ID: 929915933

View in Genome Browser
Species Human (GRCh38)
Location 2:46135641-46135663
Sequence TCATTCTGGGCCAATCTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 156}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929915933_929915938 16 Left 929915933 2:46135641-46135663 CCCTGGAGATTGGCCCAGAATGA 0: 1
1: 0
2: 1
3: 7
4: 156
Right 929915938 2:46135680-46135702 CTCGGTTATCAGCACTGCAATGG 0: 1
1: 0
2: 0
3: 5
4: 54
929915933_929915937 -2 Left 929915933 2:46135641-46135663 CCCTGGAGATTGGCCCAGAATGA 0: 1
1: 0
2: 1
3: 7
4: 156
Right 929915937 2:46135662-46135684 GAAATATTATCTTTGACTCTCGG 0: 1
1: 0
2: 0
3: 26
4: 366

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929915933 Original CRISPR TCATTCTGGGCCAATCTCCA GGG (reversed) Intronic
900701060 1:4048897-4048919 ATGTTCTGGGCCAGTCTCCACGG + Intergenic
901096649 1:6686505-6686527 TCATCCTGTGCCAATCACCAAGG + Intronic
902688285 1:18093273-18093295 TCCTTAAGGGCCATTCTCCAAGG + Intergenic
917083531 1:171281877-171281899 TCATTCTGGGGCTCTCTCCTTGG - Intronic
918045558 1:180938987-180939009 CCATTCTGGGCCCCTCCCCAGGG - Intronic
919574548 1:199291699-199291721 TCATTGTATGCAAATCTCCAAGG + Intergenic
923782373 1:237036424-237036446 TCATGCTGGGACAAACTCTATGG + Intergenic
1065205794 10:23356743-23356765 TCATTCTCTCCCATTCTCCAAGG + Intergenic
1067534619 10:47099799-47099821 TCATTTTGGGCCCATCTGAAGGG - Intergenic
1068967195 10:62924551-62924573 TGCTTCTGGGCCCAACTCCAAGG + Intergenic
1069117280 10:64523422-64523444 TCAGTCTGGGTCAATTACCAGGG - Intergenic
1070873301 10:79777484-79777506 TCAATCTAGACCAGTCTCCAAGG - Intergenic
1071640229 10:87299635-87299657 TCAATCTAGACCAGTCTCCAAGG - Intergenic
1071655002 10:87438311-87438333 TCAATCTAGACCAGTCTCCAAGG + Intergenic
1073180759 10:101581518-101581540 TCAAACTAGGCCAGTCTCCATGG + Intronic
1079449051 11:20583522-20583544 TCATTCTAGGCCTCTTTCCATGG + Intergenic
1080425200 11:32148417-32148439 GCCTTCTGGGCCAATGTCCTGGG - Intergenic
1081586108 11:44384920-44384942 TCCTTCTGGGCCACCCTCCTTGG + Intergenic
1082800841 11:57413851-57413873 TGCTCCTGGGCCACTCTCCAAGG + Intronic
1085300487 11:75455608-75455630 TCATTCTGGCCCCATCTCATGGG + Intronic
1087832119 11:102830648-102830670 TCATCCTAGACCAATCACCATGG - Intergenic
1089564018 11:119361349-119361371 TAATCCTGGGCATATCTCCAAGG + Intronic
1095517764 12:43025661-43025683 TTAGTCTGGGCAAATCTGCAGGG + Intergenic
1095863623 12:46947669-46947691 TCCTCCTAGGCCTATCTCCAGGG + Intergenic
1099585267 12:84506355-84506377 TTATACTGGGCCACTTTCCAAGG - Intergenic
1100892784 12:99144828-99144850 CCATTCTGGACCTATCTCCTTGG - Intronic
1102958207 12:117073258-117073280 TGAGTCTGAGCCAATCGCCATGG - Intronic
1105557063 13:21457593-21457615 TTATTCTGGGCCTACCTGCAGGG + Intronic
1106232523 13:27831953-27831975 TTATTTTGAGCCAATCTTCAGGG - Intergenic
1108721461 13:53136957-53136979 TCAGTCTGGCCCACTCTCAAGGG + Intergenic
1109493155 13:63130219-63130241 TCATTCTGGGCCTGTCACTATGG + Intergenic
1109704319 13:66069855-66069877 TCATTCTGAGACAAACTGCAGGG + Intergenic
1110306676 13:73995969-73995991 CCATTCTGTGCCAATGTCTATGG + Intronic
