ID: 929913981

View in Genome Browser
Species Human (GRCh38)
Location 2:46118331-46118353
Sequence ACAAGCTCTTTGGCCAACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 107}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929913981_929913983 4 Left 929913981 2:46118331-46118353 CCAAAGTTGGCCAAAGAGCTTGT 0: 1
1: 0
2: 0
3: 14
4: 107
Right 929913983 2:46118358-46118380 GTTCTACAATGATCTCAAATTGG 0: 1
1: 0
2: 0
3: 10
4: 125
929913981_929913984 10 Left 929913981 2:46118331-46118353 CCAAAGTTGGCCAAAGAGCTTGT 0: 1
1: 0
2: 0
3: 14
4: 107
Right 929913984 2:46118364-46118386 CAATGATCTCAAATTGGTAAAGG 0: 1
1: 0
2: 0
3: 13
4: 190
929913981_929913985 13 Left 929913981 2:46118331-46118353 CCAAAGTTGGCCAAAGAGCTTGT 0: 1
1: 0
2: 0
3: 14
4: 107
Right 929913985 2:46118367-46118389 TGATCTCAAATTGGTAAAGGAGG 0: 1
1: 0
2: 0
3: 14
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929913981 Original CRISPR ACAAGCTCTTTGGCCAACTT TGG (reversed) Intronic
900728297 1:4233435-4233457 AAAATCCCTTTGGTCAACTTGGG - Intergenic
905234158 1:36534356-36534378 TCAAGCTCTTTGATCCACTTTGG + Intergenic
907493508 1:54826110-54826132 CCAAACTCTTAGGCCATCTTGGG - Intronic
911652718 1:100408078-100408100 ACAAACACTTGGGCCAACTTGGG - Intronic
911992309 1:104715698-104715720 ACAAGGCCTTTGTCCTACTTTGG + Intergenic
916646570 1:166792535-166792557 ACAACCTCTTTGTCCAGCTTGGG - Intergenic
919072251 1:192771175-192771197 ACAAGCACTTTGGAAAAGTTTGG + Intergenic
922351290 1:224736579-224736601 ACAAGCTCTCTGGACAATCTTGG + Intronic
922558837 1:226552470-226552492 ACAAACTCTCTGGCCATGTTGGG - Intronic
923550201 1:234957819-234957841 TCTAGCACTTTGGCCAACTGAGG + Intergenic
1064107251 10:12510468-12510490 ACAAGATCTTTAGACAACTTCGG - Intronic
1070353565 10:75617005-75617027 CCAAGCACTGAGGCCAACTTAGG - Intronic
1071815181 10:89225117-89225139 ACTAGCCCTATGGCCAAATTAGG - Exonic
1075956302 10:126525987-126526009 ACAAGCTATTTAGGCAGCTTTGG - Intronic
1077647566 11:3939036-3939058 AAAAGTTCTTTGCCCAACTTGGG - Intronic
1083460530 11:62808133-62808155 AAAAGCTCTATGGCCAACCATGG + Intronic
1085710584 11:78825606-78825628 ACAAGCTCTTTTGCATTCTTGGG - Intronic
1086290167 11:85299679-85299701 ACAAGCTCTTTGGGTGATTTTGG - Intronic
1087696748 11:101387471-101387493 ACAAACACTTTGGAAAACTTTGG - Intergenic
1088337821 11:108728181-108728203 ACAAGCCCTTTTCCTAACTTAGG + Intronic
1088712151 11:112518275-112518297 AGATGCTCTTTAGCTAACTTAGG - Intergenic
1091592079 12:1848680-1848702 AAAACCTCATTGGCCATCTTTGG - Intronic
1093655111 12:21685855-21685877 GCAAACTCATTGGCCAACTTTGG - Intronic
1094854153 12:34395467-34395489 TCAAGCTTTTTTGCCACCTTGGG - Intergenic
1097638219 12:62147406-62147428 AGAAGCTCTTTGGTTAAATTAGG - Intronic
1097827358 12:64187957-64187979 ACAAGGCCTTTGGCCAACTGCGG - Intronic
1104131768 12:125900589-125900611 TCAAGCACTTTGGCCAGCTTTGG + Intergenic
1105969332 13:25413780-25413802 ACAAGGTCTTTGGCCAGCGATGG - Intronic
1106556677 13:30815496-30815518 ACAACCTTATTGGTCAACTTTGG - Intergenic
1113329673 13:109316128-109316150 ACAAGCACTATGTCCAAATTAGG - Intergenic
1121594782 14:95153268-95153290 ATAAGCTCTGTGGACAACATGGG - Intronic
