTAGGATGGGGAACTTGAGAGG + Intergenic
998587427 5:143441931-143441953 CTTTGGGAGGGCAAGCTGAGGGG - Intergenic
999185244 5:149702603-149702625 CTTTGGGAGGGCAAGGTGAGGGG - Intergenic
999623491 5:153495838-153495860 CTTTGGAAGGGGCATTTGGTTGG + Intronic
999666643 5:153919616-153919638 CTTTGGTAAGAGAAATTCAGTGG - Intergenic
999691437 5:154149178-154149200 CTTTGGGAGGCCAAGTTGAGTGG + Intronic
1000074989 5:157776603-157776625 TTTTGGAAGGCCAAAATGAGAGG - Intergenic
1000253692 5:159518504-159518526 CTTTGGCAAGGGAATTTTAGAGG + Intergenic
1000268288 5:159658716-159658738 CTTTGTGAAGTGAAATTGAGAGG - Intergenic
1000368242 5:160510749-160510771 CTTTGGAAGGCCAAAGTGGGTGG - Intergenic
1000874573 5:166620109-166620131 ATTTGGATGGGGAAAGTGAAGGG + Intergenic
1000970060 5:167704162-167704184 CCTTGGTATGGGATATTGAGAGG + Intronic
1001006125 5:168052014-168052036 CTTTGGGATGCGAAAGTGAGAGG + Intronic
1001828063 5:174762302-174762324 CTTTGGAAGGCTAAGTTGGGAGG - Intergenic
1001973506 5:175977485-175977507 CTTTGGGAGGCCAAAGTGAGAGG + Intronic
1002323440 5:178389304-178389326 CTTTGGAAAGGGAATGGGAGAGG - Intronic
1002506387 5:179682005-179682027 CTTTGGGAGGGGAAGGTGGGTGG + Intronic
1002693529 5:181068514-181068536 CTTTGGAAGGCCAAGGTGAGCGG + Intergenic
1003038664 6:2667458-2667480 CTTTGGAAGGGGCAATTAGATGG - Exonic
1003044956 6:2725212-2725234 CTTTGGGAGGCTAAAGTGAGAGG + Intronic
1004334752 6:14754619-14754641 CTTTGGGAGGCCAAAGTGAGAGG - Intergenic
1004702574 6:18092918-18092940 AATTAGAATGGGAAATTGAGAGG + Intergenic
1005312024 6:24567898-24567920 GTTTCTAAGGGGAAATTGGGAGG - Intronic
1005775499 6:29126735-29126757 CTTTGGGAGGCCAAATTGGGAGG - Intergenic
1006016251 6:31083574-31083596 CATTGGAAGGAAAAACTGAGAGG - Intergenic
1006469832 6:34222408-34222430 CTTTGGAAGGCTAAGGTGAGAGG + Intergenic
1007403416 6:41617773-41617795 CTTTGGGAGGACAAGTTGAGAGG + Intergenic
1007738375 6:43995899-43995921 CTCTGGAAGGTGGAATTGACTGG - Intergenic
1007824582 6:44590385-44590407 TTTTTAAAGGGGAAATTGAGTGG + Intergenic
1007910326 6:45506897-45506919 CTTTGGAAGGCCAAGTTGGGTGG - Intronic
1008137215 6:47790827-47790849 GTTTGGGAGGGGAAAGAGAGAGG - Intronic
1008878411 6:56354636-56354658 CTTTGGAAGGCCAAAGTGGGAGG + Intronic
1008996711 6:57668033-57668055 CTTTGGGAGGCCAAAGTGAGTGG - Intergenic
1009709511 6:67299830-67299852 CTTTGGATGGGGTCTTTGAGAGG + Intergenic
1010006343 6:70998966-70998988 CTTTGGATGGGGTCTTTGAGTGG - Intergenic
1010111298 6:72236953-72236975 CTTTGGAAGGCAAAGGTGAGAGG + Intronic
1010212202 6:73371047-73371069 CTTTGGGAGGCCAAAGTGAGAGG - Intronic
1010219285 6:73433728-73433750 CTTTGGAAGGCCAAGGTGAGTGG - Intronic
1010221808 6:73454469-73454491 CTTTGGAAGGCGAAGGTGGGTGG + Intergenic