1113048731 13:106185052-106185074 TCATTCTGGGCCAATCATAGTGG - Intergenic
1113302388 13:109036267-109036289 TCATGCTTGGCTAATCACCAAGG - Intronic
1113960325 13:114122462-114122484 TCATTCTGGCCCAGGCTGCATGG - Intronic
1119409746 14:74423119-74423141 TTATTCTGGGCCCTTCTACAAGG - Intronic
1119948132 14:78716099-78716121 GCATTCTGGCCCAGTCTACAGGG - Intronic
1121617337 14:95321339-95321361 TCCTTCTGGGCTCAGCTCCAAGG - Intergenic
1121955381 14:98208271-98208293 TCATCCTGGACCCATGTCCATGG + Intergenic
1127070669 15:55285851-55285873 CCATTCAGTGCCTATCTCCAGGG - Intronic
1128768600 15:70265866-70265888 TCATTCTGTGACAATTTGCATGG + Intergenic
1130559783 15:84948925-84948947 CCATTCTGGGCCACTCTGAATGG + Intergenic
1130807600 15:87342615-87342637 TAATTCTGTGCCAAACTCAATGG + Intergenic
1134442514 16:14307700-14307722 TCACTCTGGGCCGACCCCCAAGG - Intergenic
1138951396 16:61917562-61917584 TCATGATGAGCCTATCTCCAAGG - Intronic
1139706672 16:68745771-68745793 TCACTGAGAGCCAATCTCCAAGG + Intronic
1142206648 16:88785936-88785958 TCTTTCTGTGCCCATCTCAAGGG - Intergenic
1143525181 17:7467679-7467701 TCCCTTTGGCCCAATCTCCAGGG + Intronic
1143584806 17:7845747-7845769 TCAATCTGTGTCATTCTCCATGG + Intronic
1143835046 17:9684884-9684906 TCATTCTGGGCCAGAGTCCGGGG + Intronic
1144064502 17:11612373-11612395 TCTTTCTGGGCCTGTCTTCAGGG + Intronic
1144124610 17:12190872-12190894 TCATTCTGGGCCAGTCACGGTGG + Intergenic
1144265843 17:13568741-13568763 TCATTCTGGGGTAGTCTCCTGGG + Intronic
1146751958 17:35389812-35389834 TAATTCTGGGCCACTCTCAGTGG + Intergenic
1148808523 17:50276340-50276362 CCTTTCTGGGCCAACCTGCAGGG + Intronic
1152938250 17:83152893-83152915 CCATTCTCGGCCCATCTCCACGG - Intergenic
1155028563 18:21964326-21964348 GAATTCTGGGCCAGTCACCATGG + Intergenic
1157885337 18:51360996-51361018 TCATCATGGCCCATTCTCCATGG + Intergenic
1163648705 19:18504805-18504827 TTACTCTGGGACACTCTCCACGG + Intronic
1163860044 19:19738073-19738095 GCTCTCTGGGCCCATCTCCAAGG - Intergenic
1163987597 19:20968156-20968178 TCTATCTGGGCCAATCTTCTAGG + Intergenic
1164261002 19:23568487-23568509 TCATCATGGGCCATTCTCGATGG - Intronic
1164604684 19:29589280-29589302 TCATCCTGAACCAATCACCAGGG + Intergenic
1164745393 19:30608875-30608897 TTAATCTGGTCCAAGCTCCAAGG - Intronic
926088601 2:10035821-10035843 TCACTCTGGGTCACTCTGCATGG - Intergenic
929825292 2:45305315-45305337 AGATTCTGGGCCATTCTGCATGG - Intergenic
929830647 2:45343986-45344008 GCCTTCTGGGCCCACCTCCAAGG + Intergenic
929915933 2:46135641-46135663 TCATTCTGGGCCAATCTCCAGGG - Intronic
932498496 2:72159739-72159761 TCTGTCTAGGCCAGTCTCCATGG + Intergenic
933261730 2:80138675-80138697 TCATCCTGGGACCATCTGCATGG + Intronic
936003138 2:108854728-108854750 TCTTTCTTGGCCTCTCTCCAGGG + Intronic
938138901 2:128780870-128780892 TCATGCTGGCCCATTCACCAGGG - Intergenic
939918956 2:148085032-148085054 TATTTCTGGGTCAATCTGCATGG - Intronic
945780152 2:214160583-214160605 TCATTCTTTCCCATTCTCCATGG + Intronic
946228928 2:218279780-218279802 TCAGTCTGGGAGAATCTCCTAGG - Intronic
1169903152 20:10573103-10573125 TCATTGTGAGCCATTCTCCCCGG + Intronic