1124858736 15:33416676-33416698 AGAAGCTCTTTAGCTTACTTAGG + Intronic
1128777198 15:70329513-70329535 ATAAGTTGTCTGGCCAACTTGGG - Intergenic
1129413855 15:75364051-75364073 CCAGGTTCTTTGGCCAACATGGG - Exonic
1130697326 15:86143828-86143850 AGTACCTCTTAGGCCAACTTTGG - Exonic
1131334420 15:91534143-91534165 ACATGCTCTTTGGTCCAGTTGGG + Intergenic
1133903586 16:10000201-10000223 AAAATCTCTTTTGCCAAATTAGG + Intronic
1135209865 16:20516044-20516066 ACAAGCTCTGTGGCCAAGTATGG - Intergenic
1141317132 16:82973141-82973163 ACAATCTCTTTCCCCAACTTGGG + Intronic
1141862873 16:86729944-86729966 ACCAGGCCTTTGGCTAACTTTGG + Intergenic
1146315758 17:31805686-31805708 ATAAGCTCTTGGGCCAACTGGGG + Intergenic
1146797023 17:35788992-35789014 ACAAGTTCAGTGGGCAACTTAGG - Intronic
1147530096 17:41267855-41267877 ACATTCTCTTTGACCAACATCGG + Intergenic
1150875574 17:68966476-68966498 ACAACCACTTTGGCAAAGTTTGG - Intergenic
1159139139 18:64371178-64371200 ACAAGAGATTTGGTCAACTTGGG + Intergenic
1160213611 18:76906488-76906510 GTAAGCTCTTGGGCCAACTGGGG - Intronic
1164853583 19:31503743-31503765 ATCAGCACTTTGGCAAACTTGGG + Intergenic
1167709322 19:51100186-51100208 ACAAGCTCCCTGGGGAACTTGGG + Intronic
926509983 2:13763021-13763043 ACAAGCTCTTTCACCAAATAGGG + Intergenic
926709222 2:15863209-15863231 ACATGCTTTTTGGTGAACTTTGG - Intergenic
926764883 2:16315519-16315541 TCAAGCTCTGTGTCCAGCTTTGG + Intergenic
927875701 2:26653849-26653871 ACAACCTCTTTTCCCTACTTGGG - Intergenic
929527296 2:42717083-42717105 AAATGCTCTTTTGCCATCTTCGG + Intronic
929913981 2:46118331-46118353 ACAAGCTCTTTGGCCAACTTTGG - Intronic
933724609 2:85419361-85419383 AGAAGCTCCTTGGGCAACCTGGG - Intronic
934607001 2:95703122-95703144 AGAAGCTCTTGGGGCAACTGAGG - Intergenic
936540400 2:113345282-113345304 AGAAGCTCTTGGGGCAACTGAGG - Intergenic
936704975 2:115061343-115061365 AAAAGCCATTTGGCCAATTTTGG - Intronic
940032443 2:149278312-149278334 ACAAACTCTTTTGCCAAATGGGG + Intergenic
941055346 2:160781568-160781590 AAAAGCTCTTTGGTCTAATTAGG - Intergenic
943153431 2:184143777-184143799 AGAAGCTCTTTAGCCTAATTAGG - Intergenic
943741271 2:191412177-191412199 ACAGGCACTTTGGACAACTTTGG - Intronic
947897181 2:233686654-233686676 ACTACCTCTTTGGCCCACTCAGG + Intronic
948013477 2:234669372-234669394 ACAATCTCATGGGCCAACTTTGG - Intergenic
1174467553 20:50729953-50729975 GCAGGCTCTTTGCCCCACTTGGG - Intergenic
1180737306 22:18026914-18026936 ACAAACTCTTTGGGAAACTAGGG + Intergenic
1181519291 22:23436190-23436212 ACACTCTCTTTCCCCAACTTTGG - Intergenic
1181817828 22:25452290-25452312 TCAGGCTCTTTGCCCAATTTTGG + Intergenic
952380676 3:32802243-32802265 AGAAGCTCTTTGGTCTAATTAGG + Intergenic
953557851 3:43960946-43960968 ACCAGCTCTCTGGCCAAGTAAGG - Intergenic
955532917 3:59892852-59892874 ACATGCTCTTTGGTCATATTTGG + Intronic
960855044 3:122094073-122094095 CCAAGCTCTTGGGTCAACTGAGG - Intronic
965473379 3:169123014-169123036 ACAAGCTATTTGTCCAGTTTTGG + Intronic
966200068 3:177352858-177352880 ACAAGGTCTTTGGAAAACTATGG + Intergenic
966667597 3:182489335-182489357 AGAAGCTCTGTGACCTACTTGGG - Intergenic
969930095 4:10622502-10622524 AGAAGGTCTTTGCCCAACCTTGG + Intronic