1010227788 6:73507219-73507241 CTTTGGAAGGCCAAAGTGGGAGG + Intronic
1010242215 6:73627013-73627035 CTTTGGGAGGCCAAAGTGAGTGG - Intronic
1010387851 6:75303005-75303027 CCATGGTAGGGGAAATGGAGAGG + Intronic
1010413714 6:75589737-75589759 CTTTGGAAGGCCAAGGTGAGCGG - Intergenic
1011521281 6:88209441-88209463 CTCCGGAAGAGGAAAGTGAGTGG + Intergenic
1012472177 6:99584497-99584519 CTTTGGGAGGCGAAGGTGAGTGG - Intergenic
1012483574 6:99694834-99694856 CTTTGGGAGGCCAAAGTGAGTGG + Intergenic
1012619995 6:101331497-101331519 CTTTGGAAGGCTGAGTTGAGAGG - Intergenic
1013509489 6:110831536-110831558 CTTCGGAAGGTGAAAGTGGGAGG - Intronic
1014128989 6:117810166-117810188 CTTTGGATGGGGTTTTTGAGTGG + Intergenic
1014221580 6:118803731-118803753 CTTTGGAAGGCCAAGGTGAGAGG + Intergenic
1014755535 6:125298571-125298593 CTTAGGAAGGGGAAGGTCAGGGG - Intronic
1015504952 6:133974568-133974590 CTTTGGGAGGGCAAGGTGAGTGG - Intronic
1015574850 6:134660344-134660366 CTTTGGAAGGCTAAGTTGGGAGG - Intergenic
1015606626 6:134963143-134963165 GTTAGGAAGGGGAAATGGATTGG - Exonic
1015618136 6:135100908-135100930 CTTTGGAAGGCCAAAGTGGGTGG - Intronic
1017691309 6:156968287-156968309 ATGAGAAAGGGGAAATTGAGAGG + Intronic
1018852646 6:167652575-167652597 ACTCGCAAGGGGAAATTGAGAGG + Intergenic
1018965520 6:168484937-168484959 CTGGGGAAGGGGAAATGGGGAGG + Intronic
1019979847 7:4613560-4613582 CTATGCAAGCAGAAATTGAGAGG + Intergenic
1020011623 7:4808702-4808724 CGTTGGAAGGAGAAACGGAGGGG - Intronic
1020077345 7:5266957-5266979 CTTTGGAAGGGCGAAGTGGGAGG + Intergenic
1020084045 7:5301013-5301035 CTTTGGAAGGGCAAAGCGGGTGG + Intronic
1020102431 7:5401842-5401864 CTTTGGAAGGCCAAAGTGGGAGG + Intronic
1020159384 7:5756877-5756899 CTTTGGAAGGCCAAAGTGGGAGG - Intronic
1020558398 7:9698262-9698284 CTTTGGAAGGCCGAAGTGAGCGG - Intergenic
1020887654 7:13838694-13838716 CTTTTGAACCTGAAATTGAGGGG - Intergenic
1020967281 7:14887201-14887223 CTTTTAAAGGGGAATTTCAGTGG - Intronic
1021014776 7:15518645-15518667 CTTTGGATGGGGTTTTTGAGTGG - Intronic
1021194456 7:17659869-17659891 CTTTGGGAGGCCAAAGTGAGTGG + Intergenic
1021322413 7:19227833-19227855 CTTTGGATGGGGATTTTGTGTGG - Intergenic
1022323173 7:29305893-29305915 GTTTGGATGGGGAAAAGGAGAGG - Intronic
1023379941 7:39597324-39597346 CTTTGGGAGGTGGAAGTGAGAGG + Intronic
1023413850 7:39914075-39914097 CTTTGGAAGGCCAAAGTGGGAGG - Intergenic
1023495004 7:40785842-40785864 CTTTGGAAGGCCAAAGTGGGAGG + Intronic
1023712755 7:43012361-43012383 TTTTGGAAGTGGAGAATGAGTGG - Intergenic
1023910390 7:44551421-44551443 CTTTGGGAGGAGAAGTTGGGAGG + Intergenic
1024129033 7:46331189-46331211 CTTTGGGAGGCCAAAGTGAGTGG - Intergenic
1024316934 7:48028931-48028953 CTTTGGTAGGGGATCATGAGTGG - Exonic