1172843064 20:37913670-37913692 TCCTTCTGGGCCTGTATCCAGGG + Intronic
1173269796 20:41522883-41522905 CCATCCTGGACCAATCACCATGG - Intronic
1173364415 20:42371933-42371955 ACATTCTGGACCAACCTACATGG - Intronic
1173724181 20:45285759-45285781 TCATTCTGTGGTAATCTCTAGGG + Intergenic
1174422024 20:50405484-50405506 TCACTGTGGGACAGTCTCCAAGG + Intergenic
1174913593 20:54632666-54632688 TCATTCTGGGAAATTTTCCACGG - Intronic
1175018879 20:55823097-55823119 TCAGTCTTGGCCAATCTCCAGGG + Intergenic
1175928324 20:62481450-62481472 CCACTCTGGGTCAGTCTCCAGGG + Intergenic
1178759457 21:35386997-35387019 TCATTATGAACCACTCTCCATGG - Intronic
1182064893 22:27423763-27423785 TCATTCTGGCCCAATGCTCATGG + Intergenic
1183004784 22:34892086-34892108 TCTTTCTGGGGCAGGCTCCATGG - Intergenic
1183467503 22:37987015-37987037 TCATTCTTGACCCTTCTCCAGGG + Intronic
1184968123 22:47996170-47996192 TGATTTGGGGCCAATCTGCATGG + Intergenic
1185221357 22:49630585-49630607 TCGTTCTGGGCCCTTCTCCCGGG - Intronic
949127910 3:468713-468735 TAATTCTAGTTCAATCTCCATGG - Intergenic
950884002 3:16347091-16347113 CCATTCTGGCCCTTTCTCCAGGG + Intronic
954322711 3:49842937-49842959 TCATTCTTGGCAACTGTCCATGG - Intronic
960419109 3:117421815-117421837 TCCTTATAGGCCAATCTTCAGGG - Intergenic
961823477 3:129586923-129586945 TCCTTCTGGGCTCGTCTCCAAGG + Intronic
962446127 3:135467514-135467536 TCATTGTGGGGCTACCTCCAGGG + Intergenic
963626522 3:147680097-147680119 ACATTCAGGGCCAAACTGCATGG + Intergenic
966910419 3:184556541-184556563 TAATTAAGGGCCAATATCCATGG - Intronic
970255680 4:14167323-14167345 TCATTCTGGTCAATTCTCTAGGG - Intergenic
971169829 4:24222058-24222080 TAATTCAGGGACCATCTCCAAGG + Intergenic
973637016 4:52869868-52869890 TCATCCTGGGCCACTCCCCAAGG - Intergenic
973802302 4:54491584-54491606 TTGTTCTGGGCCAAACTTCAGGG - Intergenic
974522689 4:63005096-63005118 TCATTCTGTGCCTCTCTCTATGG + Intergenic
975675579 4:76824337-76824359 TCATCCTGGGACATTTTCCACGG + Intergenic
976061841 4:81137748-81137770 TTCTTCAGGGCCAACCTCCAAGG + Intronic
976090551 4:81452876-81452898 TCATTTTGGGCAAATCCCCAGGG + Intronic
976538742 4:86247931-86247953 TCAGGCTTGGCCAATCTCAAAGG + Intronic
979670857 4:123358815-123358837 TCATTCTTGGCCATTCTCTGTGG - Intergenic
981578687 4:146230554-146230576 TCTGTCTGGGACACTCTCCAGGG - Intergenic
982659763 4:158192686-158192708 TCATACTAGGCCTATTTCCAAGG + Intergenic
984245546 4:177271333-177271355 ACATTCTGGGGCATTCCCCAGGG - Intergenic
990709032 5:58562976-58562998 TCATCATGGGCCATTCTCGATGG + Intergenic
992677595 5:79121291-79121313 TCCTTCTGGGCCAATGCACATGG - Exonic
1000663653 5:163967731-163967753 CCCTTCTGGGCCAATCTGCTTGG - Intergenic
1008690984 6:53978207-53978229 ACATTTTGCGCCTATCTCCATGG - Intronic
1011338855 6:86290068-86290090 TCATTCTGGTGCTATCTCCGAGG - Intergenic
1018040852 6:159920892-159920914 TCAATGTTGGCCAATCTGCAGGG + Intergenic
1018714155 6:166518971-166518993 TCATTCATGGCCCATATCCAGGG + Intronic
1019061209 6:169259497-169259519 GAATTCTGGGCCCCTCTCCAGGG - Intergenic
1019861190 7:3659556-3659578 TCACTTTGGGCCACTCTCCTCGG - Intronic