972580396 4:40390555-40390577 ACAACATCTTTGTACAACTTGGG + Intergenic
973976239 4:56265332-56265354 ACAAGCATTTTGGGCTACTTTGG - Intronic
974824564 4:67111258-67111280 ACAACCTCATTGGTCACCTTTGG + Intergenic
988241074 5:28609891-28609913 AAAAGCTCTTTCTCCAACTACGG - Intergenic
990012572 5:51018207-51018229 ACAATCTCGTTGGCCAAGGTTGG - Intergenic
994089247 5:95794328-95794350 ACAAATTCTTGAGCCAACTTCGG - Exonic
995662733 5:114503186-114503208 ACTAGTTCTTGGGCCAATTTTGG - Intergenic
995997394 5:118318511-118318533 ACAACATCTTTGGGCCACTTTGG + Intergenic
997093826 5:130888123-130888145 CCAAACTCGTTGTCCAACTTAGG - Intergenic
1004306483 6:14506096-14506118 ACCAGCTCTTGGACCACCTTAGG - Intergenic
1008011477 6:46472194-46472216 ACAGGCTTTTGGGCCAGCTTGGG + Intronic
1012346029 6:98187511-98187533 ACAAGCTCTTTGGTTATTTTGGG - Intergenic
1015459529 6:133473333-133473355 ATGAGCTCTTTGCCCACCTTTGG + Intronic
1016042176 6:139442570-139442592 AGGAGCTCTTTGGTCATCTTGGG + Intergenic
1019434190 7:1013321-1013343 ACAAGCCCTTGGGGCAACTTTGG - Intronic
1019591989 7:1840141-1840163 ACACTCTCTTTCCCCAACTTTGG + Intronic
1019608488 7:1922763-1922785 AGATGCTCTTTGGCAAACTTGGG + Intronic
1020697862 7:11437624-11437646 AAAAGCTCTTTGGAGAAATTAGG + Intronic
1027538399 7:79436356-79436378 ACAAGCTCTTTAGTTGACTTAGG - Intronic
1028010887 7:85642193-85642215 ACAGGATCTGTAGCCAACTTGGG + Intergenic
1028895992 7:96042692-96042714 AAAACCTCTTTGGCCACCTATGG + Intronic
1030076161 7:105738872-105738894 ACAAGCTCCATGACCAACTCTGG - Intronic
1030658624 7:112195505-112195527 ACAAGCTCCTCAACCAACTTTGG + Intronic
1031012447 7:116537997-116538019 CCAGGGTCTCTGGCCAACTTGGG - Intronic
1036031714 8:4981228-4981250 ACAATCTATTTGGCCATTTTAGG + Intronic
1036699167 8:11000433-11000455 CCAAGCTCTTTGGGAAACTGAGG + Intronic
1037528419 8:19750243-19750265 CCATCCTCTTTGGCCAGCTTAGG + Intronic
1039367309 8:36943636-36943658 AGAAGCTCTTTGGTTTACTTAGG - Intergenic
1040422398 8:47252410-47252432 ACAAGCTCTGAGCCCAACTGAGG - Intergenic
1042779701 8:72477182-72477204 TCAAGCTCTCTGGCAAAATTGGG - Intergenic
1046121554 8:109854098-109854120 CCAAGCTCTTTCTCCAACATAGG - Intergenic
1050740914 9:8819666-8819688 AAAAGCTCTTTGTGAAACTTGGG + Intronic
1051123645 9:13779083-13779105 AGAAGCTCTTAGGCCCATTTGGG - Intergenic
1055971681 9:81918224-81918246 ACAAGCTCATTCTCCATCTTGGG + Intergenic
1055973434 9:81933296-81933318 ACAAGCTCATTCTCCATCTTGGG + Intergenic
1055975188 9:81948388-81948410 ACAAGCTCATTCTCCATCTTGGG + Intergenic
1058172675 9:101701703-101701725 AGAAGCTCTTTGGCTTAATTAGG - Intronic
1062076362 9:134592129-134592151 ACCGGCTCTGTGGCCAACTACGG - Intergenic
1187793436 X:22976066-22976088 ACAAGCTCTTTAGTTAAATTAGG - Intergenic
1190297033 X:49033708-49033730 ACACGCTCTCTGGCTTACTTAGG + Exonic
1190788788 X:53680565-53680587 ACATGCTTTTTGGCCATATTGGG + Intronic
1192115994 X:68411756-68411778 AGAAGCTCTTTAGCCTAATTAGG + Intronic
1192689453 X:73346907-73346929 AGAAGCTCTTTGGTTAAATTAGG + Intergenic
1193308916 X:79981966-79981988 ACAAGCTCTTTGGTTTAATTAGG + Intergenic
1200297289 X:154933361-154933383 ATAAGCTATCTGGCCAAGTTGGG + Intronic
1201169813 Y:11247076-11247098 ACAAGCTCTTGGTCTAACATGGG - Intergenic