1024336955 7:48218437-48218459 CTTTGGAAGGCCAAAGTGGGAGG + Intronic
1024966750 7:55029773-55029795 TTATGGAAGGTGAAACTGAGAGG - Intronic
1025201775 7:56966717-56966739 CTTTGGAAGGGCGAAGTGGGAGG - Intergenic
1025210232 7:57016177-57016199 CTTTGGAAGGGCAAAGTGGGTGG - Intergenic
1025661721 7:63560670-63560692 CTTTGGAAGGGCAAAGTGGGTGG + Intergenic
1025670171 7:63610211-63610233 CTTTGGAAGGGCGAAGTGGGAGG + Intergenic
1025937825 7:66051192-66051214 CTTTGGAAGGCCAAAGTGGGAGG + Intergenic
1025944110 7:66093071-66093093 CTTTGGAAGGGCAAGGTGCGAGG + Exonic
1026047803 7:66919700-66919722 CTTTGGGAGGTGGAAGTGAGCGG + Intergenic
1026123159 7:67555116-67555138 CGTTGAAAGGGATAATTGAGAGG + Intergenic
1026433062 7:70367311-70367333 CTTTGGAAGGCCAAGGTGAGTGG + Intronic
1026435650 7:70394832-70394854 CTTTGGGAGGCCAAAGTGAGAGG + Intronic
1026476692 7:70742517-70742539 CTTTGGGAGGCGAAGGTGAGTGG + Intronic
1026505631 7:70980309-70980331 CTTTGGGAGGGCAAAGTGGGGGG - Intergenic
1026584372 7:71644291-71644313 CTTTGGAAGGTCAAGGTGAGCGG + Intronic
1026912594 7:74099874-74099896 CTTTGGGAGGCCAAAGTGAGAGG + Intronic
1026961517 7:74411046-74411068 CTTTGGGAGGCCAAAATGAGAGG + Intergenic
1026963571 7:74425097-74425119 CTTTGGGAGGCCAAAGTGAGAGG + Intergenic
1027186533 7:75974768-75974790 CTTTGGGAGGCCAAGTTGAGTGG - Intronic
1027709096 7:81575090-81575112 CTTTGGAAGGCCAAGTTGGGTGG + Intergenic
1028455152 7:91030550-91030572 CTTAGGATGGGGCATTTGAGAGG - Intronic
1028519717 7:91716595-91716617 CTTTGGGAGGCCAAAGTGAGAGG + Intronic
1028523746 7:91760035-91760057 CTTTGGATGGGGTCTTTGAGTGG - Intronic
1028630159 7:92925869-92925891 CTTTGGATGGGGTCTTTGAGTGG + Intergenic
1029007971 7:97230302-97230324 AGTTGGAAGGGGGGATTGAGTGG - Intergenic
1029177801 7:98677239-98677261 CTTTGGGAGGCCAAATTGGGAGG + Intergenic
1029228433 7:99046482-99046504 CTTTGGGAGGCCAAAGTGAGCGG + Intronic
1029497717 7:100906046-100906068 CTTTGGGAGGCCAAAGTGAGTGG - Intergenic
1029816062 7:103096255-103096277 CTTTGGGAGGCCAAAGTGAGAGG + Intronic
1029847697 7:103429969-103429991 CTTTGGCAGAGGAATTTAAGGGG - Intronic
1029847929 7:103432157-103432179 CTTTGGAAGGCCAAAGTGGGTGG - Intronic
1030268010 7:107640524-107640546 CTTTGGAAGGTCAAATGAAGGGG - Intergenic
1030271927 7:107677858-107677880 CTTTGGGAGGCCAAAGTGAGAGG - Intronic
1031200355 7:118675715-118675737 CTTTGGATGATAAAATTGAGAGG + Intergenic
1033070671 7:138198579-138198601 CTTTGGTAAGGCAAATTAAGCGG - Intergenic
1033260447 7:139839593-139839615 CTTTGGGAGGGCAAAGTGGGAGG + Intronic
1033640714 7:143261198-143261220 CTTTGGAAGGCCAAAATGGGTGG + Intronic
1033782980 7:144694635-144694657 CTTTGGGAGGCCACATTGAGGGG - Intronic
1036393000 8:8341126-8341148 CTTTGGAAGGGGCAAAGTAGGGG - Intronic