1021514775 7:21472230-21472252 TCTTCCTAGGCCACTCTCCAGGG - Intronic
1021575551 7:22102688-22102710 TTGTTCTGGGCCACTCTCCTTGG + Intergenic
1021695085 7:23268743-23268765 TCATTCTGGTCCTCTCCCCAAGG - Intronic
1022959562 7:35413553-35413575 TCATTCTGTGACAAGCCCCAAGG - Intergenic
1023998495 7:45176572-45176594 TCCTTCAGGGCCTGTCTCCACGG - Intronic
1025784492 7:64632248-64632270 TAATGCTGGGCCAAGCACCAAGG + Intergenic
1029282649 7:99446445-99446467 TCATTCTGGTCGGACCTCCATGG + Intronic
1030539110 7:110807004-110807026 TCATTATGGTCCAACATCCATGG - Intronic
1031328424 7:120432257-120432279 TCATTCTGGGGCAATCTTTACGG - Intronic
1033924046 7:146434898-146434920 TCATTCAGGGCCGCTCTGCAGGG + Intronic
1037023473 8:14003095-14003117 ACATTCTGGCCCAAGTTCCAAGG - Intergenic
1037280685 8:17238676-17238698 TCATTCTTGGCCATTTGCCAAGG + Intronic
1040284451 8:46092764-46092786 TCACTCTGGGCCAGTTCCCATGG - Intergenic
1040409313 8:47138190-47138212 TCATCATGGCCCATTCTCCATGG - Intergenic
1040890612 8:52313017-52313039 TCATTTAGGGTCAATCTTCAAGG - Intronic
1041192547 8:55368240-55368262 TCATTGTGGGCCAGGCACCATGG - Intronic
1042371296 8:67993749-67993771 TTATCCAGGGCCAATCACCATGG + Intronic
1042858191 8:73288247-73288269 TCTTTGTGGGCCCACCTCCATGG - Intergenic
1046243553 8:111530145-111530167 TCATTCTGGGCTAACATCCAGGG - Intergenic
1048506557 8:135027072-135027094 TCCTACTGGGCTAATCTCCTGGG + Intergenic
1048711072 8:137211293-137211315 TCATTTTGCACCAATGTCCAAGG - Intergenic
1050397473 9:5214554-5214576 CCATGCTGGGCCAAACACCATGG + Intergenic
1050424628 9:5500799-5500821 TCCTTCTGGGCAAAGGTCCAAGG + Intergenic
1051508692 9:17853168-17853190 TCATTCTAGACATATCTCCAGGG + Intergenic
1052507042 9:29369182-29369204 TCATTTTGGGTAAATCTTCATGG + Intergenic
1053397827 9:37790407-37790429 TCATTCTGGACTATTCACCAAGG + Intronic
1053661934 9:40290469-40290491 GCCCTCTGGGCCAATCTCAAAGG - Intronic
1053912384 9:42920632-42920654 GCCCTCTGGGCCAATCTCAAAGG - Intergenic
1054374060 9:64436705-64436727 GCCCTCTGGGCCAATCTCAAAGG - Intergenic
1054522675 9:66085815-66085837 GCCCTCTGGGCCAATCTCAAAGG + Intergenic
1055825262 9:80315781-80315803 TCATTCTGGGTGACTCTACAGGG + Intergenic
1056355515 9:85797787-85797809 TCATCCTGGGCCACACACCACGG + Intergenic
1057078245 9:92152240-92152262 CAATTCTGGGCAAGTCTCCAGGG + Intergenic
1057867764 9:98694626-98694648 TAATTCTGGGCCATTCTCTCAGG - Intronic
1057942735 9:99299072-99299094 TCATTTTGAGCAAATTTCCAAGG + Intergenic
1058013450 9:100003879-100003901 TGGTTCTAGGCCAGTCTCCATGG - Intronic
1059225736 9:112671409-112671431 CAATTCTGGGCCATTATCCAAGG - Intergenic
1060314775 9:122499345-122499367 TCATGCCAGGCAAATCTCCAGGG - Intergenic
1192207520 X:69106213-69106235 TCATTCTGGGTCCATTTCCCAGG + Intergenic
1192364134 X:70456782-70456804 TCCCTCTGGACCAGTCTCCAGGG - Intronic
1196890940 X:120290315-120290337 TCACTCTGAGGCAGTCTCCATGG - Intronic
1197369348 X:125607206-125607228 TCAATTTGGGACAATTTCCAAGG - Intergenic
1201567002 Y:15375750-15375772 TCTTTCTTGGCCAATCACCAGGG - Intergenic
1201567029 Y:15375902-15375924 TCTTCCTGGGCCAGTCACCAGGG - Intergenic