1036462649 8:8967289-8967311 CTTTGGGAGGTTAAAGTGAGTGG - Intergenic
1036597796 8:10229829-10229851 ATTTGGAAGAGGAAAGGGAGAGG + Intronic
1036908592 8:12731453-12731475 CAGTGGAATGGGAAATAGAGAGG - Intronic
1037055762 8:14439741-14439763 CTTAGGAAACAGAAATTGAGGGG + Intronic
1037270646 8:17126094-17126116 GTTTGGAAGGGGAGATCCAGGGG + Intergenic
1038009473 8:23463292-23463314 CTTTGGGAGGTGAAAGTGGGAGG + Intergenic
1038220756 8:25604796-25604818 CCTTGGAAGGGGAAATGTAGAGG + Intergenic
1038395750 8:27244306-27244328 CTTGGGAAAGGGAAGGTGAGAGG - Intronic
1038928336 8:32165385-32165407 CTTTGGGAGGGCAAAATGGGAGG - Intronic
1039022214 8:33220182-33220204 CTTTGGGAGGCTAAATTGGGTGG - Intergenic
1039060624 8:33569427-33569449 CCTTTGAAGGGAAAATTGATGGG + Intergenic
1041228031 8:55719701-55719723 CTTTGGGAGGCCAAAGTGAGTGG + Intronic
1041379076 8:57233937-57233959 TTTTGGAAGGCCAAAGTGAGAGG + Intergenic
1041952228 8:63516501-63516523 ATTTGGAAAGGGAAATTAAAAGG - Intergenic
1042314873 8:67415040-67415062 TTTTGCAATGGGAAATTGAAAGG - Intergenic
1042479435 8:69286778-69286800 CTTGGGAAGTGAAGATTGAGTGG + Intergenic
1043434588 8:80226103-80226125 CTTTGGGAGGCCAAATTGGGAGG + Intronic
1043507951 8:80921423-80921445 CTTTGGAAGGTCAAGGTGAGCGG + Intergenic
1044460034 8:92433560-92433582 ATTTGGAAGGTAAATTTGAGGGG + Intergenic
1044641551 8:94387777-94387799 TTTTGGAGGGGGAATTTCAGAGG - Intronic
1045217277 8:100161094-100161116 CTTTGGAAGGCCAAAGTGGGAGG + Intronic
1045256828 8:100532220-100532242 CTTTGGAAGGCCAAAATGGGAGG + Intronic
1045313680 8:101025680-101025702 CTTTGGAAGGCCAAGGTGAGAGG - Intergenic
1045339712 8:101242652-101242674 CTTTGGAAGGCCAAAGTGGGTGG - Intergenic
1045849080 8:106672232-106672254 CTTTGGGAGGCCAAAGTGAGTGG + Intronic
1046094032 8:109537402-109537424 CTTTGAAAGGGGAGAGTAAGTGG + Intergenic
1046619327 8:116511781-116511803 GTTGGGAAGGGGAAATTTACAGG + Intergenic
1046813246 8:118555429-118555451 CATTTGTAGGGGAAATGGAGAGG - Intronic
1047169227 8:122474843-122474865 CTTTGGAAGGCCAAATGGGGAGG - Intergenic
1047373274 8:124273739-124273761 CTTTGGGAGGCCAAAGTGAGTGG - Intergenic
1048426979 8:134332154-134332176 CTTTGGCAGTGGAAAGTGGGTGG - Intergenic
1049068475 8:140338321-140338343 TTTTGGAAGTGGTAATGGAGCGG - Intronic
1049776347 8:144407436-144407458 CTTTGGAAGGCCAAGGTGAGTGG + Intronic
1049833660 8:144718805-144718827 CTTTGGAAGGGCAAGGTGGGTGG + Intergenic
1049963785 9:760600-760622 CTTGGGAAGGGCACCTTGAGGGG - Intergenic
1050260384 9:3835352-3835374 CTCTGGAGGGGGAAATTCTGGGG - Intronic
1050264519 9:3875871-3875893 TCATGGAAGGGGAAATGGAGAGG - Intronic
1051447290 9:17154324-17154346 CTTTGGATGGGGTCTTTGAGTGG + Intronic
1051664416 9:19455347-19455369 CTTTGGGAGGGGAAGGTGGGTGG + Intergenic
1052235799 9:26212395-26212417 CTTTGGAAGGCCAAGGTGAGTGG - Intergenic
1052628435 9:31005709-31005731 CTTTGGATGGGGATTTTGTGTGG - Intergenic
1052689936 9:31804421-31804443 CTTTGGGAGGCCAAAGTGAGAGG + Intergenic
1052791760 9:32881720-32881742 CTTTGGAAGGCTAAAGTGGGAGG - Intergenic
1053094732 9:35315133-35315155 CTTTGGAAGGCCAAAGTGGGAGG - Intronic
1053353199 9:37426704-37426726 CTTTGGGAGGCCAAAGTGAGCGG + Intronic
1053678822 9:40465456-40465478 CTTTGGAAGGGGTTTTTGTGGGG - Intergenic
1053928807 9:43093809-43093831 CTTTGGAAGGGGTTTTTGTGGGG - Intergenic
1054284901 9:63159486-63159508 CTTTGGAAGGGGTTTTTGTGGGG + Intergenic
1054291900 9:63300994-63301016 CTTTGGAAGGGGTTTTTGTGGGG - Intergenic
1054389919 9:64605537-64605559 CTTTGGAAGGGGTTTTTGTGGGG - Intergenic
1054505796 9:65910839-65910861 CTTTGGAAGGGGTTTTTGTGGGG + Intergenic
1055152653 9:73021146-73021168 TTGTGGTAGGGGAAATTGAGTGG + Intronic
1055319196 9:75065560-75065582 CTTTGGGAGGCTAAATTGGGAGG - Intronic
1055422021 9:76153725-76153747 AATTGTAAGGGGAAATTAAGAGG - Intronic
1055511660 9:77001129-77001151 CTTTGGGAGGCCAAAGTGAGAGG - Intergenic
1055988252 9:82076473-82076495 CTTTGGAAGTGGAAACTCAGTGG + Intergenic
1056061705 9:82889958-82889980 CTTGGTAAGGTGAAATTGAGGGG - Intergenic
1056459590 9:86796944-86796966 CTTTGGCAGGGGAATTTCATGGG - Intergenic
1057558824 9:96111352-96111374 CTGTGGAAGCAGAAAGTGAGGGG + Intronic
1057755634 9:97832769-97832791 CTTTGGAAGGCCAAGGTGAGAGG - Intergenic
1058245649 9:102621578-102621600 CTTTGGAAGGCCAAGGTGAGCGG - Intergenic
1058398344 9:104582604-104582626 CTTTGGAAGGCCAAGGTGAGAGG + Intergenic
1058824657 9:108764222-108764244 CTGAGGAAGAGGAAAGTGAGGGG - Intergenic
1058913867 9:109546606-109546628 CTTTGGGAGGCCAAAGTGAGAGG + Intergenic
1058986408 9:110212161-110212183 CTTTGGAAGGCCAAGGTGAGTGG + Intergenic
1059408249 9:114115965-114115987 CTTTGGAAGGGCTCATGGAGAGG + Intergenic
1059435572 9:114273996-114274018 CTTTGGAAGGCCAAAGTGAGTGG + Intronic
1060191886 9:121599019-121599041 CTTGGGAAGGGGACAGTGCGGGG - Intronic
1060842049 9:126801451-126801473 CTTTGGGAGGCCAAAGTGAGAGG - Intergenic
1060926564 9:127459460-127459482 CTTTGGGAGGCCAAAGTGAGTGG - Intronic
1185516550 X:703316-703338 CTTTGGAAGGCCAAGTTGGGAGG - Intergenic
1185639981 X:1584572-1584594 CTTTGAAAGGAGAGATTCAGTGG - Intergenic
1186008206 X:5098040-5098062 CTTTGGGAGGCCAAGTTGAGAGG + Intergenic
1187028369 X:15459316-15459338 ATTTGGAAGGGGCTACTGAGAGG + Intronic
1187195579 X:17080403-17080425 CTTGGCAAGGGGAGAGTGAGGGG - Intronic
1187251557 X:17603087-17603109 CTTTGGAAGGTGAAAGTGGGAGG - Intronic
1187345604 X:18460742-18460764 CTTTGGAAGGCCAAGGTGAGAGG - Intronic
1187902335 X:24036443-24036465 CTTTGGAAGGCCAAAGTGGGCGG + Intergenic
1188299113 X:28485469-28485491 CTTTGGAAATGGAAATGAAGAGG + Intergenic
1189193749 X:39134489-39134511 AGTTGGAAGGGGGAATGGAGTGG + Intergenic
1189537969 X:41956085-41956107 CTGTGGATGGGGAGCTTGAGTGG - Intergenic
1189747600 X:44185773-44185795 CTTTGGGAGGCCAAAGTGAGAGG - Intronic
1190059020 X:47199135-47199157 GTGTGGAATGGGACATTGAGAGG + Intronic
1190299913 X:49051106-49051128 TGTTGGAAGGGGAATTTTAGGGG + Intergenic
1190626268 X:52341305-52341327 CTTTGGAAGGCCAAGGTGAGAGG - Intergenic
1190765088 X:53469395-53469417 CTTTGGGAGGCGAAGGTGAGTGG + Intergenic
1191139014 X:57095599-57095621 CTTTGGATGGGGTCTTTGAGTGG - Intergenic
1191650315 X:63529821-63529843 CTTTGGAAAGAGAAAGAGAGTGG + Intergenic
1192120109 X:68447500-68447522 CTTTGGGAGGCCAAAGTGAGAGG - Intergenic
1192431368 X:71114350-71114372 CTTTGGAAGGCCAAGGTGAGTGG + Intergenic
1192714719 X:73627534-73627556 CTTTGGAAAGGGAAGAAGAGTGG - Intronic
1192745377 X:73933277-73933299 CTTTGGAAGGCCAAAGTGGGTGG + Intergenic
1192939341 X:75896448-75896470 GTTGGGAAGGGGTAGTTGAGGGG + Intergenic
1193104763 X:77657963-77657985 CTTTGGGAGGCCAAGTTGAGAGG + Intronic
1193117574 X:77790169-77790191 CTTTGGGAGGCCAAAGTGAGTGG + Intergenic
1193194143 X:78609960-78609982 CTTTGGGAGGCCAAAGTGAGTGG + Intergenic
1193844956 X:86456829-86456851 CTTTTGAAGGAGAAATTGATAGG + Intronic
1194118886 X:89936986-89937008 CTTTGGATGGGGTCTTTGAGTGG + Intergenic
1194193628 X:90865947-90865969 CTTTGGATGGGGTTATTGTGAGG - Intergenic
1194596062 X:95859936-95859958 CTTTGGGTGGGGAAATTAAAGGG - Intergenic
1196309127 X:114140957-114140979 TTTAAGAAGGGGAAATTGATGGG - Intergenic
1196520764 X:116668199-116668221 TTTTGGAGGGGGCAAGTGAGAGG - Intergenic
1196946486 X:120832225-120832247 CTTTGGATGGGGTTTTTGAGTGG + Intergenic
1197175450 X:123481002-123481024 CATTGCACGGGGAAAATGAGTGG - Intronic
1197236214 X:124067506-124067528 CTTTGGAAGGCCAAAATGCGCGG - Intronic
1197732876 X:129826948-129826970 CTTTGGAAGGCCAAGGTGAGAGG + Intronic
1198568100 X:137925976-137925998 ATTTGGAAGGGGAAATGGTAAGG - Intergenic
1199804670 X:151286462-151286484 CTTTGGGAGGTCAAAGTGAGAGG - Intergenic
1199830807 X:151547045-151547067 CTTTGGAAGGGGTTTTTGTGTGG - Intergenic
1200344734 X:155436566-155436588 CTTTGGATGGGGACTTTGTGGGG - Intergenic
1200356667 X:155559707-155559729 ATTTGGAAGGAAAAATTGACAGG - Intronic
1200419950 Y:2954438-2954460 CTTTGGAAGGCTCAATTGTGAGG + Intronic
1200471761 Y:3594540-3594562 CTTTGGATGGGGTCTTTGAGTGG + Intergenic
1200540240 Y:4448329-4448351 CTTTGGATGGGGTTATTGTGAGG - Intergenic
1201422190 Y:13811899-13811921 CTTTGGATGGGGTCTTTGAGTGG + Intergenic
1201493184 Y:14564992-14565014 CTTTGGATGGGGTCTTTGAGTGG - Intronic